CN117887871A - Salmonella typhimurium molecular detection kit and non-diagnostic detection method - Google Patents

Abstract

The invention relates to the field of microorganism detection, in particular to a one-step CRISPR/Cas12B detection kit and a one-step CRISPR/Cas12B detection method for detecting salmonella typhimurium, wherein the kit comprises an F3 primer, a B3 primer, a FIP primer, a BIP primer, an LF primer, an LB primer, guide RNA, cas12B protein and a single-stranded nucleic acid reporter molecule; the nucleotide sequence of the F3 primer is shown as SEQ ID NO. 2; the nucleotide sequence of the B3 primer is shown as SEQ ID NO. 3; the nucleotide sequence of the FIP primer is shown as SEQ ID NO. 4; the nucleotide sequence of the BIP primer is shown as SEQ ID NO. 5; the nucleotide sequence of the LF primer is shown as SEQ ID NO. 6; the nucleotide sequence of the LB primer is shown as SEQ ID NO. 7; the nucleotide sequence of the guide RNA is shown as SEQ ID NO. 23; the single stranded nucleic acid reporter is 5 '-/6-FAM/CCCCCC/BHQ 1/-3' or 5'-/6-FAM/TTTTTTTT/BHQ1/-3'. The invention successfully develops a salmonella typhimurium detection kit, and the detection is carried out by adopting the kit, so that the nucleic acid amplification and the detection are synchronously carried out, and the uncapped detection is not needed.

Description

Salmonella typhimurium molecular detection kit and non-diagnostic detection method

Technical Field

The invention relates to the field of microorganism detection, in particular to a CRISPR (clustered regularly interspaced short palindromic repeats) detection kit for detecting salmonella typhimurium and a non-diagnostic detection method.

Background

Salmonella typhimurium (Salmonella Typhimurium, ST) is a common food-borne pathogen that is widely distributed and is extremely susceptible to wide spread by contaminated foods. In addition, ST is the major serotype of salmonella, leading to salmonellosis in humans and animals, and has high pathogenic capacity. . ST is considered to be one of two major strains that are not outbreaks of salmonella typhi infection (the other being salmonella enteritidis). Thus, the search for and improvement of early diagnosis methods for ST is of great importance for blocking the broad outbreak of food poisoning, maintaining the safety of life and property.

White-Kauffman serotyping has been a subtyping method for salmonella for 80 years, by which more than 2600 salmonella sera can be identified. However, this conventional method is time consuming, inaccurate, and insensitive. Currently, some rapid methods have been applied to ST detection such as immunochromatographic strip, enzyme-linked immunosorbent assay (ELISA), polymerase Chain Reaction (PCR), loop-mediated isothermal amplification (LAMP), etc., but these methods also have disadvantages of poor specificity, time consumption, complex sample pretreatment, high false positive result, or high cost. The results are still far from satisfactory. Therefore, there is an urgent need for a rapid, sensitive, specific method of ST detection.

At present, clustered regularly interspaced short palindromic repeats and their related protein (CRISPR/Cas) systems provide a promising approach for bacterial detection that can perform bypass-cleavage activities for non-target single-stranded RNAs and DNA recognition and cleavage of specific RNA-guided nucleases of the target sequence due to the attendant Cas effects (e.g., cas12aCas b and Cas13 a). In addition, some CRISPR/Cas-based platforms have been used for nucleic acid analysis, including SHERLOCK(Specific High-sensitivityEnzymatic ReporterUnLOCKing)、HOLMES(One-Hour-Low costMultipurpose highlyEfficient System)、DETECTR(DNAEndonuclease-TargetedCRISPRTrans Reporter) and the like. The HOLMES is transformed into HOLMESv pathogen detection platform by the group of Wangjin, and the platform adopts a one-step system to combine with LAMP amplification, so that target nucleic acid can be conveniently quantified, and cross contamination is avoided. In addition, a relevant one-step platform for food origin detection, such as listeria monocytogenes, is established. However, CRISPR-based ST-tube assays have not been reported.

Disclosure of Invention

The invention aims to provide a CRISPR-based salmonella typhimurium detection kit and a method thereof. In order to achieve the above object of the present invention, the following technical solutions are adopted:

One aspect of the invention relates to a CRISPR-based salmonella typhimurium detection kit comprising an F3 primer, a B3 primer, a FIP primer, a BIP primer, an LF primer, an LB primer, a guide RNA, a Cas12B protein, and a single-stranded nucleic acid reporter molecule; the nucleotide sequence of the F3 primer is shown as SEQ ID NO. 2; the nucleotide sequence of the B3 primer is shown as SEQ ID NO. 3; the nucleotide sequence of the FIP primer is shown as SEQ ID NO. 4; the nucleotide sequence of the BIP primer is shown as SEQ ID NO. 5; the nucleotide sequence of the LF primer is shown as SEQ ID NO. 6; the nucleotide sequence of the LB primer is shown as SEQ ID NO. 7; the nucleotide sequence of the guide RNA is shown as SEQ ID NO. 23; the single stranded nucleic acid reporter is 5 '-/6-FAM/CCCCCC/BHQ 1/-3' or 5'-/6-FAM/TTTTTTTT/BHQ1/-3'.

