CN117925699A

CN117925699A - Method for establishing gentiana macrophylla VIGS silencing system and application

Info

Publication number: CN117925699A
Application number: CN202410143562.5A
Authority: CN
Inventors: 何懿菡; 岳正刚; 尹洋洋; 梁格格
Original assignee: Shaanxi University of Chinese Medicine
Current assignee: Shaanxi University of Chinese Medicine
Priority date: 2024-02-01
Filing date: 2024-02-01
Publication date: 2024-04-26

Abstract

The invention relates to the technical field of plant genetic engineering, and particularly discloses a method for establishing a gentiana macrophylla VIGS silencing system and application thereof, wherein pTRV2 is firstly obtained by converting a gentiana macrophylla tissue by agrobacterium tumefaciens through EGFP-GmPDS recombinant plasmid, and the conversion effect can be observed through green fluorescent protein. The invention successfully establishes a VIGS silencing system in the gentiana macrophylla, so that the GmPDS gene expression level in the gentiana macrophylla is reduced, the carotenoid content is reduced, and the contents of loganin and gentiopicroside which are main medicinal components in the gentiana macrophylla are improved. The method is simple and quick in operation, avoids the complicated process of stable genetic transformation, effectively solves the problem of verifying the gene function of the gentiana macrophylla, and provides technical basis for excavating and verifying the functions of the gene of the important property of the gentiana macrophylla, the disease-resistant gene and the gene of the related enzyme of biogenic synthesis.

Description

Method for establishing gentiana macrophylla VIGS silencing system and application

Technical Field

The invention relates to the technical field of plant genetic engineering, in particular to a method for establishing a gentiana macrophylla VIGS silencing system and application thereof.

Background

The gentiana macrophylla, which is originally carried in Shen nong Ben Cao Jing, has the effects of dispelling wind and removing dampness, regulating blood and relaxing tendons, clearing heat and promoting urination. It can be used for treating rheumatalgia, tendons and bones spasm, jaundice, hematochezia, hectic fever due to bone steaming, infantile malnutrition, and dysuria. Modern researches have shown that the main secondary metabolite in gentiana macrophylla is secoiridoid glycoside compounds represented by gentiopicroside. The gentiana macrophylla circulating in the current medicinal material market is divided into two resources, namely wild and cultivated. The wild gentiana macrophylla is listed as a national third-level important protection wild medicinal material, and resources are less. And the quality of the cultivated gentiana macrophylla is good and uneven, and the cultivation is limited by factors such as growth years, planting technology, price fluctuation and the like, so that the planting enthusiasm of farmers is generally low. Therefore, on one hand, the research on the mechanism of the generation mechanism of the medicinal components of the gentiana macrophylla needs to be quickened, and the breeding of the fine variety of the gentiana macrophylla is promoted. On the other hand, active ingredients such as gentiopicroside and the like can be produced in large scale by utilizing a biotechnology regulation means, and the barrier brought by the limitation of gentiana macrophylla resources is broken through. However, these have not been studied on the function of the related genes in gentiana macrophylla.

At present, under the rapid development of a high-throughput sequencing technology, genome information and transcriptome information of the gentiana macrophylla are obtained, massive gene data are obtained, but many genes related to the accumulation of the medicinal components of the gentiana macrophylla are not clear, the genes related to the excellent properties of varieties are relatively slow to study the functions of the corresponding genes, and the research system capable of efficiently and rapidly identifying the functions of the genes is mainly lacking, and the establishment of the VIGS technology in the gentiana macrophylla shortens the research period of the functions of the genes. VIGS (virus induced GENE SILENCING ) refers to that a plant is infected with a virus carrying a target gene fragment, the endogenous gene silencing of the plant is induced, the phenotype change is caused, and then the function of the target gene is studied according to the phenotype change. Compared with the traditional gene function analysis method, the method has the following advantages: ① Is simple and quick. The VIGS can silence and analyze functions of target genes after the plants are infected, so that long and complicated experimental processes for stable transformation of the plants can be avoided; ② High silencing efficiency. Because the plant virus has high-efficiency replication and diffusion capacity, the silencing inducer (SILENCING INDUCER) carried in the virus vector can rapidly accumulate and trigger gene silencing, thereby realizing high-efficiency gene silencing effect. And when the single-stranded T-DNA enters plant cells, the expression of the single-stranded T-DNA is not influenced by the gene position and gene silencing, and a plurality of free exogenous genes which are not integrated into the plant genome can be expressed, so that the expression efficiency is higher. ③ Is safe and effective. The method is not influenced by the growth and development process of plants, inheritable offspring are not generated, the risk of gene drift is avoided, and the result is reliable and visual. The VIGS technology is used for researching functional genes of disease resistance reaction, growth and development and metabolic regulation of plants such as tobacco, tomatoes, camptotheca acuminata, catharanthus roseus and the like. However, the VIGS technique has not been applied to the medicinal plant gentiana macrophylla.

Disclosure of Invention

In order to realize efficient and rapid identification of the gentiana macrophylla gene function, the invention provides a method for establishing a gentiana macrophylla VIGS silencing system by taking the gentiana macrophylla GmPDS as a target interference gene. After the gentiana macrophylla VIGS silence GmPDS genes, gmPDS gene expression level is reduced, carotenoid content is reduced compared with a control, and the contents of loganin and gentiopicroside which are main medicinal components in the gentiana macrophylla are obviously higher than the control, which indicates that the invention successfully interferes with GmPDS gene expression and obtains corresponding characters, and indicates that a VIGS silencing system is successfully established and applied in the gentiana macrophylla. In addition, the pTRV2 used in the invention is that the EGFP vector carries enhanced green fluorescent protein, if EGFP is successfully expressed, fluorescence can be observed, which indicates that the vector is successfully injected into the gentiana macrophylla tissue, and a method for researching gene functions in the gentiana macrophylla by using a VIGS system is feasible. The system provides technical basis for digging and verifying the functions of the gene of the important character of the gentiana macrophylla, the disease-resistant gene and the gene of the related enzyme of biogenic synthesis.

