CN117904306A - SNP molecular marker related to pig backfat thickness and lean meat percentage on chromosome 1 of pig and application thereof - Google Patents
SNP molecular marker related to pig backfat thickness and lean meat percentage on chromosome 1 of pig and application thereof Download PDFInfo
- Publication number
- CN117904306A CN117904306A CN202311646236.8A CN202311646236A CN117904306A CN 117904306 A CN117904306 A CN 117904306A CN 202311646236 A CN202311646236 A CN 202311646236A CN 117904306 A CN117904306 A CN 117904306A
- Authority
- CN
- China
- Prior art keywords
- pig
- lean meat
- pigs
- backfat thickness
- meat percentage
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 235000020997 lean meat Nutrition 0.000 title claims abstract description 59
- 210000000349 chromosome Anatomy 0.000 title claims abstract description 35
- 239000003147 molecular marker Substances 0.000 title claims abstract description 35
- 241000282887 Suidae Species 0.000 claims abstract description 51
- 238000009395 breeding Methods 0.000 claims abstract description 30
- 230000001488 breeding effect Effects 0.000 claims abstract description 29
- 230000035772 mutation Effects 0.000 claims abstract description 12
- 108700028369 Alleles Proteins 0.000 claims abstract description 10
- 238000000034 method Methods 0.000 claims description 13
- 239000002773 nucleotide Substances 0.000 claims description 9
- 125000003729 nucleotide group Chemical group 0.000 claims description 9
- 239000003795 chemical substances by application Substances 0.000 claims description 6
- 239000000654 additive Substances 0.000 claims description 5
- 230000000996 additive effect Effects 0.000 claims description 5
- 238000011144 upstream manufacturing Methods 0.000 claims description 5
- 108091028043 Nucleic acid sequence Proteins 0.000 claims description 4
- 238000012239 gene modification Methods 0.000 claims description 4
- 230000005017 genetic modification Effects 0.000 claims description 4
- 235000013617 genetically modified food Nutrition 0.000 claims description 4
- 238000012214 genetic breeding Methods 0.000 claims description 2
- 230000002068 genetic effect Effects 0.000 abstract description 7
- 238000005516 engineering process Methods 0.000 abstract description 6
- 230000008901 benefit Effects 0.000 abstract description 5
- 230000006872 improvement Effects 0.000 abstract description 5
- 241000282898 Sus scrofa Species 0.000 description 60
- 230000037396 body weight Effects 0.000 description 10
- 238000004458 analytical method Methods 0.000 description 8
- 108020004414 DNA Proteins 0.000 description 5
- 230000000694 effects Effects 0.000 description 5
- 238000001514 detection method Methods 0.000 description 4
- 235000015277 pork Nutrition 0.000 description 4
- 108090000623 proteins and genes Proteins 0.000 description 4
- 239000012634 fragment Substances 0.000 description 3
- 239000003550 marker Substances 0.000 description 3
- 230000008569 process Effects 0.000 description 3
- 238000012163 sequencing technique Methods 0.000 description 3
- 238000012098 association analyses Methods 0.000 description 2
- 238000012937 correction Methods 0.000 description 2
- 238000010219 correlation analysis Methods 0.000 description 2
- 238000007405 data analysis Methods 0.000 description 2
- 238000002474 experimental method Methods 0.000 description 2
- 238000003908 quality control method Methods 0.000 description 2
- 238000009394 selective breeding Methods 0.000 description 2
- 238000003307 slaughter Methods 0.000 description 2
- 238000012408 PCR amplification Methods 0.000 description 1
- 230000003321 amplification Effects 0.000 description 1
- 238000006243 chemical reaction Methods 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000004925 denaturation Methods 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 238000007865 diluting Methods 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 235000013305 food Nutrition 0.000 description 1
- 238000005194 fractionation Methods 0.000 description 1
- 230000008303 genetic mechanism Effects 0.000 description 1
- 238000012165 high-throughput sequencing Methods 0.000 description 1
- 238000009396 hybridization Methods 0.000 description 1
- 230000003601 intercostal effect Effects 0.000 description 1
- 238000004519 manufacturing process Methods 0.000 description 1
- 239000011159 matrix material Substances 0.000 description 1
- 238000005259 measurement Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 238000003199 nucleic acid amplification method Methods 0.000 description 1
- 108020004707 nucleic acids Proteins 0.000 description 1
- 150000007523 nucleic acids Chemical class 0.000 description 1