In a preferred embodiment of the invention, the kit further comprises a polymerase and dNTPs.

In a preferred embodiment of the invention, the kit further comprises: and (3) a buffer solution.

In a preferred embodiment of the present invention, the kit comprises, per 50. Mu.L:

In another aspect, the invention also relates to a method for detecting salmonella typhimurium based on CRISPR, the method comprising the steps of:

the sample to be detected is amplified by the kit, and the change of the fluorescent signal is measured.

In a preferred embodiment of the invention, the temperature detected is 56 ℃ to 60 ℃, preferably 57 ℃ to 59 ℃, more preferably 57.5 ℃ to 58.5 ℃.

In a preferred embodiment of the present invention, the nucleic acid amplification and detection in the detection method can be performed simultaneously without the need for uncovering in the middle.

The invention combines LAMP nucleic acid amplification and CRISPR/Cas12b nucleic acid detection into one step, and establishes a quick, sensitive and accurate ST detection method. Nucleic acid amplification and detection are performed simultaneously, and uncovering is not needed in the middle. Experimental results show that the salmonella typhimurium infection detection system is simple and accurate.

Drawings

Fig. 1 is a schematic diagram of the present invention.

FIG. 2 shows the LAMP primer screening results of Salmonella typhimurium in example 1.

Fig. 3 is a graph showing the results of a CRISPR-tube system screening of salmonella typhimurium of example 1 (NTC in the figure is a no-template negative control, supra).

Fig. 4 is a graph of experimental results of dose optimization of Cas protein and sgRNA for salmonella typhimurium CRISPR one-tube method of example 1.

Fig. 5 is a graph showing the results of a test for screening the reaction temperature of a salmonella typhimurium CRISPR-tube system of example 1.

FIG. 6 is a graph showing the results of a test for screening a reaction probe of a Salmonella typhimurium CRISPR one-tube system of example 1.

Fig. 7 is a graph of the results of a CRISPR-tube system sensitivity test for salmonella typhimurium of example 1.

Fig. 8 is a graph of the results of a CRISPR-tube system specificity test for salmonella typhimurium of example 1.

Detailed Description

Terminology

Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

The term "CRISPR" refers to clustered regularly interspaced short palindromic repeats (Clustered regularly interspaced short palindromic repeats) derived from the immune system of a microorganism.

The term "CRISPR-Cas": a unique bacterial and archaeal derived genomic element that serves as an adaptive immune defense system against invading phage or foreign nucleic acids. The system consists of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and CRISPR-associated proteins (Cas protein, cas for short).

The term "Cas protein" refers to a CRISPR-associated protein, which is a related protein in a CRISPR system. The "Cas protein" as described herein refers to CRISPR-associated proteins (some documents translate to CRISPR-Cas effect proteins, CRISPR/Cas effect proteins, CRISPR-Cas effectors, CRISPR/Cas effectors) which may be type V Cas proteins or type VI Cas proteins. A V-type Cas protein, which upon binding to a cis-cleaving substrate under guide RNA guidance forms a ternary complex of Cas protein-guide RNA-cis-cleaving substrate, can induce its trans-cleaving activity, i.e., randomly cleaving single-stranded nucleic acids and their equivalents (nucleic acid equivalents such as nucleic acid analogs). The Cas protein of this embodiment is a protein having trans-cleavage activity. In particular, cas proteins that are active, in particular trans-cleaving, are still active at temperatures higher than the temperatures of the systems in which the isothermal amplification reactions are carried out.

The term "Cas12 Sup>A" (formerly "Cpf 1") refers to crRNA-dependent endonucleases, which are enzymes of type V-Sup>A in the CRISPR system classification.

The terms "Cas12B", "C2C1" are used interchangeably to refer to sgRNA-dependent endonucleases, which are enzymes of type V-B in the CRISPR system classification.

The term "PAM" refers to a protospacer-adjacent motif (protospacer-adjacent motif), a short DNA sequence immediately adjacent to a CRISPR effector protein-targeted DNA sequence, necessary for Cas12a or Cas12b to cleave double-stranded DNA, e.g., PAM for Cas12a is TTTV, PAM for aacas 12b is TTN sequence.

The term "target DNA or RNA molecule", when a nucleic acid molecule is to be detected, is the DNA or RNA or a specific portion thereof to be detected; when non-nucleic acid molecules are to be detected, the target DNA or RNA molecule is a nucleic acid sequence that has been designed in advance.

The term "CRISPR one-step detection technology" (or simply one-step detection, one-tube detection and one-pot detection) is a rapid and convenient detection technology developed on the basis of a CRISPR molecular diagnosis system, and can synchronously realize amplification and detection of target nucleic acid in one reaction tube. The technology combines a CRISPR-Cas system and an isothermal amplification technology, does not need to perform uncapping operation on amplified nucleic acid products, and can specifically detect target nucleic acid in a short time. The CRISPR one-step detection technology is a rapid, accurate, high-sensitivity and high-specificity detection technology, is simple and convenient to operate, and can improve the detection specificity of the current isothermal amplification technology. Compared with the traditional PCR technology, the CRISPR one-step detection does not need complicated temperature control and multi-step operation, and has higher real-time performance and portability.

The term "system" is to be understood in a broad sense as a composition, product combination, reagent, kit, as well as an apparatus comprising the aforementioned composition, product combination, reagent, kit, as well as a mixture formed when the composition, product combination, reagent, kit is used for detection, as well as an apparatus comprising the aforementioned mixture, etc.

The term "system temperature" refers to the temperature of the system (the mixture formed when used for detection).

The term "guide RNA" is intended to mean either mature crRNA fused to tracrRNA as guide RNA, mature crRNA fused to scoutRNA as guide RNA, or crRNA alone as guide RNA.

In general, the guide RNA can comprise, consist essentially of, or consist of, a sequence of identical repeats (DIRECT REPEAT sequences, also known as DR sequences) and a guide sequence (spacer sequences) in the context of endogenous CRISPR systems. The gRNA may include crRNA and tracrRNA, or crRNA and scoutRNA, or may include crRNA alone, in different CRISPR systems, depending on the Cas protein on which it depends. The crRNA and tracrRNA may be fused by artificial engineering to form single guide RNA (sgRNA). In certain instances, the guide sequence is a polynucleotide sequence that has sufficient complementarity to the cis-cleaving substrate DNA to hybridize to the cis-cleaving substrate DNA and to direct specific binding of the CRISPR/Cas protein-guide RNA complex to the cis-cleaving substrate DNA, typically having a sequence length of 15-28 nt. The co-repeat sequence can be folded to form a specific structure (e.g., a stem-loop structure) for Cas protein recognition to form a complex. The targeting sequence need not be 100% complementary to cis-cleaving substrate DNA. The targeting sequence is not complementary to the nucleic acid in the trans-cleaving reporter.

In certain embodiments, when optimally aligned, the degree of complementarity (degree of matching) between the targeting sequence and its corresponding cis-cleaving substrate DNA is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%. It is within the ability of one of ordinary skill in the art to determine the optimal alignment. For example, there are published and commercially available alignment algorithms and programs such as, but not limited to, the smith-waterman algorithm (smith-waterman), bowtie, geneious, biopython, and SeqMan in ClustalW, matlab.

The terms "polynucleotide", "nucleotide sequence", "nucleic acid molecule" and "nucleic acid" are used interchangeably and include DNA, RNA or hybrids thereof, which may be double-stranded or single-stranded.

The term "homology" or "identity" is used to refer to the match of sequences between two polypeptides or between two nucleic acids. When a position in both sequences being compared is occupied by the same base or amino acid monomer subunit (e.g., a position in each of two DNA molecules is occupied by adenine, or a position in each of two polypeptides is occupied by lysine), then the molecules are identical at that position between the two sequences. Typically, the comparison is made when two sequences are aligned to produce maximum identity. Such an alignment can be determined by using, for example, amino acid sequence identity by conventional methods, with reference to, for example, the teachings of Smith and Waterman,1981,Adv.Appl.Math.2:482Pearson&Lipman,1988,Pro.Natl.Acad.Sci.USA85:244,Thompson etal.,1994,NucleicAcids Res 22:467380, et al, by computerized operation algorithms (GAP, BESTFIT, FASTA in Wisconsin Genetics software package, and TFASTA, genetics Computer Group). The BLAST algorithm available from (NCBI www.ncbi.nlm.nih.gov /) may also be used, using default parameters for determination.

The term "RPA" refers to the recombinase polymerase amplification technique (Recombinase PolymeraseAmplification, RPA); the term "RAA" refers to a recombinase-mediated strand-exchange nucleic acid amplification technique (RecombinaseAidedAmplification, RAA); the term "ERA" refers to an enzymatic recombinant isothermal amplification technique (Enzymatic RecombinaseAmplification, ERA). The term "MIRA" refers to a multi-enzyme isothermal rapid amplification technology (Multienzyme Isothermal RapidAmplification, abbreviated as MIRA), which is a isothermal nucleic acid rapid amplification technology, and realizes nucleic acid rapid amplification at normal temperature by means of the synergistic action of various functional proteins (helicase, recombinase, single-chain binding protein, DNA polymerase, etc.). Compared with other isothermal amplification technologies, the four isothermal amplification technologies have the advantages of milder reaction conditions, simpler primer design and the like, and the detection principle is similar.

The present embodiment provides an RNA. An RNA, the sequence of which is shown in SEQ ID NO. 23. The use of the RNA is as guide RNA for a detection method using the cis-or trans-cleavage activity of a Cas protein of the V-B type, or for the preparation of a composition for detection using the cis-or trans-cleavage activity of a Cas protein of the V-B type, or for the preparation of a product combination for detection using the cis-or trans-cleavage activity of a Cas protein of the V-B type, or for the preparation of a kit for detection using the cis-or trans-cleavage activity of a Cas protein of the V-B type, or for the preparation of a system for detection using the cis-or trans-cleavage activity of a Cas protein of the V-B type, said detection being a detection of salmonella typhimurium, preferably a one-tube detection of salmonella typhimurium.

On the basis of the RNA, a composition is provided, wherein the composition comprises a composition for CRISPR nucleic acid detection, and the composition for CRISPR nucleic acid detection comprises the following components: a V-B type Cas protein; a guide RNA, which is an RNA as described above, the sequence of which is shown in SEQ ID No. 23; a single stranded nucleic acid reporter.

The combination formula also comprises a composition for LAMP nucleic acid amplification, wherein the composition for LAMP nucleic acid amplification comprises a primer group, polymerase and dNTPs, and the primer group comprises the following primers:

1.1 F3 primer, wherein the nucleotide sequence of the F3 primer is shown as SEQ ID NO. 2;

1.2 A B3 primer, wherein the nucleotide sequence of the B3 primer is shown as SEQ ID NO. 3;

1.3 FIP primer, the nucleotide sequence of which is shown as SEQ ID No. 4;

1.4 A BIP primer, wherein the nucleotide sequence of the BIP primer is shown as SEQ ID NO. 5;

1.5 LF primer, wherein the nucleotide sequence of the LF primer is shown as SEQ ID NO. 6; and

1.6 And LB primer, wherein the nucleotide sequence of the LB primer is shown as SEQ ID NO. 7.

The use of the composition is for a detection method for cis-or trans-cleavage activity of a Cas protein of V-B type, or for preparing a product combination for detection of trans-cleavage activity of a Cas protein of V-B type, or for preparing a reagent for detection of trans-cleavage activity of a Cas protein of V-B type, or for preparing a kit for detection of trans-cleavage activity of a Cas protein of V-B type, or for preparing a system for detection of trans-cleavage activity of a Cas protein of V-B type, the detection being detection of salmonella typhimurium, preferably the detection is a one-tube detection of salmonella typhimurium.

On the basis of the RNA, a product combination is also provided, wherein the product combination comprises a product combination for CRISPR nucleic acid detection, and the product combination for CRISPR nucleic acid detection comprises the following components: a V-B type Cas protein; a guide RNA, which is an RNA as described above, the sequence of which is shown in SEQ ID No. 23; a single stranded nucleic acid reporter.

The V-B type Cas protein, guide RNA, and single stranded nucleic acid reporter molecule may be formed separately and then combined, or may be formed two by two and then combined, or may be formed together.

The product combination further comprises a product combination for LAMP nucleic acid amplification, the product combination for LAMP nucleic acid amplification comprising a primer set, a polymerase and dNTPs, the primer set comprising the following primers:

1.1 F3 primer, wherein the nucleotide sequence of the F3 primer is shown as SEQ ID NO. 2;

1.2 A B3 primer, wherein the nucleotide sequence of the B3 primer is shown as SEQ ID NO. 3;

1.3 FIP primer, the nucleotide sequence of which is shown as SEQ ID No. 4;

1.4 A BIP primer, wherein the nucleotide sequence of the BIP primer is shown as SEQ ID NO. 5;

1.5 LF primer, wherein the nucleotide sequence of the LF primer is shown as SEQ ID NO. 6; and

1.6 And LB primer, wherein the nucleotide sequence of the LB primer is shown as SEQ ID NO. 7.

The use of the above product combination is for a detection method utilizing the cis-or trans-cleavage activity of a Cas protein of the V-B type, or for the preparation of a reagent for detection utilizing the cis-or trans-cleavage activity of a Cas protein of the V-B type, or for the preparation of a kit for detection utilizing the cis-or trans-cleavage activity of a Cas protein of the V-B type, or for the preparation of a system for detection utilizing the cis-or trans-cleavage activity of a Cas protein of the V-B type, said detection being a detection of salmonella typhimurium, preferably said detection is a one-tube detection of salmonella typhimurium.

On the basis of the RNA, a reagent or a kit is provided.

A reagent or kit comprising a reagent for CRISPR nucleic acid detection, the reagent for CRISPR nucleic acid detection comprising: a V-B type Cas protein; a guide RNA, which is an RNA as described above, the sequence of which is shown in SEQ ID No. 23; a single stranded nucleic acid reporter.

In the kit, the V-B type Cas protein, the guide RNA and the V-B type Cas protein can be respectively contained in three containers, can be contained in two containers, and can be contained in the same container.

The reagent or the kit also comprises a reagent for LAMP nucleic acid amplification, wherein the reagent for LAMP nucleic acid amplification comprises a primer group, polymerase and dNTPs, and the primer group comprises the following primers:

1.1 F3 primer, wherein the nucleotide sequence of the F3 primer is shown as SEQ ID NO. 2;

1.2 A B3 primer, wherein the nucleotide sequence of the B3 primer is shown as SEQ ID NO. 3;

1.3 FIP primer, the nucleotide sequence of which is shown as SEQ ID No. 4;

1.4 A BIP primer, wherein the nucleotide sequence of the BIP primer is shown as SEQ ID NO. 5;

1.5 LF primer, wherein the nucleotide sequence of the LF primer is shown as SEQ ID NO. 6; and

1.6 And LB primer, wherein the nucleotide sequence of the LB primer is shown as SEQ ID NO. 7.

In the kit, the primer group, the polymerase and the dNTPs may be respectively contained in three containers, may be contained in two containers, or may be contained in the same container.

The reagent or kit further comprises: and (3) a buffer solution.

The use of the reagent or the kit is for a detection method using the cis-or trans-cleavage activity of a V-B type Cas protein or for preparing a system for detection using the cis-or trans-cleavage activity of a V-B type Cas protein, wherein the detection is detection of salmonella typhimurium.

A method for detecting salmonella typhimurium based on LAMP-CRISPR/Cas12b, comprising the steps of:

Contacting the sample to be tested with:

A composition as described above, or a combination of products as described above, or an agent as described above, or a kit as described above;

The change in signal is measured.

The V-B type Cas protein is Cas12B; the temperature for the detection is 56 to 60 ℃, preferably 57 to 59 ℃, more preferably 57.5 to 58.5 ℃.

In another preferred embodiment, the source of Cas12b is selected from the group consisting of: alicyclobacillus acidophilus (Alicyclobacillus acidiphilus), alicyclobacillus californicus (Alicyclobacillus kakegawensis), alicyclobacillus megaterium (Alicyclobacillus macrosporangiidus), bacillus V3-13 (Bacillus sp.v3-13), bacillus exovillans (Bacillus hisashii), bacillus (Bacillus), rhodobacter mucilaginosus (Lentisphaeriabacterium), vibrio most desulfur (Desulfovibrio inopinatus), renieratia (LACEYELLA SEDIMINIS), spirochete bacteria (Spirochaetes bacterium), cas12b (TcCas b) of Bacillus thermosiphon (Tuberibacillus calidus), or combinations thereof.

In another preferred embodiment, the Cas12b is selected from the group consisting of: cas12b (AaCas b) from alicyclobacillus acidophilus (Alicyclobacillus acidiphilus), cas12b (AkCas b) from alicyclobacillus californicus (Alicyclobacillus kakegawensis), cas12b (AmCas b) from alicyclobacillus megaterium (Alicyclobacillus macrosporangiidus), cas12b (BhCas b) from Bacillus exovillati (Bacillus hisashii), bsCas b from Bacillus, cas12b (Bs 3Cas12 b) from Bacillus V3-13 (Bacillus sp.v3-13), cas12b (DiCas 12 b) from vibrio most desulphus (Desulfovibrio inopinatus), cas12b (LsCas 12 b) from bordetella (LACEYELLA SEDIMINIS), cas12b (SbCas 12 b) from helicobacter (Spirochaetes bacterium), cas12b (TcCas b) from Bacillus thermogenic tumor (Tuberibacillus calidus).

In another preferred embodiment, the Cas12b is selected from the following group ：AapCas12b、AacCas12b、AaCas12b、BthCas12b、AkCas12b、AmCas12b、BsCas12b、Bs3Cas12b、LsCas12b、BvCas12b、BrCas12b、EbCas12b or a combination thereof.

Example 1

1. Experimental materials and methods

1.1 Laboratory apparatus

Table 1 laboratory apparatus

1.2 Experimental reagents

Table 2 experimental reagents

2. Experimental method

2.1, Salmonella typhimurium detection target selection

The reference materials and related sequences are analyzed and aligned, and the ST_STM4497 gene (SEQ ID NO. 1) is finally selected as a salmonella typhimurium specificity detection target, and a plasmid pUC57-ST_STM4497 containing the ST_STM4497 sequence is constructed.

PUC57-ST_STM4497 plasmid size: 2710bp+730 bp=3440 bp.

The concentration of 100. Mu. LTE diluted plasmid was determined using Qubit, the concentration average: 23.3 ng/. Mu.L.

The calculated concentration is: 6.28X10 ⁹ copies/. Mu.L.

2.2, Salmonella typhimurium LAMP primer design

LAMP primer design is carried out according to the selected salmonella typhimurium ST_ST4497 gene sequence, and the salmonella typhimurium ST_ST4497 LAMP primer design sequence is shown in Table 3.

Table 3 Salmonella typhimurium LAMP primers

2.3, Salmonella typhimurium LAMP primer screening

(1) LAMP primer mix preparation

The preparation of 10×LAMP primer mix was performed in the ratio of the amount of primers shown in Table 4 below, and if Loop primer (LF/LB) was not used in the LAMP primer, water without ribozyme was used instead of the corresponding volume ratio.

TABLE 410 LAMP primer mix formulation

(2) Salmonella typhimurium LAMP reaction system

Table 5 Salmonella typhimurium LAMP reaction System

Reagent name	Volume (mu L)
		10×LAMP buffer	2.5
dNTPmix(25mM)	1.4
		MgSO4(100mM)	1.75
10 XST_STM4497 LAMP primer mix	2.5
		Glycine (2M)	6
100×SYTO-9	0.25
		Bst enzyme	1
Nuclease-free water	7.1
		Template	2.5
Total amount of	25

The reaction procedure is: FAM fluorescent channel signals are collected every 30s at a constant temperature of 60 ℃, and the reaction time is 30min. LAMP primer screening was performed using the pUC57-ST_STM4497 plasmid quantified by digital PCR as a template.

Referring to FIG. 2, the best-performing LAMP primer for Salmonella typhimurium is ST_ST4497-LAMP-1, which has the earliest peak time of fluorescent signal and the latest time of nonspecific amplification signal. The LAMP primer was used in the subsequent experiments, and was ST_STM4497-LAMP-1 unless otherwise specified.

2.4 Salmonella typhimurium sgRNA design

According to the LAMP primer with better performance screened by salmonella typhimurium, corresponding Cas12b sgRNA design is carried out in the amplification fragment range, the sequence is shown in Table 6 in detail, and the underlined part sequence is the target sequence.

TABLE 6 Salmonella typhimurium sgRNA sequences

2.5, Establishment of a CRISPR one-tube method detection system for salmonella typhimurium

(1) Salmonella typhimurium Cas12b sgRNA in vitro transcription and purification

The Cas12b HIGH YIELD SGRNA SYNTHESIS AND Purification Kit (cat No. 31904, tolofo) of the ipecac organism was used for the in vitro transcription and Purification of Cas12b sgrnas, the specific procedure being shown below.

① DNA transcription template preparation

And after the annealing extension reaction of the Cas12b Sense Oligo in the Cas12b HIGH YIELD SGRNA SYNTHESIS AND Purification Kit and the ST_STm4497-sgRNA-R series primer is finished, the primer can be used as a transcription template.

TABLE 7 Salmonella typhimurium Cas12b sgRNA in vitro transcription oligo sequence

A. preparation of annealing extension system

TABLE 8 annealing extension System

Component (A)	Volume of
		2×PCRMasterMix	10μL
Cas12bSenseOligo(10μM)	0.5μL
		ST_STM4497-sgRNA-R(10μM)	0.5μL
Nuclease-free water	9μL

PCR annealing extension program setup

TABLE 9 PCR annealing extension procedure

② Cas12b sgRNA in vitro transcription

A. the preparation of the reaction system was carried out in the order of the reagents shown in the following table.

TABLE 10 reaction system

B. The above reagents are fully and uniformly mixed, and then are subjected to short centrifugation, and are incubated for 2-4 hours at 37 ℃ for in vitro transcription, so that the transcription time can be prolonged to improve the transcription yield, and if the transcription product is used for CRISPR one-tube detection, overnight transcription is recommended for 12-16 hours.

After the incubation at 37℃was completed, 30. Mu.L of DNase I reaction solution was prepared as shown in the following table and added to 20. Mu.L of the in vitro transcription product to remove the DNA template in the transcription system.

Table 11 DNase I reaction solution

Component (A)	Volume of
		2 XDNSAII buffer	25μL
DNaseⅠ	4μL
		Nuclease-free water	1μL

DNase I reaction conditions: 37℃for 30min.

③ Cas12b sgRNA transcript magnetic bead purification

A. the beads were first removed from the 4 ℃ refrigerator and allowed to stand at room temperature for about 30min to equilibrate to room temperature. The beads were thoroughly mixed by inversion or vortexing, 25 μl of beads and 50 μl of isopropanol were pipetted into 50 μl of the sgRNA sample to be purified, and thoroughly mixed by pipetting.

B. The RNA was bound to the beads by incubation at room temperature for 5min.

C. The sample was placed on a magnetic rack for 5min and after the solution was clear, the supernatant was carefully removed.

D. The samples were kept on a magnetic rack, 200 μl of freshly prepared 80% ethanol was added, the beads were rinsed, incubated at room temperature for 30s, and the supernatant carefully removed.

E. The step 4 was repeated for 2 times.

F. the sample is kept on the magnetic rack all the time, and the magnetic beads are air-dried for 5min after being uncapped.

G. the sample was taken out of the magnetic rack, 50. Mu.L of nuclease-free water was added, and the mixture was blown with a pipette to mix well and left to stand at room temperature for 5min.

H. and placing the sample in a magnetic rack for 5min, carefully transferring the supernatant into a new nuclease-free PCR tube after the solution is clarified, and obtaining the purified Cas12b sgRNA.

(2) Salmonella typhimurium CRISPR one-tube system sgRNA screening

On the basis of the LAMP reaction system, screening of dNTP and MgSO ₄ concentrations is carried out on a salmonella typhimurium CRISPR one-tube system, and the specific reference is shown in the following table 12.

Table 12 Salmonella typhimurium CRISPR one-tube method System sgRNA screening

The reaction procedure is: FAM fluorescent channel signals are collected every 30s at a constant temperature of 60 ℃, and the reaction time is 45min.

As can be seen from FIG. 3, the concentration of dNTPs is 0.8mM, and the concentration of Mg ²⁺ is 12mM. The subsequent experiments were carried out with dNTP concentrations of 0.8mM and Mg ²⁺ concentrations of 12mM, unless otherwise specified.

2.6, Salmonella typhimurium CRISPR one-tube method detection system optimization

① CRISPR one-tube Cas protein and sgRNA dosage optimization

The Cas protein and sgRNA usage in the CRISPR one-tube assay was continuously optimized according to the salmonella typhimurium CRISPR one-tube assay screened in table 12.

Table 13 Cas protein and sgRNA dose optimization in Salmonella typhimurium CRISPR one-tube method

Reagent name	Volume (mu L)
		10×LAMP buffer	2.5
dNTPmix(25mM)	0.8
		MgSO4(100mM)	2.5
10 XST_STM4497-LAMP-1 primer mix	2.5
		Glycine (2M)	6
8C-FQ(10μM)	1.25
		AapCas12b(10μM)	0.625/1.25/1.875/2.5
Bst(8U/μL)	1
		ST_STM4497-sgRNA-1(10μM)	0.625/1.25/1.875/2.5
Nuclease-free water	4.7/3.45/2.2/0.95
		Template	2.5
Total amount of	25

The reaction procedure is: FAM fluorescent channel signals are collected every 30s at a constant temperature of 60 ℃, and the reaction time is 45min. As can be seen from FIG. 4, the optimal concentration of Cas protein and sgRNA in the one-step CRISPR system of Salmonella typhimurium is 500nM, and the fluorescence signal of the system is strongest. Subsequent experiments were performed using Cas protein and sgRNA concentrations of 500nM, unless otherwise specified.

② CRISPR one-tube method reaction temperature optimization

The reaction temperature screening of the CRISPR one-step system was performed according to the following Table 14, the reaction temperature screening range was 56-61℃and screening tests were performed at 1℃intervals, FAM fluorescent channel signals were collected at 30s intervals, and the reaction time was 45min.

Table 14 Salmonella typhimurium CRISPR one-step system reaction temperature screening test

Reagent name	Volume (mu L)
		10×LAMP buffer	2.5
dNTPmix(25mM)	0.8
		MgSO4(100mM)	2.5
10 XST_STM4497-LAMP-1 primer mix	2.5
		Glycine (2M)	6
8C-FQ(10μM)	1.25
		AapCas12b(10μM)	1.25
Bst(8U/μL)	1
		ST_STM4497-sgRNA-1(10μM)	1.25
Nuclease-free water	3.45
		Template	2.5
Total amount of	25

As can be seen from FIG. 5, the optimal reaction temperature of the one-step CRISPR system of salmonella typhimurium is 58 ℃, and the fluorescence signal of the system is strongest under the temperature condition. The reaction temperature was 58℃for the subsequent experiments, unless otherwise specified.

③ CRISPR one-tube method reaction probe optimization

Based on the CRISPR one-step reaction system of table 14, the effect of different probes on the CRISPR one-step detection system was tested, and the different probe sequences are shown in table 15 below.

TABLE 15 probe sequences

Probe name	Sequence (5 '-3')
		8A-FQ	5’-/6-FAM/AAAAAAAA/BHQ1/-3’
8T-FQ	5’-/6-FAM/TTTTTTTT/BHQ1/-3’
		8C-FQ	5’-/6-FAM/CCCCCCCC/BHQ1/-3’
8G-FQ	5’-/6-FAM/GGGGGGGG/BHQ1/-3’

As can be seen from the results of FIG. 6, the probes used in the reaction system of the Salmonella typhimurium CRISPR one-step method are preferably 8C-FQ, and 8T-FQ can also be used. The subsequent experiments adopt the probe 8C-FQ unless otherwise specified.

2.7 Sensitivity test and specificity test of salmonella typhimurium CRISPR one-tube method detection system

Sensitivity and specificity tests were performed according to the optimized salmonella typhimurium CRISPR one-step detection system, which is shown in table 16 below.

Table 16 Salmonella typhimurium CRISPR one-step method system

The reaction procedure is: FAM fluorescent channel signals are collected at constant temperature of 58 ℃ at intervals of 30 seconds, and the reaction time is 45 minutes.

① Sensitivity test of salmonella typhimurium CRISPR one-tube method detection system:

The quantified pUC57-ST_STM4497 plasmid was tested at 200copies/test, 100copies/test, 50copies/test, 25copies/test and 12.5copies/test gradient concentrations of 10 replicates each.

As can be seen from FIG. 7, the lowest detection limit LoD of the Salmonella typhimurium CRISPR-tube system is 13.4copies/test.

② Salmonella typhimurium CRISPR one-tube method detection system specificity test

Salmonella CRISPR one-step assay system specificity testing was performed using 20 Salmonella genomic nucleic acids and 10 non-Salmonella genomic nucleic acids extracted.

Table 17 Salmonella typhimurium specificity verification bacterial name

As can be seen from FIG. 8, the one-step CRISPR system for detecting different species of Salmonella, only Salmonella typhimurium, and no other Salmonella or non-Salmonella.

The beneficial effects of this embodiment are as follows:

(1) A salmonella typhimurium CRISPR one-tube method detection system is initially established, the detection time is 45min, the minimum detection limit is 60.0copies/test, and the method has the characteristics of quick detection, convenient operation and the like, and simultaneously has higher detection sensitivity.

(2) The CRISPR one-tube method detection system does not need to open the cover and sample for the second time, so that aerosol pollution can be avoided, and meanwhile, the CRISPR technology can be utilized to improve the specificity of isothermal amplification detection, and avoid the risk of false positive results.

The method comprises the following steps: pUC57-ST_STM4497 plasmid Synthesis

Plasmid pUC57-ST_STM4497 containing the conserved sequence of Salmonella typhimurium ST_STM4497 was constructed, and the sequence of ST_STM4497 was as follows (SEQ ID NO. 1).

CGTCGTTGCTGCTTCCGGGAATGACAGCCATGAGTATTTCACTTCCCGGCACCGCAGCAATGGTTGGGTTCGGGGGAGACTATACCTACAGGGGCACAATAACCGTAACCGGAGAGGCGCTCATCGGTCCTGCTGTAGATGCAAGGGTGCCTAAGGTTAGTGTGACTCTCTGTAGCTCGACCAAAGTGACGGTGGAACAATGCAACGCCCGGTTAGAGCGCAAAAATCAGGATGGCTCATGGAATGTTGTGACAGGGATGCAGTGTACAGGGCAAAATAGCAATAATTTAAGTGTGGTGACCCCCATCTCAAAAATCTATAAGCTCGTGTACGGCGATTTCTACCGTGTCGTTTTTATGAATGTGAGGGCGAGGTTTGAACCAAGTGGAGCAGCTGAGCATGGTTCGCGTTGTTTTGTTGAAAAACAAAGCTACAGCTATGGGAATCCTGTCAGTGGAGGAGTACTGGAGTTGAGTACATTGTCAGGTCAAACTGAACGTTTGGCTGCCTATGGCCAGCACGAGACGACATTCTTGATGCCAGTCACTGCGGTCGATAAAACTTATATCGAATACCCGACCATGACCCGGTTGAGTGTTGCTCCCGACGGAAGCGCGCGCGGACAGGTAGTCACCGTTGTGGGTCGTAACGCACAAGTGAAATTTACCCTGAGGGAGGCTTATGGTAATAATAATTTGGGGCAGTATTGGATACCAACGGCTGCTAGCGG

The invention and its embodiments have been described above by way of illustration and not limitation, and the invention is illustrated in the accompanying drawings and described in the drawings in which the actual structure is not limited thereto. Therefore, if one of ordinary skill in the art is informed by this disclosure, the structural mode and the embodiments similar to the technical scheme are not creatively designed without departing from the gist of the present invention.

Claims (7)

1. A CRISPR-based salmonella typhimurium detection kit comprising an F3 primer, a B3 primer, a FIP primer, a BIP primer, an LF primer, an LB primer, a guide RNA, a Cas12B protein, and a single-stranded nucleic acid reporter; the nucleotide sequence of the F3 primer is shown as SEQ ID NO. 2; the nucleotide sequence of the B3 primer is shown as SEQ ID NO. 3; the nucleotide sequence of the FIP primer is shown as SEQ ID NO. 4; the nucleotide sequence of the BIP primer is shown as SEQ ID NO. 5; the nucleotide sequence of the LF primer is shown as SEQ ID NO. 6; the nucleotide sequence of the LB primer is shown as SEQ ID NO. 7; the nucleotide sequence of the guide RNA is shown as SEQ ID NO. 23; the single stranded nucleic acid reporter is 5 '-/6-FAM/CCCCCC/BHQ 1/-3' or 5'-/6-FAM/TTTTTTTT/BHQ1/-3'.

2. The kit of claim 1, further comprising a polymerase and dntps.

3. The kit of claim 1, further comprising: and (3) a buffer solution.

4. The kit of claim 1, wherein each 25 μl comprises:

5. A method for detecting salmonella typhimurium based on CRISPR, the method comprising the steps of:

the sample to be detected is amplified by the kit, and the change of the fluorescent signal is measured.

6. The method of claim 5, wherein the temperature detected is 56 ℃ to 60 ℃, preferably 57 ℃ to 59 ℃, more preferably 57.5 ℃ to 58.5 ℃.

7. The method according to claim 5, wherein the nucleic acid amplification and the detection are performed simultaneously without uncovering the middle.