The invention provides a method for establishing a gentiana macrophylla VIGS silencing system, which comprises the following steps:

S1, construction of pMD 19-T-GmPDS: extracting total RNA of gentiana macrophylla, carrying out reverse transcription to obtain cDNA, and carrying out amplification by taking the cDNA as a template and GmPDS-F and GmPDS-R as primers to obtain a CDS full-length sequence of GmPDS gene (GmPDS CDS full-length nucleotide sequence is shown as SEQ ID NO. 9), and then connecting with a pMD19-T vector to obtain a plasmid pMD19-T-GmPDS;

S2, pTRV2, construction of EGFP-GmPDS recombinant plasmid: using plasmid pMD19-T-GmPDS as a template, using GmPDS-pTRV2-F and GmPDS-pTRV2-R as primers to amplify and obtain GmPDS gene fragment (the nucleotide sequence of GmPDS gene fragment is shown as SEQ ID NO. 10), and then connecting with linearized pTRV2:EGFP vector by a one-step cloning method to obtain pTRV2:EGFP-GmPDS recombinant plasmid;

the pTRV2 EGFP vector is obtained by inserting green fluorescent protein EGFP at 1053bp of the pTRV2 vector;

S3, agrobacterium injection method is used for transforming gentiana macrophylla leaves: pTRV2 EGFP-GmPDS recombinant plasmid is transferred into GV3101 agrobacterium tumefaciens to be competent, bacterial liquid is obtained after culture, and gentiana macrophylla tissues are transformed by injection.

Further, in S1, the nucleotide sequence of the GmPDS-F primer is shown as SEQ ID NO. 1;

the nucleotide sequence of GmPDS-R is shown as SEQ ID NO. 2.

Further, in S1, the full-length sequence amplification system of CDS of GmPDS gene is: 5. Mu.L of template cDNA, gmPDS-F1.5. Mu.L, gmPDS-R1.5. Mu.L, 25. Mu.L of Premix Taq ^TM enzyme, ddH ₂ O17. Mu.L.

Further, in S2, the nucleotide sequence of the GmPDS-pTRV2-F primer is shown as SEQ ID NO. 7;

The nucleotide sequence of the GmPDS-pTRV2-R primer is shown as SEQ ID NO. 8.

Further, in S2, the reaction system for connecting the GmPDS gene fragment with the linearized pTRV2:EGFP vector is as follows: gmPDS Gene fragment 3. Mu.L, linearized pTRV2 vector 1. Mu.L, 2X Samless Cloning. Mu.L, nucleic FREE WATER. Mu.L.

In S3, the injection method is used for transforming the gentiana macrophylla leaves, wherein the injection pTRV1+pTRV2:EGFP bacterial liquid is used as a control group, and the injection pTRV1+pTRV2:EGFP-GmPDS is used as an experimental group.

Further, the expression level of GmPDS genes in the gentiana macrophylla VIGS silencing system is reduced, and the carotenoid content is reduced.

The invention also provides the application of the gentiana macrophylla VIGS silencing system established by the method in the accumulation of the content of medicinal components, the contents of loganin and gentiopicroside in the conversion system of the gentiana macrophylla VIGS silencing GmPDS gene are obviously increased, and the silencing plant obtains corresponding characters.

Furthermore, the pTRV2 is the green fluorescent protein EGFP of the EGFP vector, and the injection condition and the expression condition of the vector can be observed through fluorescence after the EGFP vector is injected into the gentiana macrophylla tissue.

Further, the gentiana macrophylla tissue is any one of leaf, fruit, flower, stem, root or callus.

The invention also provides application of the construction method of the transgenic gentiana macrophylla in preparation of medicines, and after the GmPDS genes are silenced by utilizing the VIGS, the content of the medicinal components of loganin and gentiopicroside in the gentiana macrophylla is increased. The VIGS silence GmPDS gene improves the drug effect of the transgenic gentiana macrophylla, thereby improving the drug effect of the preparation of the medicine by using the gentiana macrophylla.

Compared with the prior art, the invention has the beneficial effects that:

1. according to the invention, a VIGS silencing system is constructed in the gentiana macrophylla by utilizing a VIGS technology, gmPDS gene expression analysis shows that the PDS gene expression amounts in the gentiana macrophylla seedling leaves and the gentiana macrophylla callus in the experimental group are lower than those in the control group, and the carotenoid content in the gentiana macrophylla seedling leaves in the 5d, 10d and 15d injection experimental groups is measured to be lower than that in the control group, so that the VIGS system is successfully established in the gentiana macrophylla, and a good silencing effect is obtained.

The detection and analysis show that the content of loganin and gentiopicroside in the gentiana macrophylla VIGS silencing system is obviously higher than that of no-load, and the content of the gentiopicroside is obviously accumulated on the 30 th day, which indicates that the gentiana macrophylla VIGS silencing GmPDS gene promotes the increase of main active ingredients of the system and has practical significance for promoting the accumulation of the content of secondary metabolites of the medicinal plant gentiana macrophylla.

The invention has short experimental period, simple method and low cost, and lays a good foundation for the rapid identification of the gene function of the gentiana macrophylla.

2. The VIGS system constructed based on tobacco embrittlement virus (TRV) is the most widely used transient silencing system today. The system relies on positive control, namely, the gene related to chlorophyll and carotenoid synthesis in plants is interfered, so that new leaves of infected plants show whitening or yellowing effects, whether the virus vectors are infected successfully or not is determined, the gene silencing effects of the virus vectors in different plants and under different conditions can be different, and the time of occurrence of the whitening phenotype can be different due to different plant growth periods, so that the whitening phenomenon is probably not obvious or can not be observed, and the subsequent experimental study is influenced. The pTRV2 used in the invention is that the EGFP carrier is provided with enhanced green fluorescent protein EGFP, and whether the carrier is successfully injected into gentiana macrophylla tissues can be judged through fluorescence observation equipment. Fluorescence can be observed when EGFP is successfully expressed, which indicates that the vector is successfully injected into gentiana macrophylla tissues, and the target vector is normally expressed, which indicates that the infection of the viral vector is successful.

Drawings

In order to more clearly illustrate the embodiments of the invention or the technical solutions in the prior art, the drawings that are required in the embodiments or the description of the prior art will be briefly described, it being obvious that the drawings in the following description are only some embodiments of the invention, and that other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 shows pTRV 2. EGFP vector map.

FIG. 2 is a schematic diagram of a full-length sequence PCR amplification electrophoresis bar of GmPDS genes; in the figure, M is DL2000 DNA MARKER; 1. 2: gmPDS full-length sequence PCR amplification band of gene.

FIG. 3 is an electrophoretogram of GmPDS gene VIGS silencing vector construction process;

in the figure, A is GmPDS gene fragment PCR amplification electrophoresis diagram; wherein, 1, 2: gmPDS PCR amplification of the gene fragment; the amplification primer is GmPDS-F/R;

B is pTRV2, EGFP vector linearization electrophoresis; wherein, 1: pTRV2 after BamHI and EcoI double cleavage: the pTRV2 without enzyme cutting is an EGFP vector;

c is pTRV2, EGFP-GmPDS recombinant vector escherichia coli bacterial liquid PCR amplification electrophoresis chart; wherein, 1, 2: pTRV2 is EGFP-GmPDS recombinant vector escherichia coli bacterial solution PCR amplification strip, and the primer used for bacterial solution PCR is pTRV2-F/R;

D is pTRV2, EGFP carrier agrobacterium tumefaciens bacterial liquid PCR amplification electrophoresis chart; wherein, 1, 2: the PCR amplification strip of the agrobacterium tumefaciens bacterial solution of the pTRV2 vector, wherein the primer used for the bacterial solution PCR is pTRV2-F/R;

E is a PCR amplification electrophoresis chart of the pTRV1 vector agrobacterium tumefaciens liquid; wherein, 1, 2: pTRV1 carrier bacterial liquid PCR amplification strip, wherein the primer used for bacterial liquid PCR is pTRV1-F/R;

F is pTRV2, EGFP-GmPDS recombinant vector agrobacterium tumefaciens bacterial liquid PCR amplification electrophoresis chart; and (3) injection: 1. 2: pTRV 2. EGFP-GmPDS recombinant vector Agrobacterium solution PCR amplified band, and the primer used in the bacterial solution PCR is pTRV2-F/R.

FIG. 4 is a view of blade fluorescence; wherein A is a control group of EGFP bacterial liquid injected with pTRV1+pTRV2; B. c is blank group without bacterial liquid injection.

FIG. 5 is a graph showing the effect of silencing GmPDS gene on carotenoid accumulation.

Fig. 6 shows gene expression analysis of gentiana macrophylla GmPDS gene silencing plants (P <0.05; P <0.01; P < 0.001).

FIG. 7 is the effect of silencing GmPDS genes on loganin and gentiopicroside;

in the figure, A is the effect of silencing GmPDS gene on loganin acid;

B is the influence of the silencing GmPDS gene on gentiopicroside.

FIG. 8 is a PCR amplification electrophoresis diagram of the carrier bacterial liquid;

a is a PCR amplification electrophoresis chart of a pTRV1 vector agrobacterium tumefaciens bacterial liquid; wherein, 2: pTRV1 carrier bacterial liquid PCR amplification strip, wherein the primer used for bacterial liquid PCR is pTRV1-F/R;

B is pTRV2, EGFP carrier agrobacterium tumefaciens bacterial liquid PCR amplification electrophoresis chart; wherein, 1, 2: pTRV 2. EGFP vector Agrobacterium solution PCR amplified band, and the primer used in the bacterial solution PCR is pTRV2-F/R.

FIG. 9 is a fluorescent observation of callus; wherein A, B is a control group, and pTRV1+pTRV2 is injected into the bacterial solution of EGFP; C. d is a blank group without bacterial liquid injection.

Detailed Description

The following detailed description of specific embodiments of the invention is, but it should be understood that the invention is not limited to specific embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention. The experimental methods described in the examples of the present invention are conventional methods unless otherwise specified, and materials, reagents, etc. used in the examples described below are commercially available.

Example 1: a method for establishing a VIGS silencing system in Gentiana macrophylla leaf and application thereof are provided.

1. Experimental materials and instruments

The experimental reagents are shown in Table 1, and the experimental instruments are shown in Table 2.

TABLE 1 Experimental reagents

Preparing an LB culture medium: tryptone and sodium chloride are added in an amount of 10g per 1L of water, and yeast powder is added in an amount of 5g per 1L of water.

Preparation of 10×TAE electrophoresis liquid: tris 48.4g, EDTA3.7224g and glacial acetic acid 11.42mL are added to each 1L of water.

Table 2 laboratory apparatus

2. Experimental method

Cloning of GmPDS Gene CDS full Length

RNA extraction and cDNA synthesis: extracting total RNA of gentiana macrophylla by using a polysaccharide polyphenol plant total RNA extraction kit, detecting the integrity by 1% agarose gel electrophoresis, and detecting the concentration and purity of RNA by Nanodrop. And after the total RNA quality is qualified, reversing the extracted total RNA by using PRIMESCRIPT ^TM IV 1st strand cDNA Synthesis Mix reverse transcription kit to obtain cDNA, and preserving at-20 ℃ for later use.

1. Primer design and Synthesis

Full length primers for GmPDS gene were designed using PRIMER PREMIER software and synthesized by the company limited by the biological engineering (Shanghai) and the sequences of the primers are shown in Table 3.

TABLE 3 GmPDS Gene CDS full-length amplification primer sequences

Numbering device	Primer name	Primer sequence (5 '-3')
			SEQ ID NO.1	GmPDS-F	AGCACCTTTATCCTTTCTTTTGG
SEQ ID NO.2	GmPDS-R	GTAGCATAATATAGTGCCTTCG

2. Amplification and recovery of CDS region of GmPDS Gene

The CDS full-length sequence of GmPDS gene was PCR amplified using the cDNA obtained as described above as a template and the sequence shown in Table 3 as a primer according to the amplification system shown in Table 4 and the amplification procedure shown in Table 5.

TABLE 4 GmPDS Gene PCR amplification System

Component (A)	Volume of
		Template cDNA	5μL
GmPDS-F(10μm)	1.5μL
		GmPDS-R(10μm)	1.5μL
Premix Taq ^TM enzyme	25μL
		RNase Free ddH₂O	17μL
Total volume of	50μL

TABLE 5 GmPDS PCR amplification procedure for genes

After amplification is completed, the PCR product is subjected to 1% agarose gel electrophoresis detection, a rapid agarose gel DNA recovery kit is adopted to recover and purify the CDS full-length sequence of GmPDS genes, and the recovery solution is stored at the temperature of minus 20 ℃ for standby.

(II) construction of pMD19-T-GmPDS

1. Ligation of the fragment of interest with T vector

And (3) connecting the CDS full-length sequence of the recovered GmPDS gene with a pMD19-T vector by using a pMD19-T Vector Cloning Kit kit to obtain a recombinant T vector connecting solution. The reaction system is shown in Table 6.

Table 6 GmPDS Gene and T vector ligation reaction System

Component (A)	Volume of
		Gene fragment of interest	3μL
Linearization carrier	1μL
		2×Samless Cloning	10μL
Nuclease free water	6μL
		Total volume of	20μL

2. Colibacillus transfer, plasmid extraction and sequencing

A. taking out the E.coli DH5 alpha-competence preserved at-80 ℃ and melting on ice.

B. respectively adding 10 mu L of recombinant T vector connecting solution into the competence of the escherichia coli, and lightly blowing and beating uniformly.

C. The mixture was placed on ice for 25min, heat-shocked at 42℃for 42s, and immediately placed on ice for 2min.

D. to the tube, 700. Mu.L of LB medium without antibiotics was added, and the mixture was shaken at 37℃and 200rpm for 1 hour.

E.5000rpm for 1min, sucking out the excessive supernatant, leaving 100. Mu.L of bacterial liquid, and re-suspending the bacterial cells. A sterile coating bar was applied to LB medium containing Kana (50. Mu.g/mL).

F. The plates were incubated overnight in an incubator at 37℃with the plates inverted.

G. to a clean 1.5mL centrifuge tube was added 1mL of LB medium (containing 50. Mu.g/mL Kana).

H. picking up the monoclonal bacteria on the LB plate by using a sterile gun head, placing in the LB culture solution for a plurality of seconds, taking out, shaking the bacteria for 5-8 hours at 37 ℃ and 150rpm, and taking out when the bacteria solution is turbid.

I. and (3) performing PCR detection on the bacterial liquid, and performing plasmid extraction after propagating the bacterial liquid with positive results.

J. Plasmid pMD19-T-GmPDS was extracted using the plasmid extraction kit and sent to the sequencing industry.

(III) VIGS silencing GmPDS

1. Verification of pTRV1 and pTRV2 EGFP plasmid

PTRV1 and pTRV2 were subjected to the amplification system of Table 8 and the amplification procedure of Table 9, respectively, by transferring the EGFP vector to E.coli DH 5. Alpha. To competent cells, and extracting plasmids, and PCR-amplifying the pTRV1 plasmid fragments using pTRV1-F and pTRV1-R of Table 7 as primers.

PTRV 2. EGFP vector verification method is the same, and the primers used are pTRV2-F and pTRV2-R. Sequencing verifies that it is correct for subsequent experiments.

PTRV 2. EGFP vector is obtained by inserting 720bp enhanced green fluorescent protein EGFP in 1053bp position of pTRV2 vector, and the vector map is shown in figure 1.

Table 7 primers for verification of plasmids

Numbering device	Primer name	Primer sequence (5 '-3')
			SEQ ID NO.3	pTRV1-F	AGATACGCCTGGGTTCATTC
SEQ ID NO.4	pTRV1-R	GGTAAAATCGCCTTCAATGT
			SEQ ID NO.5	pTRV2-F	TATTATTACGGACGAGTGGAC
SEQ ID NO.6	pTRV2-R	ACCTAAAACTTCAGACACGGA

TABLE 8 PCR amplification System for plasmid fragments

Component (A)	Volume of
		Template CDNA	2μL
Primer-F (10. Mu.M)	0.8μL
		Primer-R (10. Mu.M)	0.8μL
Premix Taq^TM	10μL
		RNase Free ddH2O	6.4μL
Total volume of	20μL

TABLE 9 plasmid fragment PCR amplification procedure

2. GmPDS Gene VIGS vector construction

(1) Primer design

Primers were designed according to the homologous recombination primer design method and synthesized by the division of biological engineering (Shanghai) Co., ltd, and the primer information is shown in Table 10.

TABLE 10 pTRV2: primer used for EGFP-GmPDS vector construction

Numbering device	Primer name	Primer sequence (5 '-3')
			SEQ ID NO.7	GmPDS-pTRV2-F	GAAGGCCTCCATGGGTTCACTTTGCTGCCTTCT
SEQ ID NO.8	GmPDS-pTRV2-R	GGACATGCCCGGGCCCACCTCCAATGGCTTATT

(2) PCR amplification target gene and cut gel recovery

The GmPDS gene fragment was PCR amplified using the plasmid pMD19-T-GmPDS as a template and GmPDS-pTRV2-F and GmPDS-pTRV2-R of Table 10 as primers according to the amplification system of Table 11 and the amplification procedure of Table 12. After amplification, the PCR product is subjected to 1% agarose gel electrophoresis detection, the GmPDS gene fragment is recovered and purified by adopting a rapid agarose gel DNA recovery kit, and the recovery solution is placed at the temperature of minus 20 ℃ and is preserved for standby.

Table 11 GmPDS Gene fragment PCR amplification System

Component (A)	Volume of
		Template	5μL
Upstream primer (10 μm)	2μL
		Downstream primer (10 μm)	2μL
Premix Taq^TM	25μL
		RNase Free ddH₂O	16μL
Total volume of	50μL

Table 12 GmPDS Gene fragment PCR amplification procedure

(3) Carrier linearization

The pTRV2: EGFP vector is linearized by XhoI and BamHI restriction enzyme, 30 mu L of pTRV2: EGFP plasmid, 1 mu L of BamHI, 1 mu L of XhoI,10 mu L Cutsmart buffer and 58 mu L of ddH ₂ O are taken, placed in a 1.5mL clean centrifuge tube, blown and mixed uniformly, centrifuged for 3-5s, and the reagent is enriched with the bottom of the tube at room temperature overnight.

(4) Construction of pTRV2: EGFP-GmPDS recombinant vector

Connecting the recovered GmPDS gene fragment with a linearization pTRV2:EGFP vector by adopting Seamless Cloning Kit seamless cloning kit, reacting for 20min at 55 ℃, and connecting the GmPDS gene fragment with the pTRV2:EGFP vector to obtain the recombinant plasmid pTRV 2:EGFP-GmPDS. The reaction system is shown in Table 13.

TABLE 13 GmPDS Gene fragment and pTRV2:EGFP vector ligation reaction System

Component (A)	Volume of
		GmPDS target gene fragment	3μL
PTRV2 EGFP linearization vector	1μL
		2×Samless Cloning	10μL
Nuclease free water	6μL
		Total volume of	20μL

(5) The pTRV2 EGFP-GmPDS recombinant plasmid was transformed into E.coli, extracted and sequenced according to the procedure described above.

3. Agrobacterium injection method for transforming gentiana macrophylla leaves

(1) Agrobacterium tumefaciens

A. the GV3101 Agrobacterium-competent cells were removed from the cells and stored at-80℃and dissolved in ice.

B. Adding 10 μl of plasmid liquid (pTRV 2: EGFP-GmPDS recombinant plasmid) into the competent of GV3101 agrobacterium, gently blowing uniformly, and sequentially placing on ice for 5min, liquid nitrogen for 5min, and metal bath at 28deg.C for 5min, and ice bath for 5min.

C. 700. Mu.L of LB (without antibiotics) was added and the culture was continued at 28℃for 2-3 hours with shaking.

Centrifugation was performed at 6000rpm for 1min to leave 100. Mu.L of the bacterial liquid, and the bacterial cells were resuspended. The sterile coating rod is coated on LB culture medium, and the incubator is inverted at 28 ℃ for about 3 days.

PTRV1, pTRV2. EGFP plasmid transformation of Agrobacterium was carried out as described above.

(2) Preparation of agrobacterium inoculation bacterial liquid

And (3) respectively picking agrobacterium tumefaciens single colonies containing pTRV1, pTRV2: EGFP and recombinant plasmids (pTRV 2: EGFP-GmPDS), inoculating into LB (containing Kan 50 mug/mL and rib 50 mug/mL), shaking to obtain bacterial liquid, and carrying out colony PCR verification by taking the bacterial liquid as a template. The transformed Agrobacterium was activated 3 times until the OD ₆₀₀ of the bacterial solution was about 0.8, and the bacterial cells were collected by centrifugation, and resuspended in 50ml of a resuspension MS (containing 10mM MgCl, 10mM MES, 100. Mu.M AS). Then, the mixture is placed at 28 ℃ and kept stand for 3 hours in a dark place, and then pTRV1 bacterial liquid is uniformly mixed with pTRV2 EGFP bacterial liquid and recombinant plasmid pTRV2 EGFP-GmPDS bacterial liquid according to the proportion of 1:1 (v/v) for inoculation.

(3) Inoculation of Agrobacterium solution

Selecting seedlings of gentiana macrophylla with good growth condition and consistent growth vigor, manufacturing a wound on the back of the leaves of the gentiana macrophylla by using a syringe needle, injecting inoculation bacterial liquid into the leaves by using a syringe in a mode of pressing injection at the wound, enabling the bacterial liquid to diffuse into the whole leaves, injecting two leaves into each seedling, and culturing under the same condition after injection is completed. Firstly, culturing for 24 hours under dark conditions, and then culturing under 12 hours of illumination and 12 hours of dark conditions. The EGFP bacterial liquid with the injection pTRV1+pTRV2 is used as a control group, the EGFP-GmPDS with the injection pTRV1+pTRV2 is used as an experimental group, and 60 strains are injected into each group. The blank group was not injected with bacterial liquid.

4. Carotenoid content determination

And respectively taking the control group (pTRV1+pTRV2: EGFP bacterial liquid) and the experimental group (pTRV1+pTRV2: EGFP-GmPDS bacterial liquid) for 6h, 5d, 10d and 15d of gentiana macrophylla leaves for carotenoid content measurement, and verifying whether the VIGS system is successfully established in the gentiana macrophylla. The method comprises the following steps:

(1) Respectively taking fresh gentiana macrophylla leaves, cleaning the surfaces of the leaves, shearing, and uniformly mixing;

(2) 100mg was precisely weighed into a 25mL volumetric flask, 96% ethanol was added to 15mL, and left overnight under dark conditions with shaking several times.

(4) When the leaves are soaked until the leaves are all whitened, 96% ethanol is added to a constant volume of 25ml, and the leaves are uniformly mixed.

(5) 200UL of the extracting solution is absorbed in a 96-well plate, 96% ethanol of a leaching reagent is used as a blank, absorbance is measured, and wavelengths of 470nm, 649nm and 665nm are selected; each group was 3 parallel.

(6) The concentrations of chlorophyll a, chlorophyll b, carotenoids were calculated according to the following formula:

C_{Chlorophyll a}＝13.95×A₆₆₅-6.88A₆₄₉

C_{Chlorophyll b}＝24.69×A₆₄₉-7.32A₆₆₅

C_Carotenoids＝(1000×A₄₇₀-2.05×C_{Chlorophyll a}-114.8×C_{Chlorophyll b})/245

5. Gene expression analysis

Taking leaves of gentiana macrophylla seedlings 6h, 5d, 10d and 15d after injection, extracting RNA, and performing reverse transcription to obtain cDNA. And carrying out expression analysis on GmPDS genes in leaves to verify whether the VIGS system is successfully established in the gentiana macrophylla.

Gene expression analysis method: RT-qPCR was performed using a Germany Yes fluorescent quantitative gradient PCR apparatus qTOWER2.0 with SAND1 as the reference gene and the primer information as shown in Table 14. The reaction system: 2. Mu.L of template cDNA, TB Green Premix Ex Taq. Mu.L, 0.8. Mu.L of upstream primer (10 μm), 0.8. Mu.L of downstream primer (10 μm) and water were added to make up to 20. Mu.L. Reaction conditions: 95 ℃,30 s of pre-denaturation, 95 ℃, 5s,60 ℃,30 s,40 cycles. The relative gene expression level was calculated by 2 ^-ΔΔCt method in 3 replicates of each group.

TABLE 14 RT-qPCR primer sequences

Gene name	Upstream primer sequence (5 '-3')	Downstream primer sequence (5 '-3')
			GmPDS	TCTTCACCACGCCCGAATAAGC	GCCGTAGTCAAACCAGCCAAAC
SAND1	TTCATGGTGATTCTCCAGC	TTCAAGGAAGATGACAACC

6. Determination of loganin acid and gentiopicroside content

(1) Preparation of sample solutions

And respectively taking 15d and 30d leaves of gentiana macrophylla seedlings after the injection of empty pTRV1+pTRV2, EGFP and pTRV1+pTRV2, EGFP-GmPDS bacterial liquid, and measuring the content of secondary metabolites. Cutting the leaves, ultrasonically extracting for 3 times, adding 1mL of methanol each time for 40min, centrifuging at 12000rpm for 5min, collecting supernatant, mixing the 3 supernatants, evaporating to dryness, adding 1mL of methanol for dissolving, and filtering with 0.22 μm filter membrane to obtain sample solution.

(2) HPLC chromatographic conditions

Chromatographic column (Welch, 4.6X105 mm,5 μm), mobile phase 0.1% phosphoric acid water (A) acetonitrile (B), elution gradient 0-13 min,11% B, 13-16 min,10% B,16 min-30 min,12% B, flow rate 0.8mL/min, detection wavelength 254nm, sample injection amount 20. Mu.L, column temperature 30 ℃.

(3) Preparation of mixed standard solution and linear relation

Precisely weighing standard substances of 1.12mg of loganin, 1.13mg of swertiamarin, 2.05mg of gentiamarin and 1.26mg of swertiamarin respectively, dissolving in methanol in a 1mL volumetric flask, fixing the volume to 1mL, and uniformly mixing to obtain mixed standard substance solution mother liquor with mass concentration of 1.12mg/mL of loganin, 1.13mg/mL of swertiamarin, 2.05mg/mL of gentiamarin and 1.26mg/mL of swertiamarin. And diluting the prepared mixed standard solution mother solution with methanol according to multiple to prepare standard solutions with different concentration gradients. The sample concentration (X, g.mL ^-1) and the peak area (Y) are subjected to linear regression according to the HPLC chromatographic conditions of (2), a standard curve is drawn, the linear relation is examined, and the correlation coefficient R ² of the four measured standards is larger than 0.999, which shows that the linear relation is good (Table 15).

TABLE 15 Linear relationship between loganin acid and gentiopicroside standard

Standard substance	Regression equation	Correlation coefficient R ²	Linear range mg/mL
				Loganin acid	Y＝9313169.91X+52842.65	0.9996	4.38×10^-3～1.12
Gentiopicroside	Y＝10348224.18X+124625.728	0.9995	8.01×10^-3～2.05

3. Experimental results

1. Establishment of VIGS technology in gentiana macrophylla

(1) GmPDS Gene cloning

The full-length sequence of CDS of GmPDS (shown as SEQ ID NO. 9) is amplified by RT-PCR using gentiana macrophylla cDNA as a template, and 1% agarose gel electrophoresis detection (shown as figure 2) is carried out, so that a band consistent with GmPDS (2291 bp) fragment size in the gentiana macrophylla transcriptome data is obtained. The recombinant plasmid pMD19-T-GmPDS is connected with a T vector through a pMD19-T Vector Cloning Kit kit, transformed into escherichia coli, extracted into plasmid and sent to a sequencing process. The sequencing result is consistent with GmPDS sequence comparison results in transcriptome data, and can be used for subsequent experiments.

SEQ ID NO.9：

ATGTCACAATTGGGACACATATCAGCTGTTAACATAGGTAGACAAGGCAATGCTGTTTGTGTTTGGAACTCGCAAACAGCATCTATGGGCGGGTATCGTTTTTGTTCAGAGCAAAGGAATTCGCGTTTACTACGAAGCAGTGATGTGATAAGTCATAAACTGAATGTTCCAGCTATCAAGCGAGCAAGCAAGTGTGCAAGCCCTTTAAAGGTGGTTTGTATAGACTATCCAAGACCTGAACTTGACAACACTGTGAATTATTTGGAAGCTGCTTACTTATCCTCCTCATTTCGTTCTTCACCACGCCCGAATAAGCCATTGGAGGTGGTCATTGCGGGTGCAGGTTTGGCTGGTTTGACTACGGCAAAGTACTTAGCGGATGCAGGTCATAAACCTATTCTACTGGAAGCAAGAGATGTTCTAGGAGGAAAGGTTGCTGCATGGAAGGATGATGATGGGGACTGGTATGAAACAGGCTTACATATATTCTTTGGGGCATACCCAAATGTGCAGAACTTGTTTGGAGAGCTAGGAATTAACGATCGATTGCAGTGGAAAGAACATTCTATGATATTTGCTATGCCAAATAAACCTGGAGAATTCAGTCGATTTGATTTTGCAGAGGTTTTACCTGCACCATTAAACGGAATATGGGCCATTTTGAAGAACAATGAAATGCTTACTTGGCCTGAGAAAGTTAAGTTTGCAATTGGACTCGTGCCCGCGATTCTTGGTGGACAGCCTTATGTTGAGGCACAAGATGGTATAACTGTCAAAGACTGGATGAGAAAGCAAGGTGTACCTGATCGGGTGACAGAAGAGGTATTCATTGCTATGTCAAAAGCTTTGAACTTTATAAATCCCGACGAACTCTCCATGCAGTGCATCTTGATTGCTTTGAACAGATTTCTTCAGGAGAAACATGGTTCTAAAATGGCCTTTTTAGACGGTAATCCTCCAGAAAGACTCTGCATGCCAATTGCTGATCACATCCAATCACGAGGAGGTGAAGTACGACTTAACTCGCGAATACAGAGGATCGAGCTTAATGAAGATGGAAGCGTGGAAAGCTTCGTTCTAAATAATGGCTCGGTTATAAAAGGAGATGCTTATGTATTTGCTACTCCAGTTGATACCCTAAAACTTCTTTTGCCTGATGAATGGAAAGAGATTTCATACTTCAGAAAATTGGATAAATTAGTTGGGGTGCCAGTCATAAATATCCACATATGGTTTGATAGAAAACTGAAAAACACATATGATCATCTTCTTTTTAGCAGGAGTCCACTTCTCAGTGTGTATGCAGACATGTCTGTCACGTGTAAGGAATATTACAATCCAAACCAGTCCATGTTGGAGCTAGTTTTTGCACCTGCAGAAGAATGGGTATCACGAAGTGACTCAGAAATCGTGGAAGCCACGATGAAGGAACTGGCAAAACTCTTTCCAGATGAAATTGCTGCAGATCAGAGCAAAGCAAAGATCTTGAAGTACCATGTTGTAAAAACTCCAAGGTCTGTTTACAAAACTGTTCCGGGCACGGAACCTTGCCGTCCATTACAAAGATCTCCAATAAAAGGATTCTATTTAGCTGGTGACTACACAAAGCAGAAGTATTTGGCTTCTATGGAAGGTGCTGTTTTATCTGGAAAGTTTTGTGCACAAGCTATTGTACAGGATTACGAGTTGCTTCGTGCAGGAGCACGGAGTAAGCTAGCAGAAGCAAGCATTCCAAACTGA

2. Construction of GmPDS Gene VIGS silencing vector

According to GmPDS gene clone to obtain full-length sequence, designing primer required by construction of VIGS silencing vector, using pMD19-T-GmPDS recombinant plasmid as template, making PCR amplification to obtain GmPDS gene fragment (sequence is shown as SEQ ID NO. 10), 1% agarose gel electrophoresis detection, and the detection result is shown as A of figure 3, and is identical with 444bp of GmPDS gene fragment. The pTRV2: EGFP vector was digested with the endonucleases BamHI and XhoI, and 1% agarose gel electrophoresis was performed, and the detection results were shown as B in FIG. 3, indicating that linearization of the pTRV2: EGFP vector was completed. Then Seamless Cloning Kit the seamless cloning kit recombines GmPDS gene fragment with linearization vector pTRV2: EGFP, the recombined vector pTRV2: EGFP-GmPDS is transferred into colibacillus, monoclonal PCR is identified, the identification result is shown as C of figure 3, and the fragment size is consistent with the expected result. And (3) after the bacterial liquid with positive results is propagated, extracting plasmids, carrying out sequencing by a worker, and completely conforming the sequencing result to the expected sequence. The recombinant vector with correct sequencing result, pTRV2: EGFP vector and pTRV1 vector are respectively transferred into GV3101 agrobacterium, colony PCR is verified, 1% agarose gel electrophoresis detection is carried out, and the detection results are D, E and F in FIG. 3, which show that the recombinant vector pTRV2: EGFP-GmPDS, pTRV2: EGFP vector and pTRV1 vector are respectively successfully transferred into GV3101 agrobacterium. The pTRV1 bacterial solution and pTRV2:EGFP bacterial solution were mixed at a ratio of 1:1 (v/v) (referred to as pTRV1+pTRV2:EGFP bacterial solution).

SEQ ID NO.10：

GAAGGCCTCCATGGGTTCACTTTGCTGCCTTCTTTTTTTTGTTATTCTTTGAGTGGAACTGCAATTCAAGAACTGCAGTTGGGCGGCTTTCAATTTTCTACAAGCACCAGGGTTTTGGTTGAATTGGGCAAAATGTCACAATTGGGACACATATCAGCTGTTAACATAGGTAGACAAGGCAATGCTGTTTGTGTTTGGAACTCGCAAACAGCATCTATGGGCGGGTATCGTTTTTGTTCAGAGCAAAGGAATTCGCGTTTACTACGAAGCAGTGATGGGATAAGTCATAAACTGAATGTTCCAGCTATCAAGCGAGCAAGCAAGTGTGCAAGCCCTTTAAAGGTGGTTTGTATAGACTATCCAAGACCTGAACTTGACAACACTGTGAATTATTTGGAAGCTGCTTACTTATCCTCCTCATTTCGTTCTTCACCACGCCCGAATAAGCCATTGGAGGTGGGCCCGGGCATGTCC

3. Successful establishment of VIGS system in gentiana macrophylla

The results of fluorescence detection of the leaves of Gentiana macrophylla in the blank group (not injected) and the control group (pTRV1+pTRV2: EGFP bacterial liquid) show (as shown in figure 4) that the leaves of the control group have obvious fluorescence intensity, but the blank group does not have fluorescence intensity, which indicates that EGFP fluorescent protein is normally expressed, and the agrobacterium transformation is successful, and the method is feasible.

The carotenoid content measurement is carried out by taking the injection pTRV1+pTRV2:EGFP bacterial liquid as a control group and the injection pTRV1+pTRV2:EGFP-GmPDS bacterial liquid as an experimental group, taking the leaves of the gentiana macrophylla seedlings after 6h, 5d, 10d and 15d injection, and the result shows (as shown in figure 5) that the carotenoid content measurement in the leaves of the gentiana macrophylla seedlings in the 5d, 10d and 15d injection experimental group is lower than that in the control group, and the time phase is the maximum at 5 d.

The leaf blades of the gentiana seedlings of 6h, 5d, 10d and 15d after injection are taken for carrying out GmPDS gene expression analysis, and the result shows (as shown in figure 6) that the GmPDS gene expression quantity in the leaf blades of the gentiana seedlings in the experimental groups of 0d, 5d, 10d and 15d is lower than that in the control group. Taken together, it is shown that the VIGS system was successfully established in gentiana macrophylla.

4. Influence of the silencing GmPDS Gene on loganin and gentiopicroside

As shown in FIG. 7, the plants with the EGFP-GmPDS bacterial liquid silencing the gentiana macrophylla GmPDS gene by injecting pTRV1+pTRV2 are significantly higher than the control group in 15 th and 30 th day of the total content of the nueleaid (A in FIG. 7) and gentiopicroside (B in FIG. 7), and the content is significantly accumulated in 30 th day.

When GmPDS gene expression was inhibited, carotenoids were significantly reduced at day 5, indicating that the VIGS system could significantly reduce expression of the target gene and the target metabolite. The carotenoid content increased from day 10 but was still lower than the control. This suggests that metabolites continue to be produced and accumulated as plants grow, but are affected by VIGS interference GmPDS, and that the carotenoid content in the silenced plants is less than the control increase, and that the VIGS system was successfully established in gentiana macrophylla.

The carotenoid is used as a tetraterpenoid, is consistent with the starting path of monoterpene compounds such as gentiopicroside and loganin acid, starts with MEP and MVA, and synthesizes the same product IPP, and the IPP can be isomerized into an isomer DMAPP. Starting from IPP, metabolic pathway is shunted, IPP generates GPP to synthesize monoterpene, IPP and GPP generate FPP to synthesize sesquiterpene, FPP generates GGPP to synthesize diterpenoid. Thus, upon intervention of the PDS gene, the diterpene pathway metabolic flux was reduced, the carotenoid content was reduced, and the monoterpene metabolic flux was enhanced, thus resulting in a significant increase in the content of the 30 th day nueleonic acid and gentiopicroside compounds, and above the control. The interference GmPDS gene reduces the synthesis of tetraterpene compounds, which in turn promotes the accumulation of monoterpene compounds, and the VIGS system can be used for the identification and research of the functions of gentiana macrophylla genes.

Example 2: a method for establishing VIGS silencing system in gentiana macrophylla callus.

1. Experimental materials and instruments

The experimental reagents and apparatus were as in example 1.

2. Experimental method

1. Verification of pTRV1 and pTRV2 EGFP plasmid

The procedure is as in example 1.

2. Agrobacterium injection method for transforming gentiana macrophylla leaves

(1) Agrobacterium tumefaciens

B. 10 mu L (pTRV 1 or pTRV2: EGFP) of plasmid liquid is added into the competent Agrobacterium of GV3101, and the mixture is gently blown to be uniform and placed on ice for 5min, liquid nitrogen for 5min, and metal bath at 28 ℃ for 5min, and ice bath for 5min.

C. 700. Mu.L of LB (without antibiotics) was added and the culture was continued at 28℃for 3 hours with shaking.

(2) Preparation of agrobacterium inoculation bacterial liquid

And respectively picking agrobacterium tumefaciens single colonies containing pTRV1 and pTRV2: EGFP, inoculating the agrobacterium tumefaciens single colonies into LB (containing Kan 50 mug/mL and rib 50 mug/mL), shaking to obtain bacterial liquid, and performing colony PCR verification by taking the bacterial liquid as a template. The transformed Agrobacterium was activated 3 times until the OD ₆₀₀ of the bacterial solution was about 0.8, and the bacterial cells were collected by centrifugation, and resuspended in 50ml of a resuspension MS (containing 10mM MgCl, 10mM MES, 100. Mu.M AS). Then, the mixture was left to stand at 28℃in the dark for 3 hours, and then the pTRV1 bacterial liquid and pTRV2:EGFP bacterial liquid were mixed in a ratio of 1:1 (v/v) (referred to as pTRV1+pTRV2:EGFP bacterial liquid) and used for inoculation.

(3) Inoculation of Agrobacterium solution

And (3) selecting gentiana macrophylla callus with good growth condition and consistent growth condition, injecting inoculation bacterial liquid into the tissue by using a syringe needle, enabling the bacterial liquid to diffuse the whole callus, and culturing under the same condition after injection is completed. Firstly, culturing for 24 hours under dark conditions, and then culturing under 12 hours of illumination and 12 hours of dark conditions. The EGFP bacterial liquid is used as a control group, and the non-injected bacterial liquid is used as a blank group.

3. Experimental results

1. Bacterial liquid transformation verification

PTRV1 vector and pTRV2: EGFP vector are respectively transferred into GV3101 agrobacterium, colony PCR is verified, 1% agarose gel electrophoresis detection is carried out, and detection results shown as A and B in FIG. 8 respectively indicate that pTRV1 vector and pTRV2: EGFP vector are respectively successfully transferred into GV3101 agrobacterium.

2. Fluorescence microscopic observation

The fluorescent detection is carried out on the callus of the control group by using the blank group (not injected) and the injected pTRV1+pTRV2 EGFP bacterial liquid, and the result shows (as shown in figure 9) that the callus of the control group has obvious fluorescent intensity, which indicates that the fluorescent protein EGFP is normally expressed, and the blank group does not have fluorescent intensity, which indicates that the bacterial liquid is successfully injected in the callus, and indicates that the application of the VIGS method in the gentiana macrophylla callus is feasible.

While preferred embodiments of the present invention have been described, additional variations and modifications in those embodiments may occur to those skilled in the art once they learn of the basic inventive concepts. It is therefore intended that the following claims be interpreted as including the preferred embodiments and all such alterations and modifications as fall within the scope of the invention.

It will be apparent to those skilled in the art that various modifications and variations can be made to the present invention without departing from the spirit or scope of the invention. Thus, it is intended that the present invention also include such modifications and alterations insofar as they come within the scope of the appended claims or the equivalents thereof.

Claims

1. The method for establishing the gentiana macrophylla VIGS silencing system is characterized by comprising the following steps of:

pMD19-T-GmPDS construction: amplifying by using gentiana macrophylla DNA as a template and GmPDS-F and GmPDS-R as primers to obtain a CDS full-length sequence of GmPDS genes, and then connecting with a pMD19-T vector to obtain a plasmid pMD19-T-GmPDS;

pTRV 2. EGFP-GmPDS recombinant plasmid construction: using plasmid pMD19-T-GmPDS as a template, using GmPDS-pTRV2-F and GmPDS-pTRV2-R as primers to amplify and obtain GmPDS gene fragments, and then connecting the GmPDS gene fragments with a linearized pTRV2:EGFP vector to obtain a recombinant plasmid pTRV2:EGFP-GmPDS;

Agrobacterium injection to transform gentiana macrophylla leaves: pTRV2 EGFP-GmPDS recombinant plasmid is transferred into GV3101 agrobacterium tumefaciens to be competent, bacterial liquid is obtained after culture, and gentiana macrophylla tissues are transformed by injection.

2. The method for establishing a gentiana macrophylla VIGS silencing system according to claim 1, wherein the nucleotide sequence of the GmPDS-F primer is shown as SEQ ID No. 1;

the nucleotide sequence of GmPDS-R is shown as SEQ ID NO. 2.

3. The method for establishing a gentiana macrophylla VIGS silencing system according to claim 2, wherein the CDS full-length sequence amplification system of GmPDS genes is as follows: 5. Mu.L of template cDNA, gmPDS-F1.5. Mu.L, gmPDS-R1.5. Mu.L, 25. Mu.L of Premix Taq ^TM enzyme, ddH ₂ O17. Mu.L.

4. The method for establishing a gentiana macrophylla VIGS silencing system according to claim 1, wherein the nucleotide sequence of the GmPDS-pTRV2-F primer is shown as SEQ ID No. 7;

The nucleotide sequence of the GmPDS-pTRV2-R primer is shown as SEQ ID NO. 8.

5. The method for establishing a gentiana macrophylla VIGS silencing system according to claim 4, wherein the reaction system for connecting the GmPDS gene fragment with the linearized pTRV2:egfp vector is as follows: gmPDS Gene fragment 3. Mu.L, linearized pTRV2, EGFP vector 1. Mu.L, 2X Samless Cloning. Mu.L, nucleic FREE WATER. Mu.L.

6. The method for establishing a gentiana macrophylla VIGS silencing system according to claim 4, wherein the injection method is used for transforming gentiana macrophylla leaves, wherein an injection pTRV1+pTRV2:EGFP bacterial liquid is used as a control group, and an injection pTRV1+pTRV2:EGFP-GmPDS is used as an experimental group.

7. The method for constructing a silencing system according to claim 1, wherein after the silencing GmPDS of the gentiana VIGS, the expression level of GmPDS is reduced and the carotenoid content is reduced.

8. Use of the gentiana macrophylla VIGS silencing system established by the method of claim 1 in gene function identification, wherein after the use of VIGS silencing GmPDS genes in the gentiana macrophylla, the content of the pharmacodynamic components of loganin and gentiopicroside is increased, and the silencing plant obtains corresponding characters.

9. The use according to claim 8, wherein the green fluorescent protein EGFP of pTRV 2/EGFP vector is used for observing the injection condition and the expression condition of the vector by fluorescence after the injection into the gentiana macrophylla tissue.

10. The use according to claim 8, wherein the gentiana macrophylla tissue is any one of leaf, fruit, flower, stem, root or callus.