- 102000039446 nucleic acids Human genes 0.000 description 1
- 238000002205 phenol-chloroform extraction Methods 0.000 description 1
- 238000000513 principal component analysis Methods 0.000 description 1
- 230000001105 regulatory effect Effects 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 210000003765 sex chromosome Anatomy 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
- 210000001519 tissue Anatomy 0.000 description 1
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 1
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides an SNP molecular marker related to pig backfat thickness and lean meat percentage on a pig No. 1 chromosome and application thereof, belonging to the technical fields of molecular biotechnology and molecular markers, wherein the locus of the SNP molecular marker corresponds to G > A mutation at 36331868bp on an international pig reference genome 11.1 version No. 1 chromosome. The invention also provides a primer pair for identifying the molecular marker, and a high-efficiency and accurate molecular marker assisted breeding technology can be established by using the molecular marker and the primer pair, and the primer pair is applied to pig backfat thickness and lean meat percentage characteristic genetic improvement, so that dominant allele frequency can be increased generation by generation, pig genetic improvement progress is accelerated, and the economic benefit of breeding pigs is effectively improved.
Description
Technical Field
The invention belongs to the technical field of molecular biotechnology and molecular marking, and particularly relates to an SNP molecular marking which is positioned on a No. 1 chromosome of a pig and is related to pig backfat thickness and lean meat percentage and application thereof.
Background
Along with the improvement of the living standard of people, the demand for pork consumption is gradually changed from fat-type pigs to lean-type pigs, and the cultivation of high-quality lean-type pigs becomes an important target of pig breeding work. The lean meat percentage of pigs is one of important indexes for measuring the carcass quality of pigs, and in breeding work, the backfat thickness is commonly used as the information character of the lean meat percentage for breeding, and is an important component in a lean meat percentage estimation equation.
For a long time, the lean meat percentage is a complex quantitative trait regulated by multiple genes, and the phenotype is not easy to directly observe, so that the genetic progress is slow. With the development of high-throughput sequencing technology, whole genome association analysis (genome-wide Association Study, GWAS) becomes an important method for researching complex trait genetic mechanisms, breaks the bottleneck of screening important economic trait molecular markers, and combines the GWAS with molecular marker assisted selection (MARKER ASSISTED selection, MAS) technology to improve the backfat thickness and lean meat percentage of pigs at the same time, so that the genetic progress of the two traits can be effectively accelerated.
Du Changda (Duroc pig. Times. Long white pig. Times. Big white pig) is the commercially popular pig species worldwide due to its excellent performance in terms of growth rate, carcass performance, etc., duroc pig as its terminal father directly affects the long-growing productivity and carcass quality. The backfat thickness and lean meat percentage characters of the Duroc pigs in the core group are bred, and the genetic potential of the high-quality Duroc pigs is transferred to commercial pig groups, so that the production performance of commercial pigs can be greatly improved, and the economic benefit of pig raising enterprises is improved.
Disclosure of Invention
In order to overcome the defects and shortcomings of the prior art, the primary purpose of the invention is to provide an SNP molecular marker which is positioned on a pig chromosome 1 and is related to pig backfat thickness and lean meat percentage.
It is another object of the present invention to provide the use of the above SNP molecular marker on chromosome 1 of pig, which is related to backfat thickness and lean meat percentage of pig.
It is still another object of the present invention to provide a primer set for identifying the above SNP molecular markers on chromosome 1 of swine, which are related to backfat thickness and lean meat percentage of swine.
A fourth object of the present invention is to provide the use of the above primer pair.
A fifth object of the present invention is to provide a method for genetic modification of pigs.
The aim of the invention is achieved by the following technical scheme:
SNP molecular markers which are positioned on a chromosome 1 of a pig and are related to pig backfat thickness and lean meat percentage, wherein the SNP locus corresponds to G > A mutation at 36331868 th position on a chromosome 1 of an international pig reference genome version 11.1 reference sequence;
the nucleotide sequence of the SNP molecular marker which is positioned on the chromosome 1 of the pig and is related to the pig backfat thickness and lean meat percentage is shown as SEQ ID NO.1, wherein M in the sequence is G or A, which leads to the difference of the characteristics of the pig backfat thickness and the lean meat percentage;
The SNP locus of the SNP molecular marker which is positioned on the chromosome 1 of the pig and is related to the lean meat percentage and backfat thickness of the pig is the nucleotide mutation of G389-A389 (the single base mutation of 389 nucleic acid positioned on the fragment of the sequence is named as g.389G > A) of which the sequence mark position of SEQ ID NO.1 is 389;
The SNP molecular marker which is positioned on the chromosome 1 of the pig and is related to the lean meat percentage and the backfat thickness of the pig is applied to the identification of the backfat thickness and the lean meat percentage characteristics of the Duroc pig and the genetic breeding;
A method for detecting the characteristics of backfat thickness and lean meat percentage of pigs, comprising the following steps:
detecting the SNP molecular marker which is positioned on the chromosome 1 of the pig and is related to the lean meat percentage and the backfat thickness of the pig, wherein the 389 single nucleotide at the 5' end of the SNP molecular marker is G or A;
the pig is preferably Duroc of the additive system and the synthetic system thereof;
A primer pair for identifying the SNP molecular markers which are positioned on the chromosome 16 of the pig and are related to the lean meat percentage and backfat thickness of the pig, comprising primers primer-F and primer-R, wherein the nucleotide sequences of the primers are as follows:
Upstream primer-F:5'-GCCCTCTTTTGTTGATCTGCT-3';
downstream primer-R:5'-TGATGAGCTCAATGCCTCCT-3';
the primer pair is applied to identifying the characteristics of the backfat thickness and the lean meat percentage of pigs;
the primer pair is applied to pig molecular marker assisted breeding;
the primer pair is applied to reducing the backfat thickness of pigs and improving the lean meat percentage of the pigs;
a method of genetic modification of a pig comprising the steps of:
Determining the locus of the SNP molecular marker related to pig lean meat percentage and backfat thickness on the chromosome 1 of the breeding pigs in the core group of the breeding pigs, and making corresponding selection according to the molecular marker: selecting a pig breeder individual with AA genotype at 36331868bp on chromosome 1 of international pig reference genome 11.1 version 1 from the pig breeder core group, eliminating the pig breeder individual with GG genotype and AG genotype at the point, and increasing the frequency of allele A at the point by generation so as to reduce backfat thickness of the offspring pigs and increase lean meat percentage of the offspring pigs;
the pig is preferably Duroc of the additive system and the synthetic system thereof;
compared with the prior art, the invention has the following advantages and effects:
(1) The invention researches and determines that the molecular marker related to the back fat thickness and lean meat percentage of the pig is positioned on the nucleotide sequence of chromosome 1 of the pig, verifies the influence effect of the molecular marker on the back fat thickness and lean meat percentage of the pig, finally establishes a molecular marker assisted selective breeding technology for rapidly improving the back fat thickness and lean meat percentage of the pig, and applies the molecular marker assisted selective breeding technology to the genetic improvement of reducing the back fat thickness and improving the lean meat percentage of the breeding pig, thereby improving the carcass quality of offspring pigs, adapting to the demands of consumer markets and improving the economic profits of breeding enterprises.
(2) The invention provides a primer pair for identifying SNP molecular markers which are positioned on a chromosome 1 of a pig and are related to lean meat percentage and backfat thickness of the pig, and by the primer pair, a high-efficiency and accurate molecular marker assisted breeding technology can be established, so that the lean meat percentage and backfat thickness characteristics can be quickly and accurately bred, and the breeding process can be accelerated.
(3) The invention provides a pig breeding method by optimizing dominant alleles of the molecular marker, which can increase dominant allele frequency generation by generation, reduce backfat thickness of breeding pigs, improve lean meat percentage of the breeding pigs, and accelerate genetic improvement progress of the pigs so as to effectively improve economic benefit of breeding of the breeding pigs.
Drawings
FIG. 1 is a graph of a whole genome association (GWAS) analysis of the marker of Duroc of the addition line on chromosome 1 with respect to the backfat thickness trait of a breeding pig at a body weight of 100 kg; wherein: the abscissa indicates chromosome number of pigs; the ordinate represents-logP value;
FIG. 2 is a graph of genome-wide association (GWAS) analysis of the lean meat percentage trait of a breeding pig on chromosome 1 for 100kg body weight of Duroc of the addition line.
FIG. 3 is a graph of backfat thickness results analysis for pigs of different genotypes at a body weight of 100 kg.
FIG. 4 is a graph showing the analysis of lean meat percentage results of pigs of different genotypes at a body weight of 100 kg.
Detailed Description
The present invention will be described in further detail with reference to examples and drawings, but embodiments of the present invention are not limited thereto.
Experimental swinery: the experiment used 2090 head plus duroque altogether.
Example 1 specifically explaining the determination of lean meat percentage in the present invention
And finally measuring the backfat thickness of all the test pigs by using an Aloka SSD 500V type living B ultrasonic tester, wherein the measuring part is at the 10 th to 11 th intercostal position, and correcting the final measuring body reuse correction formula to 100kg. Lean meat percentage of post-slaughter Duroc pigs was determined by a New Zealand HGS (Hennessy Grading System) carcass fractionation system and their pre-slaughter live weights were corrected to 100kg using a correction formula.
The experimental pig group used in the invention is the pure-bred Duroc 2090 head of the Guangdong Wen food group stock limited pig division, and is the core group of the pig division, and the group genealogy record is detailed. The experiment selects the Duroc pigs of the additive system in the resource group, and the pig group can eat and drink water freely under the unified feeding standard, and feeds the pigs to 100+/-5 kg body weight.
Example 2 specifically explaining the inventive procedure for obtaining the gene markers in the present invention
(1) The extraction method of the DNA of the loop-like tissue of the Duroc pig of the addition system refers to the phenol-chloroform method for extracting the whole genome DNA. The DNA of the pure strain of Duroc population was subjected to quality detection and concentration measurement by using a Nanodrop-ND1000 spectrophotometer. The A260/280 ratio is 1.8-2.0, and the A260/230 ratio is 1.7-1.9, and the product is judged to be qualified. Finally, uniformly diluting the qualified DNA sample into 50 nanograms per microliter.
(2) Pig whole genome 50K SNP genotype detection and filling: geneSeek Genomic Profiler Porcine 50K SNP typing platform, using Illumina Infinium instructions and standard flow to carry out chip hybridization and result scanning. Genotype data were finally read by genome studio software. To increase the marker density and thus the success rate of identifying key mutation sites affecting the trait of interest, genotype data was populated using the SWIM database website. Quality control is performed on the obtained genotype filling data by PLINK v1.9, and SNP markers with P less than or equal to 10 -6 are checked with a reject detection rate of <90%, a minor allele frequency (mimor allel frequency, MAF) <1% or a deviation from Hardy-Weinberg Equilibrium, HWE, and SNPs on unknown positions and sex chromosomes are excluded with a reject detection rate of < 95%. The remaining 11388559 SNP markers and 2080 samples of the lean meat percentage quality control of 100kg body weight are used for subsequent data analysis; a backfat thickness of 100kg body weight remained 11388559 SNPs and 2080 samples for subsequent data analysis.
(3) Whole genome association (GWAS) analysis: because the relationship and the population layering effect may cause false positive of the result, the relationship matrix is constructed by GEMMA software before the association analysis, the principal component analysis is carried out by GCTA software, the population structure is corrected by using the first five principal components as covariates, and the GWAS analysis is carried out by a univariate mixed model of GEMMA software. The present invention refers to human genome significant thresholds, setting genome significant and chromosome significant thresholds to 5.00E-08 and 1.00E-06.
The GWAS analysis results are shown in fig. 1 and 2. From FIGS. 1 and 2, it is clear that in Duroc, there is a site in chromosome 1 that significantly affects the backfat thickness and lean meat percentage of 100kg, the strongest associated SNP is g.389G > A (P values are 3.61X10 -8 and 1.92X10 -7, respectively) (nucleotide 389 in SEQ NO.1, i.e. the G > A mutation at 36331868bp on chromosome 11.1 version 1 of the International pig reference genome).
(4) Correlation analysis of different genotypes with backfat thickness and lean meat percentage phenotype at 100kg body weight of the breeding pigs: according to Table 1, it is known that SNP locus g.389G > A of molecular marker (nucleotide 389 in SEQ NO.1, namely G > A mutation corresponding to 36331868bp on chromosome 11.1 version 1 of the international pig reference genome) is extremely obviously related to backfat thickness and lean meat percentage characteristics (P < 0.01), which indicates that the molecular marker obviously affects backfat thickness and lean meat percentage of pigs, and the auxiliary selection of SNP locus of pigs can reduce backfat thickness of the population, improve lean meat percentage and further accelerate the breeding process of lean meat type pigs. Further, as can be seen from tables 1,3 and 4, the GG and AG types are thicker than the AA type backfat and have lower lean meat percentage, which indicates that the GG and AG genotypes are unfavorable for the carcass quality of pigs, and the GG and AG types need to be phased out in the breeding process, so that the AA type breeding pigs are reserved, and the frequency of the allele A of the locus is increased from generation to generation.
TABLE 1 correlation analysis of SNP locus g.389G > A of molecular marker and trait
Example 3 specifically explaining the inventive procedure for detecting SNP markers
(1) The target fragment containing SNP loci which are obviously related to 100kg body weight backfat thickness and 100kg body weight lean rate of the Duroc of the adding line is a 684bp nucleotide sequence in chromosome 1, and the upstream and downstream primers for sequence amplification are primer-F and primer-R, wherein the nucleotide sequences are as follows:
Upstream primer-F:5'-GCCCTCTTTTGTTGATCTGCT-3';
Downstream primer-R:5'-TGATGAGCTCAATGCCTCCT-3'.
(2) System and condition setting for PCR amplification
A10. Mu.L system was configured in which 1. Mu.L of DNA sample, 0.3. Mu.L of upstream primer, 0.3. Mu.L of downstream primer, 5. Mu.L of PCR mix, 3.4. Mu.L of ddH 2 O, 5min of PCR conditions of 95℃pre-denaturation, 30s of 95℃denaturation, 30s of 64℃annealing, 30s of 72℃extension, total of 35 cycles, and finally extension at 72℃for 5min.
(3) Sequencing and identifying DNA sequences: sequence sequencing was performed in Shenzhen Hua big Gene technologies Co., ltd, and the gene fragment was tested for both the forward and reverse reactions. Comparing the detected sequence with NCBI genome sequence to obtain mutation of corresponding SNP locus, and sequencing the sequence as follows:
GCCCTCTTTTGTTGATCTGCTGCAGCAAGTGGGGTTGGTAATAATTGCACCTTACAAT
TCCAACTGGAAGATAGGTCTTTAGGATTATGGATATTTGTACAATCAACTATATTCTATTT
CAAGGATCACAAATATTCTATAGGTAGGAGTTTGATGGTACTACCTAATTATGTTTCTTAT
CTTTTCCTCACCTATAACTTCTTCTCCCTTATTTTTATCTGCTGTGAAACTTCAAAATGTT
ATCAAAAAGTATTTTCATAAGTAATATAGTCATTCAGCACTGAAGGAGAAAAAGTGCTT
CATATTTTATTTCTAGAATGTGATTTGCTGAGAAATCATAACCTTGATCATTTCTTTATACTTTGTTCATAGACTAGAAGAGAGAGAGM(G/A)CAAGAGTGTTGGCAAAATCACCTATA GCTAAAATGTTCAGCAGAAATGGGATCATCACAACACTGTAAATCAACTTACATCAATAAAACTTAAAAAATTAAAATTAAATGTATAATTCTTCTATGTATGAATTTATTCATTATACCTAGTACATAAACTTACCATTAAATATTGTTAAATTGAAAATTTTTTAAGCAAATAGTTTACAAAGCAAGTATTCAGGACTATTTATGATGTGTTTAAAAGTCAGAGAACTGCAAAATTTTATATGGGGAAGGAGGCATTGAGCTCATCA
Note that: m in the sequence is the mutation site, underlined (in brackets is the mutation base, is the allelic mutation), the sequence is shown in the beginning and end of the thick as the primer sequence binding position.
EXAMPLE 4 SNP site g.389G > A Effect analysis of molecular markers
As shown in Table 1, the effect of SNP site g.389G > A dominant allele (AA) was reduced by 0.76cm from GG backfat thickness average, and the lean average was increased by 0.77%. Therefore, by molecular marker assisted selection, pigs with genotypes GG and AG in a group are gradually eliminated, so that the allele frequency of the allele A can be obviously improved, the backfat thickness of the group is reduced, the lean meat percentage of the group is increased, the carcass quality of the pigs is improved, more high-quality commercial lean meat type pork can be obtained to meet the requirements of people on high-quality pork, the increase of the sales of pork is driven, and huge economic benefits are brought to enterprises.
The above examples are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above examples, and any other changes, modifications, substitutions, combinations, and simplifications that do not depart from the spirit and principle of the present invention should be made in the equivalent manner, and the embodiments are included in the protection scope of the present invention.
Claims (10)
1. An SNP molecular marker on a pig chromosome 1 related to pig backfat thickness and lean meat percentage, characterized in that the SNP locus corresponds to G > A mutation at 36331868bp on an international pig reference genome chromosome 11.1 version 1;
The nucleotide sequence of the SNP molecular marker which is positioned on the chromosome 1 of the pig and is related to the pig backfat thickness and lean meat percentage is shown as SEQ ID NO.1, wherein M in the sequence is G or A, and the difference of the characteristics of the pig backfat thickness and the lean meat percentage is caused.
2. The use of the SNP molecular markers on chromosome 1 of pigs associated with backfat thickness and lean mass percentage of pigs according to claim 1 for the identification of backfat thickness and lean mass percentage traits and genetic breeding of pigs.
3. A method for detecting the characteristics of backfat thickness and lean meat percentage of pigs, which is characterized by comprising the following steps:
Detecting the SNP molecular marker related to the backfat thickness and the lean meat percentage of the pig on the chromosome 1 of the pig, wherein the 389 th single nucleotide at the 5' end of the SNP molecular marker is G or A, and the G is eliminated to keep A.
4. The method for detecting the characteristics of backfat thickness and lean meat percentage of pigs according to claim 3, which is characterized in that:
the pig is Duroc of the additive system and its synthetic system.
5. A primer pair for identifying SNP molecular markers associated with pig backfat thickness and lean meat percentage on chromosome 1 of pigs, comprising primers primer-F and primer-R, the nucleotide sequences of which are as follows:
Upstream primer-F:5'-GCCCTCTTTTGTTGATCTGCT-3';
Downstream primer-R:5'-TGATGAGCTCAATGCCTCCT-3'.
6. Use of the primer pair of claim 5 for identifying backfat thickness and lean meat percentage traits of breeding pigs.
7. The use of the primer pair of claim 5 in pig molecular marker-assisted breeding.
8. The use of the primer pair of claim 5 for reducing the backfat thickness of a breeding pig and increasing the lean meat percentage of a breeding pig.
9. A method for genetic modification of pigs comprising the steps of:
Determining the site of the SNP molecular marker related to the backfat thickness and lean meat percentage of pigs on chromosome 1 of pigs according to claim 1 of the breeding pigs in the breeding pig core group, and making corresponding selection according to the molecular marker: the breeding pig is bred by subculturing the individual of the AA genotype at 36331868bp on chromosome 11.1 version 1 of the international pig reference genome, the individual of the GG and AG genotypes at the point are eliminated, so that the frequency of the allele A at the point is increased by generations, the backfat thickness of the offspring pig is reduced, and the lean meat percentage of the offspring pig is increased.
10. The method of genetic modification of pigs according to claim 9, wherein: the pig is Duroc of the additive system and its synthetic system.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311646236.8A CN117904306A (en) | 2023-12-04 | 2023-12-04 | SNP molecular marker related to pig backfat thickness and lean meat percentage on chromosome 1 of pig and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311646236.8A CN117904306A (en) | 2023-12-04 | 2023-12-04 | SNP molecular marker related to pig backfat thickness and lean meat percentage on chromosome 1 of pig and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN117904306A true CN117904306A (en) | 2024-04-19 |
Family
ID=90691317
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202311646236.8A Pending CN117904306A (en) | 2023-12-04 | 2023-12-04 | SNP molecular marker related to pig backfat thickness and lean meat percentage on chromosome 1 of pig and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN117904306A (en) |
-
2023
- 2023-12-04 CN CN202311646236.8A patent/CN117904306A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110257529B (en) | SNP molecular marker related to lean meat percentage, eye muscle area and eye muscle thickness on pig No. 6 chromosome and application | |
| CN110218798B (en) | SNP molecular marker located on pig chromosome 7 and related to eye muscle area and eye muscle thickness and application | |
| CN110117665B (en) | SNP molecular marker located on pig No. 16 chromosome and related to pig lean meat percentage and eye muscle area and application | |
| CN108676897B (en) | SNP marker influencing daily gain traits of pigs and application thereof | |
| CN110106255B (en) | Molecular marker located on pig No. 7 chromosome and related to Duroc pig daily gain trait and application | |
| CN106906303B (en) | SNP marker influencing pork quality traits and application thereof | |
| CN110541038A (en) | SNP molecular marker located on pig No.1 chromosome and related to daily gain of pig and application | |
| WO2018218857A1 (en) | Myh4 gene molecule marker for improved pork quality and use thereof in porcine genetic improvement | |
| CN108913779B (en) | SNP marker influencing daily gain traits of pigs and application thereof | |
| CN110468212B (en) | SNP (single nucleotide polymorphism) site related to content of fatty acid C14:0 on chromosome 19 of meat Simmental cattle and application | |
| CN114150070A (en) | SNP molecular marker related to chicken growth and slaughter traits, detection primer, kit and breeding method | |
| CN113699246B (en) | SNP molecular marker affecting pig feed conversion efficiency character and application thereof | |
| CN113564264A (en) | SNP molecular marker located on No. 14 chromosome of pig and related to number of stillbirths and litter size of sow and application thereof | |
| CN112941198B (en) | SNP marker for detecting pig eye muscle area and application thereof | |
| CN116286804A (en) | SNP molecular marker related to pig correction of backfat thickness of 115 kg body weight and application | |
| CN116144792A (en) | SNP molecular marker related to pig backfat thickness and application thereof | |
| CN114350818B (en) | Prolactin gene SNP molecular marker related to egg laying traits of Muscovy ducks and application thereof | |
| CN113699247B (en) | SNP molecular marker related to pig residual feed intake on pig chromosome 1 and application thereof | |
| CN112280874B (en) | Copy number variation molecular marker influencing pig backfat thickness on pig chromosome 11 and application | |
| CN113584185A (en) | SNP molecular marker located on pig chromosome 12 and related to piglet malformation number and application thereof | |
| CN117904306A (en) | SNP molecular marker related to pig backfat thickness and lean meat percentage on chromosome 1 of pig and application thereof | |
| CN113736890A (en) | SNP molecular marker related to Jian' er number and survival rate and application thereof | |
| CN113699248A (en) | SNP molecular marker related to pig backfat thickness and application thereof | |
| CN112266968B (en) | Copy number variation molecular marker influencing weight age in days and daily gain on pig chromosome 13 and application | |
| CN112458183B (en) | Copy number variation molecular marker on pig No. 3 chromosome and related to daily gain and weight and age on market of pig and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |