CN117867090B - Standard substance for quantitative DNA fragmentation level and preparation method and application thereof - Google Patents
Standard substance for quantitative DNA fragmentation level and preparation method and application thereof Download PDFInfo
- Publication number
- CN117867090B CN117867090B CN202410276533.6A CN202410276533A CN117867090B CN 117867090 B CN117867090 B CN 117867090B CN 202410276533 A CN202410276533 A CN 202410276533A CN 117867090 B CN117867090 B CN 117867090B
- Authority
- CN
- China
- Prior art keywords
- dna
- standard
- dna fragmentation
- sequence
- level
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 238000013467 fragmentation Methods 0.000 title claims abstract description 86
- 238000006062 fragmentation reaction Methods 0.000 title claims abstract description 86
- 239000000126 substance Substances 0.000 title claims abstract description 41
- 238000002360 preparation method Methods 0.000 title claims abstract description 18
- 238000011002 quantification Methods 0.000 claims abstract description 12
- 239000012634 fragment Substances 0.000 claims description 36
- 238000000034 method Methods 0.000 claims description 27
- 238000001514 detection method Methods 0.000 claims description 6
- 238000004519 manufacturing process Methods 0.000 claims description 6
- 238000007865 diluting Methods 0.000 claims description 4
- 230000002194 synthesizing effect Effects 0.000 claims description 3
- 108090000623 proteins and genes Proteins 0.000 abstract description 5
- 239000012895 dilution Substances 0.000 abstract description 4
- 238000010790 dilution Methods 0.000 abstract description 4
- 238000002156 mixing Methods 0.000 abstract description 3
- 238000011112 process operation Methods 0.000 abstract description 3
- 238000012163 sequencing technique Methods 0.000 abstract description 3
- 108020004414 DNA Proteins 0.000 description 117
- 239000000523 sample Substances 0.000 description 27
- 239000013612 plasmid Substances 0.000 description 16
- 238000005259 measurement Methods 0.000 description 8
- 238000013112 stability test Methods 0.000 description 7
- 239000002773 nucleotide Substances 0.000 description 6
- 125000003729 nucleotide group Chemical group 0.000 description 6
- 238000004458 analytical method Methods 0.000 description 5
- 238000010276 construction Methods 0.000 description 5
- 238000012165 high-throughput sequencing Methods 0.000 description 5
- 238000003753 real-time PCR Methods 0.000 description 4
- 230000003321 amplification Effects 0.000 description 3
- 238000007796 conventional method Methods 0.000 description 3
- 238000003199 nucleic acid amplification method Methods 0.000 description 3
- 238000000246 agarose gel electrophoresis Methods 0.000 description 2
- 238000003556 assay Methods 0.000 description 2
- 238000005251 capillar electrophoresis Methods 0.000 description 2
- 239000003153 chemical reaction reagent Substances 0.000 description 2
- 238000010367 cloning Methods 0.000 description 2
- 238000004445 quantitative analysis Methods 0.000 description 2
- 230000035945 sensitivity Effects 0.000 description 2
- 239000000243 solution Substances 0.000 description 2
- 238000010257 thawing Methods 0.000 description 2
- 102000053602 DNA Human genes 0.000 description 1
- 241000196324 Embryophyta Species 0.000 description 1
- 241000588724 Escherichia coli Species 0.000 description 1
- 241000282414 Homo sapiens Species 0.000 description 1
- 241001465754 Metazoa Species 0.000 description 1
- 238000011529 RT qPCR Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 238000006243 chemical reaction Methods 0.000 description 1
- 238000009826 distribution Methods 0.000 description 1
- 238000001962 electrophoresis Methods 0.000 description 1
- 230000003203 everyday effect Effects 0.000 description 1
- 238000007710 freezing Methods 0.000 description 1
- 230000008014 freezing Effects 0.000 description 1
- 238000003780 insertion Methods 0.000 description 1
- 230000037431 insertion Effects 0.000 description 1
- 244000005700 microbiome Species 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 108020004707 nucleic acids Proteins 0.000 description 1
- 102000039446 nucleic acids Human genes 0.000 description 1
- 150000007523 nucleic acids Chemical class 0.000 description 1
- 239000013600 plasmid vector Substances 0.000 description 1
- 238000004321 preservation Methods 0.000 description 1
- 239000002096 quantum dot Substances 0.000 description 1
- 238000007480 sanger sequencing Methods 0.000 description 1
- 238000002798 spectrophotometry method Methods 0.000 description 1
- 238000001308 synthesis method Methods 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
- 230000000007 visual effect Effects 0.000 description 1
- 239000002699 waste material Substances 0.000 description 1
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of gene sequencing, in particular to a standard substance for quantitative DNA fragmentation level and a preparation method and application thereof. The sequence of the standard substance for quantifying the DNA fragmentation level is known, wherein the multiple of the target L and the target S is also known, the multiple does not change along with the concentration change of the standard substance, and the problem that the multiple relationship of the target L and the target S in the prepared standard substance is inconsistent with expectations due to inaccurate quantification of the standard substance or improper process operations such as dilution, mixing and the like when the standard substance with independent target L and target S is used is avoided. The standard substance for quantifying the DNA fragmentation level and the DNA sample to be tested are simultaneously detected, and the standard curve obtained by the standard substance is utilized to analyze the fragmentation level of the DNA sample to be tested, so that the fragmentation level of the DNA sample to be tested is estimated.
Description
Technical Field
The invention relates to the technical field of gene sequencing, in particular to a standard substance for quantitative DNA fragmentation level and a preparation method and application thereof.
Background
The high-throughput sequencing can detect multiple genes and multiple targets simultaneously, and is widely used for determining gene sequences of human beings and various other animals, plants and microorganisms. Because of the high cost of high throughput sequencing, accurate quantification of DNA concentration, fragmentation levels, is required to obtain better library yields prior to library preparation. Particularly, the method can accurately quantify the DNA fragmentation level, can control the quality of a DNA sample to be detected, screen out a DNA sample with a shorter fragment in time for cause analysis, so as to prepare DNA again in time for library construction, and avoid the waste of library construction reagents and time caused by serious DNA fragmentation. Thus, accurate quantification of DNA fragmentation levels is essential in high throughput sequencing techniques.
At present, DNA fragmentation analysis can be carried out by agarose gel electrophoresis, capillary electrophoresis, fluorescent quantitative PCR and other methods. However, agarose gel electrophoresis has complicated experimental process, is easy to produce nucleic acid pollution and has poor sensitivity; the capillary electrophoresis can convert the fluorescence signal of the electrophoresis fragment into an electric signal, and the DNA fragmentation distribution situation is shown through a graph, so that the method is more visual, but the method is not accurate in quantification, the cost is high, the requirement on the DNA sample loading amount is high, and some low-concentration DNA cannot be detected; the fluorescence quantitative PCR method has higher detection sensitivity, the concentration of targets with different lengths is mainly measured at present, and then the fragmentation degree of DNA is represented by the ratio of the concentrations of the targets with different lengths, but the method can cause poorer precision and larger error when evaluating the DNA fragmentation level with lower concentration.
These problems can ultimately lead to problems such as large differences in the yield of high throughput sequencing libraries from expectations, the need to reconstruct libraries for analytical reasons, etc. In view of the above, there is a need for a quantitative method for determining the level of fragmentation of DNA for high throughput sequencing that is rapid, stable and accurate.
Disclosure of Invention
In order to solve the technical problems, the invention provides a standard for quantifying the DNA fragmentation level, and a preparation method and application thereof.
Specifically, the technical scheme of the invention is as follows:
In a first aspect, the present invention provides a standard for quantifying the level of DNA fragmentation, comprising N DNA molecules comprising fragments of a specific sequence, n.gtoreq.3;
the specific sequence fragment is selected from any one of S9L1, S8L2, S7L3, S6L4, S5L5, S4L6, S3L7, S2L8 and S1L 9;
S9L1：
S-x-L-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’
S8L2：
S’-x-L-x-S-x-L-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’
S7L3：
S’-x-L-x-S’-x-L-x-S-x-L-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’
S6L4：
S’-x-L-x-S’-x-L-x-S’-x-L-x-S-x-L-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’
S5L5：
S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S-x-L-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’
S4L6：
S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S-x-L-x-S-x-L’-x-S-x-L’-x-S-x-L’
S3L7：
S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S-x-L-x-S-x-L’-x-S-x-L’
S2L8：
S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S-x-L-x-S-x-L’
S1L9：
S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S-x-L
wherein:
the S, S' regions have the same length and are more than or equal to 60 bp and less than or equal to 80 bp;
the L, L' regions have the same length and have the length of more than or equal to 150 bp and less than or equal to 170 bp;
the length of the x region is more than or equal to 400 bp and less than or equal to 600 bp;
The S sequence contains an S-F, S-R, S-Pb binding sequence;
the L sequence contains an L-F, L-R, L-Pb binding sequence;
The S' sequence contains an S-F, S-R binding sequence and does not contain an S-Pb binding sequence;
the L' sequence contains an L-F, L-R binding sequence and does not contain an L-Pb binding sequence;
The x sequence does not contain S-F, S-R, S-Pb and L-F, L-R, L-Pb binding sequences;
S-F is a forward primer of the small fragment DNA;
S-R is the reverse primer of the small fragment DNA;
S-Pb is a probe of small fragment DNA;
L-F is a forward primer of large fragment DNA;
L-R is the reverse primer of the large fragment DNA;
L-Pb is a probe for large fragment DNA.
In the present invention, the DNA molecule containing a specific sequence fragment may be an artificially synthesized plasmid (or other macromolecular DNA): wherein the insert is a specific sequence fragmented DNA comprising S, L, S ', L', x regions. Wherein S, S 'regions have the same length (60-80 bp), and all contain a forward primer (S-F, S-R) binding region of a small fragment DNA (abbreviated as target S), the S region contains a probe (S-Pb) binding region of the target S at the same time, and the only difference between the S' region and the S region is that the S-Pb binding region is not contained (but replaced by other sequences which cannot be bound by S-Pb); the L, L 'region has the same length (150-170 bp), and contains a forward primer (L-F, L-R) binding region and a reverse primer (L-F, L-R) binding region of large fragment DNA (abbreviated as target L), the L region simultaneously contains a probe (L-Pb) binding region of the target L, and the only difference between the L' region and the L region is free of the L-Pb binding region (but replaced by other sequences which cannot be bound by L-Pb); the x sequence is a sequence different from S, L sequences, and does not contain S-F, S-R, S-Pb and L-F, L-R, L-Pb binding sequences; the S or S 'region is spaced from the L or L' region by an x sequence or other substance that blocks extension of the product during PCR, and S ', L and L' are not immediately adjacent to each other when aligned.
The sequence of the standard substance for quantifying the DNA fragmentation level is known, wherein the multiple of the target L and the target S is also known, the multiple does not change along with the concentration change of the standard substance, and the problem that the multiple relationship of the target L and the target S in the prepared standard substance is inconsistent with expectations due to inaccurate quantification of the standard substance or improper process operations such as dilution, mixing and the like when the standard substance with independent target L and target S is used is avoided.
Preferably, the nucleotide sequence of S-F is shown as SEQ ID NO. 6; the nucleotide sequence of the S-R is shown as SEQ ID NO. 7; the nucleotide sequence of the S-Pb is shown as SEQ ID NO. 8; the nucleotide sequence of L-F is shown as SEQ ID NO. 9; the nucleotide sequence of the L-R is shown as SEQ ID NO. 10; the nucleotide sequence of L-Pb is shown as SEQ ID NO. 11.
Preferably, the S sequence is shown as SEQ ID NO. 1; the S' sequence is shown as SEQ ID NO. 2; the sequence L is shown as SEQ ID NO. 3; the sequence of L' is shown as SEQ ID NO. 4.
Preferably, the x sequence is shown in SEQ ID NO. 5.
In a more specific preferred embodiment of the present invention, the standard for quantitative determination of DNA fragmentation level comprises 9 DNA molecules containing specific sequence fragments selected from S9L1, S8L2, S7L3, S6L4, S5L5, S4L6, S3L7, S2L8 or S1L9 in sequence.
Preferably, the standard for quantifying the level of DNA fragmentation further comprises poly (dN), N=A/C/T/G bases.
More preferably, the poly (dN) is poly (dA), the concentration of the poly (dA) is 0.1-100 ng/mu L, and the number of dA bases is 5-100.
In a second aspect, the present invention provides a method for preparing the standard for quantifying the level of DNA fragmentation, comprising the steps of: synthesizing N DNA molecules containing specific sequence fragments, and diluting the N DNA molecules to the same mass concentration, wherein N is more than or equal to 3; the specific sequence fragment is selected from any one of S9L1, S8L2, S7L3, S6L4, S5L5, S4L6, S3L7, S2L8 and S1L 9.
Preferably, the mass concentration is 1pg/μl to 50ng/μl.
The method provided by the invention is simple to operate, and a group of standard products for quantitative DNA fragmentation level can be rapidly, stably and accurately prepared.
In a third aspect, the invention provides an application of the standard for quantifying the DNA fragmentation level or the standard for quantifying the DNA fragmentation level prepared by the preparation method in quantifying the DNA fragmentation level.
In a fourth aspect, the present invention provides a method for quantifying the level of DNA fragmentation, as one of the modes of application of the standard for quantifying the level of DNA fragmentation in quantifying the level of DNA fragmentation, comprising the steps of:
s1, simultaneously carrying out fluorescence PCR detection on the standard substance for DNA fragmentation level quantification and a DNA sample to be detected, and counting Ct values of targets L and S of each sample;
S2, according to statistical data of a standard sample for DNA fragmentation level quantification, using a multiple of a target L/S as an abscissa X and using 2- [ Ct (L) -Ct (S) ] as an ordinate Y, and manufacturing a standard curve;
S3, substituting the 2- [ Ct (L) -Ct (S) ] value of the DNA sample to be detected into the standard curve in the step S2 to obtain the multiple of the target L/S of the DNA sample to be detected.
The DNA fragmentation level quantitative method provided by the invention carries out real-time fluorescent quantitative PCR detection on the DNA fragmentation level quantitative standard substance and the DNA sample to be detected simultaneously, and carries out the fragmentation level analysis of the DNA sample to be detected by utilizing a standard curve obtained by the standard substance, thereby evaluating the fragmentation level of the DNA sample to be detected.
The beneficial effects are that:
The invention provides a standard substance for quantifying DNA fragmentation level, a preparation method and application thereof. The sequence of the standard for quantifying the DNA fragmentation level is known and determined, wherein the multiple of the target L and the target S is also known and determined, the multiple does not change along with the concentration change of the standard, and the problem that the multiple relationship of the target L and the target S in the prepared standard is inconsistent with expectations due to inaccurate quantification of the standard or improper process operations such as dilution, mixing and the like when the standard with independent targets L and S is used is avoided.
Although the number of sequences (corresponding to L, S region, excluding L ', S') that can generate fluorescent signals is different in different standards, the number of sequences that can be amplified is the same (since L ', S' each contain a primer binding region, amplification can be performed as in L, S region), so that the difference in amplification efficiency due to the different content of primer-amplifiable templates in the reaction system does not occur in each standard.
In addition, the standard for quantifying DNA fragmentation level provided by the invention has the advantages of fixed sequence, simple and quick preparation process, stability and reliability, small batch-to-batch difference, high stability, convenience in use and preservation and the like.
Detailed Description
The invention provides a standard substance for quantifying DNA fragmentation level, a preparation method and application thereof. The standard for quantifying the DNA fragmentation level comprises N DNA molecules containing specific sequence fragments, wherein N is more than or equal to 3; the specific sequence fragment is selected from any one of S9L1, S8L2, S7L3, S6L4, S5L5, S4L6, S3L7, S2L8 and S1L 9.
In one preferred embodiment of the present invention, the standard for quantifying the level of DNA fragmentation comprises 9 DNA molecules comprising fragments of a specific sequence, and the preparation and application methods thereof comprise the steps of:
(1) 9 plasmids containing specific sequence fragments were synthesized: the insert on the plasmid includes S, L, S ', L', x regions. Wherein S, S 'regions have the same length (60-80 bp), and all contain a forward primer (S-F, S-R) binding region of a small fragment DNA (abbreviated as target S), the S region contains a probe (S-Pb) binding region of the target S at the same time, and the only difference between the S' region and the S region is that the S-Pb binding region is not contained (but replaced by other sequences which cannot be bound by S-Pb); the L, L 'region has the same length (150-170 bp), and contains a forward primer (L-F, L-R) binding region and a reverse primer (L-F, L-R) binding region of large fragment DNA (abbreviated as target L), the L region simultaneously contains a probe (L-Pb) binding region of the target L, and the only difference between the L' region and the L region is free of the L-Pb binding region (but replaced by other sequences which cannot be bound by L-Pb); the S or S 'region is spaced from the L or L' region by an x sequence or other substance that blocks extension of the product during PCR, and S ', L and L' are not immediately adjacent to each other when aligned.
(2) Diluting to obtain a group of standard substances for quantifying DNA fragmentation level: quantification of a set of 9 plasmids containing specific sequence fragments was performed using conventional methods (e.g., spectrophotometry, fluorometer). And 9 plasmids are diluted to the same mass concentration, respectively, of 1 pg/. Mu.L to 50 ng/. Mu.L, preferably 1 pg/. Mu.L to 1 ng/. Mu.L, preferably 10 pg/. Mu.L. In the preparation process, poly (dN) (N=A/C/T/G base) with a certain concentration is added to obtain 9 DNA fragmentation level quantitative standard substances. Poly (dN) is preferably Poly (dA), and the concentration of the Poly (dA) is 0.1-100 ng/. Mu.L, preferably 1-10 ng/. Mu.L, preferably 1 ng/. Mu.L; the number of dA bases is 5 to 100, preferably 10 to 50, preferably 18 to 30.
(3) The group of 9 DNA fragmentation level quantitative standard substances and the DNA sample to be detected are subjected to fluorescence PCR detection simultaneously, ct values (respectively marked as Ct (L) and Ct (S)) of targets L and S measured by each standard substance are calculated to obtain corresponding 2- [ Ct (L) -Ct (S) ] as an ordinate Y, and multiples (1/9, 2/8, 3/7, 4/6, 5/5, 6/4, 7/3, 8/2 and 9/1) of the corresponding L/S of each standard substance are used as an abscissa X to prepare a standard curve. Standard curve formulas (y=kx+b, where k, b are the slope and intercept of the standard curve, respectively) are obtained by straight line fitting. And then calculating Ct values of the targets L and S measured by the sample to be detected to obtain corresponding 2- [ Ct (L) -Ct (S) ] as an ordinate Y, substituting the ordinate Y into a linear standard curve, and converting to obtain multiples of the target L/S of the DNA sample to be detected as accurate quantitative indexes of DNA fragmentation levels.
More specifically, the preparation method of the standard for quantifying the DNA fragmentation level comprises the following steps:
S1, synthesizing 9 escherichia coli cloning plasmids (or long-chain DNA molecules) containing specific sequence insertion fragments by adopting a gene synthesis method.
Embodiments are described with respect to plasmids: plasmid vectors are cloning plasmids, including but not limited to pUC57 plasmids.
The insert on the plasmid comprises S, L, S ', L' regions, wherein:
The S, S 'region has the same length (60-80 bp), and contains a forward primer binding region and a reverse primer binding region (S-F, S-R) of small fragment DNA (short for target S), the S region simultaneously contains a probe (S-Pb) binding region of target S, and the only difference between the S' region and the S region is that the S-Pb binding region is not contained (but replaced by other sequences which cannot be bound by S-Pb).
The L, L ' region has the same length (150-170 bp), and contains a forward primer binding region and a reverse primer binding region (L-F, L-R) of large fragment DNA (abbreviated as target L), the L region simultaneously contains a probe (L-Pb) binding region of the target L, and the only difference between the L ' region and the L region is that the L ' region does not contain the L-Pb binding region (but is replaced by other sequences which cannot be bound by L-Pb).
The S or S 'regions are spaced from the L or L' regions and S ', L and L' are not immediately adjacent when aligned as follows:
S9L1：S-x-L-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’
S8L2：S’-x-L-x-S-x-L-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’
S7L3：S’-x-L-x-S’-x-L-x-S-x-L-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’
S6L4：S’-x-L-x-S’-x-L-x-S’-x-L-x-S-x-L-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’
S5L5：S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S-x-L-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’
S4L6：S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S-x-L-x-S-x-L’-x-S-x-L’-x-S-x-L’
S3L7：S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S-x-L-x-S-x-L’-x-S-x-L’
S2L8：S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S-x-L-x-S-x-L’
S1L9：S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S-x-L。
s sequence: contains the S-F, S-R, S-Pb binding sequence.
L sequence: contains the L-F, L-R, L-Pb binding sequence.
S' sequence: contains S-F, S-R binding sequence and does not contain S-Pb binding sequence.
L' sequence: contains an L-F, L-R binding sequence and does not contain an L-Pb binding sequence.
X sequence: the sequence is different from S, L sequences, and does not contain S-F, S-R, S-Pb and L-F, L-R, L-Pb binding sequences.
More specifically:
The S sequence is as follows:
CGTACAGAGGGCTTCCTCTTTGGCTCTTTGCCTGGTTGTTTCCAAGATGTACTGTGCCTCTTACTTTCG（SEQ ID NO.1）
the S' sequence is as follows:
CGTACAGAGGGCTTCCTCTTCTATCTGCTGCGACGGAGCAAATCAGATGTACTGTGCCTCTTACTTTCG（SEQ ID NO.2）
The sequence L is as follows:
GGAAAGATACCAAGTCACGGTTTATTCTTCAAAATGGAGGTGGCTTGTTGGGAAGGTGGAAGCTCATTTGGCCAGAGTGGAAATGGAATTGGGAGAAATCGATGACCAAATGTAAACACTTGGTGCCTGATATAGCTTGACACCAAGTTAGCCCCAAGTGAAA（SEQ ID NO.3）
The sequence L' is as follows:
GGAAAGATACCAAGTCACGGTTTATTCTTCAAAATGGAGGTGGCTTGTTGGGAAGGTGGAAGCTCATTTGGCCAGAGTGGAAATGGAATTGGGAGAAATCGATGACCAAATGTAACTCGTAAGTTGCTATCGCGAAACGGCACCAAGTTAGCCCCAAGTGAAA（SEQ ID NO.4）
The x sequence is as follows:
CAGTTTTCACGCCTAAAGCATAAACGACGAGCAGTCATGAAAGTCTTAGTACTGGACGTGCCGTTTCACTGCGAATAATACCTGGAGCTGTACCGTTATTGCGCTGCATAGATGCAGTGCTGCTCTTATCACATTTGTTTCGACGACAGCCGCCTTCGCAGTTTCCTCAGACACTTAAGAATAAGCGCTTATTGTAGGCAGAGGCACGCCCTATTAGTGGCTGCGGCAAAATATCTTCGGATCCCCTTGTCCAACCAAATTGATCGAATTCTTTCATTTAAGACCCTAATATGTCATCATTAGTGATTAAATGCCACTCCGAAAATACCGCCTAGAAATGTCTAAGATCGGTCCACTAAAGTTGTTTAAAACGACTGCTAAATCCGCGTGATAGGGGATTTGAAGTTTAATCTTCTATCGCAAGGAACTGCCGATCTTAATGGATGGCCGGAGGTGGTATGGAAGCTATAAGCGCGGGTGAGAGGGTAATTAGGCGTGTT（SEQ ID NO.5）
note that: the plasmid sequence was confirmed using Sanger sequencing.
S2, extracting and purifying the plasmid by using a conventional method of molecular biology (for example, using a commercial kit), quantifying a group of 9 plasmids containing the fragments with the specific sequences by using a conventional method, and detecting the mass concentration of the plasmids (for example, using a spectrophotometer, a fluorometer and the like).
The designed 2 groups of primer probes are respectively used for amplifying a target S and a target L, and the specific sequences are as follows:
S-F：CGTACAGAGGGCTTCCTCT（SEQ ID NO.6）
S-R：CGAAAGTAAGAGGCACAGTAC（SEQ ID NO.7）
S-Pb：TGGCTCTTTGCCTGGTTGTTTCCA（SEQ ID NO.8）
L-F：GGAAAGATACCAAGTCACGG（SEQ ID NO.9）
L-R：TTTCACTTGGGGCTAACTTG（SEQ ID NO.10）
L-Pb：TCAAGCTATATCAGGCACCAAGTGT（SEQ ID NO.11）
S-Pb and L-Pb can be the same fluorescent groups (such as FAM and HEX fluorescent groups) or different fluorescent groups (such as FAM and HEX fluorescent groups respectively).
S3, quantifying the purified 9 plasmids containing the fragments with the specific sequences (such as a spectrophotometer and a fluorometer), and respectively diluting the plasmids to a certain mass concentration to obtain a group of 9 DNA fragmentation level quantification standard products. The mass concentration is 1 pg/. Mu.L to 50 ng/. Mu.L, preferably 1 pg/. Mu.L to 1 ng/. Mu.L, preferably 10 pg/. Mu.L. During the dilution, a concentration of poly (dN) (N=A/C/T/G bases) was added. Poly (dN) is preferably Poly (dA), and the concentration of the Poly (dA) is 0.1-100 ng/. Mu.L, preferably 1-10 ng/. Mu.L, preferably 1 ng/. Mu.L; the number of dA bases is 5 to 100, preferably 10 to 50, preferably 18 to 30.
The above-mentioned set of 9 standards for quantitative determination of DNA fragmentation level is used for preparing a standard curve for determination of DNA fragmentation level, and therefore the core is the multiples of the target L and S, not their respective mass concentrations or copy concentrations, and thus there is no need to precisely determine the mass concentrations or copy concentrations thereof. Meanwhile, the copy number of the targets L and S in the group of 9 standards is confirmed by sequence determination, so that determination by other methods is not needed.
S4, carrying out real-time fluorescence quantitative PCR detection on the group of 9 DNA fragmentation level quantitative standard substances and the DNA sample to be detected simultaneously, calculating Ct values (respectively marked as Ct (L) and Ct (S)) of a target L and S measured by each standard substance to obtain corresponding 2- [ Ct (L) -Ct (S) ] as an ordinate Y, and taking multiples (1/9, 2/8, 3/7, 4/6, 5/5, 6/4, 7/3, 8/2 and 9/1) of the L/S corresponding to each standard substance as an abscissa X to manufacture a standard curve. Standard curve formulas (y=kx+b, where k, b are the slope and intercept of the standard curve, respectively) are obtained by straight line fitting. And then calculating Ct values of the targets L and S measured by the sample to be detected to obtain corresponding 2- [ Ct (L) -Ct (S) ] as an ordinate Y, substituting the ordinate Y into a linear standard curve, and converting to obtain multiples of the target L/S of the DNA sample to be detected as accurate quantitative indexes of DNA fragmentation levels.
In order to facilitate the understanding of the present invention, the technical solutions provided by the present invention will be described in detail with reference to examples, but they should not be construed as limiting the scope of the present invention. The specific conditions are not noted in the examples and are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents and equipment used were conventional products available commercially without the manufacturer's attention.
Example 1
In this example, a standard for quantitative determination of DNA fragmentation level was prepared according to the method described in the embodiment, and 3 days was selected for batch preparation, and one batch was prepared every day. The standard for quantifying the DNA fragmentation level is designed as a group of 9 standards with the concentration of: 10 pg/. Mu.L, poly (dA) was added at the time of preparation, and the concentration of Poly (dA) was 1 ng/. Mu.L; the number of dA bases is 18.
In this example, an illuminea sequencing platform is taken as an example, and the experimental group: 3 prepared standard substances for quantitative DNA fragmentation level of 3 batches are subjected to 3 times of fragmentation level measurement on 10 samples (# 1 to # 10) of the same group of DNA samples to be detected, wherein the concentrations are respectively 0.1, 0.2, 0.5, 1, 2, 5, 10, 20, 50 and 100 ng/. Mu.L), and 10 samples of the DNA samples to be detected are subjected to library construction after each measurement. And simultaneously setting a control group: the same set of 10 samples of DNA to be tested was assayed using another assay for the level of fragmentation (this assay also uses the qPCR method, but the level of DNA fragmentation was assessed by measuring the concentrations of the large and small fragments of DNA, respectively, and then determining the ratio of the concentrations of the two), and 10 samples of DNA to be tested were subjected to library construction. The experimental group and the control group have the same addition amount of the DNA sample to be detected when constructing the library.
The results show that: the standard curve amplification efficiency and the linear correlation coefficient r obtained by using the respective standard substances in the control group and the experimental group meet the requirements. However, the relative standard deviation between the DNA fragmentation level measurement results (L/S ratio) obtained by using the method of the present invention is not more than 5%; the relative standard deviation between the fragmentation level measurement results (the ratio of the large and small fragment DNA concentrations) of 10 DNA samples to be detected, which are quantified by using the standard substance for quantifying the DNA fragmentation level obtained by the control group method, is up to 57%, and the relative standard deviation is larger when the DNA concentration is lower. This shows that: the DNA fragmentation level quantitative prepared by the method has small batch-to-batch difference prepared by the standard substance, and has high precision on the determination result of the fragmentation level of the DNA with different concentrations. The specific results are shown in Table 1 below.
TABLE 1 determination of the DNA fragmentation level by different methods
And respectively constructing libraries of the 10 quantitated DNA samples to be detected, and quantitating the libraries after the construction is finished (such as Qubit). The results show that: the method of the invention is used for measuring DNA fragmentation level results (L/S ratio) and the average value of DNA samples (# 1,2, 3, 4, 6, 9, 10) with at least 0.5 is good in library production, and samples (# 5, 7, 8) with the average value lower than 0.5 are poor in library production; the average value of DNA fragmentation level results (ratio of large and small fragment concentrations) obtained by the control method has obviously poor correlation with library output. This shows that: the quantitative preparation of the DNA fragmentation level prepared by the method has small batch-to-batch difference by using the standard substance, and the method can effectively evaluate the DNA fragmentation level and indicate the output condition of a constructed library. The specific results are shown in tables 2 to 3 below.
TABLE 2 relationship between the levels of DNA fragmentation in experimental groups and the yield of the constructed library
TABLE 3 relationship between the level of DNA fragmentation in control groups and the yield of the constructed library
Example 2
The standard for quantitative determination of DNA fragmentation level was prepared according to the method described in the specific embodiment, and designed as a group of 9 standards, the concentrations were all: 10 pg/. Mu.L, poly (dA) was added during the preparation, the concentration of Poly (dA) was 1 ng/. Mu.L, and the number of dA bases was 18. A control group was also set up, which was formulated without any Poly (dN) added. The two groups of DNA fragmentation level quantitative standard substances are simultaneously subjected to real-time stability test (stored at-30 to-10 ℃ C., 0/4/8/12/16/20/24 th month) and accelerated damage stability test (repeated freezing and thawing for 10 times and standing at room temperature (20 to 30 ℃ C.) for 2 days). And (3) testing 3 batches of DNA fragmentation level quantitative standard substances, and respectively measuring the same group of DNA samples to be tested.
The measurement results show that: according to the standard substance for quantitative DNA fragmentation level prepared according to the specific embodiment, the relative standard deviation of the real-time stability test results is within 10% and the relative deviation of the accelerated stability test results is within +/-10% when the results of measuring 3 DNA samples to be detected are measured; the control group (without adding any poly (dN)) carries out the measurement on 3 DNA samples to be detected, the relative standard deviation of the real-time stability test result is more than 20%, the relative deviation of the accelerated stability test result exceeds +/-10%, the result shows that the measurement result has larger fluctuation along with the extension of time and the aggravation of the accelerated stability test condition. This shows that: the DNA fragmentation level prepared by the method is good in real-time stability and accelerated damage stability (repeated freeze thawing and room temperature placement) when being quantitatively prepared by a standard substance, and is convenient to use and store. The specific results are shown in tables 4 to 5 below.
TABLE 4 real-time stability analysis results (DNA fragmentation level measurement results)
TABLE 5 accelerated stability towards disruption analysis results (quantitative results for DNA fragmentation level)
The above examples merely represent several embodiments of the present invention, which facilitate specific and detailed understanding of the technical solutions of the present invention, but should not be construed as limiting the scope of protection of the present invention. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the invention, which are all within the scope of the invention.
Claims (7)
- A standard for quantitative determination of DNA fragmentation level, characterized by consisting of 9 DNA molecules containing fragments of a specific sequence; the 9 DNA molecules containing the specific sequence fragments are S9L1, S8L2, S7L3, S6L4, S5L5, S4L6, S3L7, S2L8 and S1L9;S9L1：S-x-L-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’S8L2：S’-x-L-x-S-x-L-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’S7L3：S’-x-L-x-S’-x-L-x-S-x-L-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’S6L4：S’-x-L-x-S’-x-L-x-S’-x-L-x-S-x-L-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’S5L5：S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S-x-L-x-S-x-L’-x-S-x-L’-x-S-x-L’-x-S-x-L’S4L6：S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S-x-L-x-S-x-L’-x-S-x-L’-x-S-x-L’S3L7：S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S-x-L-x-S-x-L’-x-S-x-L’S2L8：S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S-x-L-x-S-x-L’S1L9：S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S’-x-L-x-S-x-Lwherein:The S sequence is shown as SEQ ID NO. 1; the S' sequence is shown as SEQ ID NO. 2; the sequence L is shown as SEQ ID NO. 3; the sequence of L' is shown as SEQ ID NO. 4; the x sequence is shown as SEQ ID NO. 5.
- 2. The standard for quantitative determination of the level of DNA fragmentation according to claim 1, further comprising poly-dN, N=A/C/T/G bases.
- 3. The standard for quantitative determination of DNA fragment level according to claim 2, wherein the poly-dN is poly-dA, the concentration of the poly-dA is 0.1-100 ng/. Mu.L, and the number of dA bases is 5-100.
- 4. A method for producing a standard for quantitative determination of DNA fragmentation level according to any one of claims 1 to 3, comprising the steps of: synthesizing 9 DNA molecules containing specific sequence fragments, and diluting the 9 DNA molecules to the same mass concentration; the 9 specific sequence fragments are S9L1, S8L2, S7L3, S6L4, S5L5, S4L6, S3L7, S2L8 and S1L9.
- 5. The method according to claim 4, wherein the mass concentration is 1pg/μl to 50ng/μl.
- 6. Use of the standard for quantitative determination of DNA fragmentation level according to any one of claims 1 to 3 or the standard for quantitative determination of DNA fragmentation level prepared by the preparation method according to any one of claims 4 to 5 in quantitative determination of DNA fragmentation level.
- A method for quantifying the level of dna fragmentation comprising the steps of:s1, simultaneously carrying out fluorescence PCR detection on the standard substance for DNA fragmentation level quantification according to any one of claims 1-3 and a DNA sample to be detected, and counting Ct values of targets L and S of each sample;S2, according to statistical data of a standard sample for DNA fragmentation level quantification, using a multiple of a target L/S as an abscissa X and using 2- [ Ct (L) -Ct (S) ] as an ordinate Y, and manufacturing a standard curve;S3, substituting the 2- [ Ct (L) -Ct (S) ] value of the DNA sample to be detected into the standard curve in the step S2 to obtain the multiple of the target L/S of the DNA sample to be detected.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202410276533.6A CN117867090B (en) | 2024-03-12 | 2024-03-12 | Standard substance for quantitative DNA fragmentation level and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202410276533.6A CN117867090B (en) | 2024-03-12 | 2024-03-12 | Standard substance for quantitative DNA fragmentation level and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN117867090A CN117867090A (en) | 2024-04-12 |
| CN117867090B true CN117867090B (en) | 2024-06-11 |
Family
ID=90588751
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202410276533.6A Active CN117867090B (en) | 2024-03-12 | 2024-03-12 | Standard substance for quantitative DNA fragmentation level and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN117867090B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101454450A (en) * | 2006-06-21 | 2009-06-10 | 塞诺菲-安万特股份有限公司 | DNA fragmentation assay |
| CN106103713A (en) * | 2014-02-03 | 2016-11-09 | 赛默飞世尔科技波罗的海封闭股份公司 | For the method through controlling DNA fragmentation |
| CN106399555A (en) * | 2016-11-10 | 2017-02-15 | 三生国健药业（上海）股份有限公司 | Real-time fluorescent quantitative PCR (polymerase chain reaction) detection method as well as standard substance and detection kit for real-time fluorescent quantitative PCR detection |
| CN109239029A (en) * | 2018-07-31 | 2019-01-18 | 广州燃石医学检验所有限公司 | A kind of method for evaluating quality of the high-throughput detection sample of efficiently and accurately |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10993418B2 (en) * | 2012-08-13 | 2021-05-04 | Life Genetics Lab, Llc | Method for measuring tumor burden in patient derived xenograft (PDX) mice |
-
2024
- 2024-03-12 CN CN202410276533.6A patent/CN117867090B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101454450A (en) * | 2006-06-21 | 2009-06-10 | 塞诺菲-安万特股份有限公司 | DNA fragmentation assay |
| CN106103713A (en) * | 2014-02-03 | 2016-11-09 | 赛默飞世尔科技波罗的海封闭股份公司 | For the method through controlling DNA fragmentation |
| CN106399555A (en) * | 2016-11-10 | 2017-02-15 | 三生国健药业（上海）股份有限公司 | Real-time fluorescent quantitative PCR (polymerase chain reaction) detection method as well as standard substance and detection kit for real-time fluorescent quantitative PCR detection |
| CN109239029A (en) * | 2018-07-31 | 2019-01-18 | 广州燃石医学检验所有限公司 | A kind of method for evaluating quality of the high-throughput detection sample of efficiently and accurately |
Non-Patent Citations (1)
| Title |
|---|
| DNA fragmentation and quality control analysis using Diagenode shearing systems and Fragment Analyzer;Wassim Lakhal等;《NATURE METHODS》;20160929;第1-2页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN117867090A (en) | 2024-04-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106048009B (en) | Label joint for ultralow frequency gene mutation detection and application thereof | |
| CN110878333A (en) | Method for preparing gene mutation reference substance | |
| CN114507749B (en) | Primer group, kit and method for accurately detecting transgenic components of corn | |
| Butler | DNA Profiling and Quantitation of Human DNA | |
| CN117867090B (en) | Standard substance for quantitative DNA fragmentation level and preparation method and application thereof | |
| CN114107453A (en) | Kit for detecting instability of microsatellite | |
| CN109593832A (en) | A kind of detection method of ARMS-ddPCR point mutation | |
| WO2021047175A1 (en) | Quantitative analysis of gene copy number | |
| US9528161B2 (en) | Materials and methods for quality-controlled two-color RT-QPCR diagnostic testing of formalin fixed embedded and/or fresh-frozen samples | |
| CN114622028B (en) | Primer pair combination, kit and detection method for detecting transgenic papaya | |
| CN112980930B (en) | Primer group for specific PCR (polymerase chain reaction) accurate quantitative detection of transgenic corn 2A-7 strain and detection method | |
| CN117867086B (en) | Standard substance for quantitative high-throughput sequencing library and preparation method and application thereof | |
| CN112143816B (en) | 29-plex Y-STR typing system for family search and paternal biological geographic ancestor inference | |
| CN117887812B (en) | Library for high-throughput sequencing quality control, and preparation method and application thereof | |
| CN111718979B (en) | Gene amplification reference substance and application thereof | |
| CN111718978B (en) | Gene amplification reference substance and application thereof | |
| CN114657275B (en) | Primer pair combination, kit and detection method for detecting transgenic alfalfa | |
| CN116555402B (en) | Telomere detection kit and telomere length detection method for non-disease diagnosis purpose | |
| CN117247999B (en) | Nucleic acid integrity quality assessment method and application thereof | |
| CN114774567B (en) | Primer pair combination, kit and detection method for detecting transgenic components of rice | |
| CN113186262B (en) | Method and kit for rapid quantification of MGI platform high-throughput sequencing library | |
| CN116626189B (en) | Analysis method for DNA damage in On-DNA chemical reaction based On LC-MS | |
| CN114657276B (en) | Primer pair combination, kit and detection method for detecting rice transgenic line | |
| CN114807407B (en) | Primer pair combination, kit and detection method for detecting soybean transgenic strain | |
| CN117089593A (en) | Method for measuring activity of DNA ligase and enzyme activity detection system of DNA ligase |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |