CN114107453A - Kit for detecting instability of microsatellite - Google Patents
Kit for detecting instability of microsatellite Download PDFInfo
- Publication number
- CN114107453A CN114107453A CN202111090896.3A CN202111090896A CN114107453A CN 114107453 A CN114107453 A CN 114107453A CN 202111090896 A CN202111090896 A CN 202111090896A CN 114107453 A CN114107453 A CN 114107453A
- Authority
- CN
- China
- Prior art keywords
- seq
- digital pcr
- bat
- pcr reaction
- msi
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Abstract
The kit is based on a digital PCR technology, and provides a novel microsatellite instability detection kit which is simple to operate, short in time consumption, ultrasensitive and good in detection repeatability. The kit does not need a normal sample as a reference and complex analysis software, overcomes the problem that low frequency and loss of heterozygosity are difficult to detect in an unstable state of the microsatellite, and has detection sensitivity reaching 0.1%.
Description
Technical Field
The invention belongs to the technical field of nucleic acid detection, and particularly relates to a kit for detecting instability of a microsatellite.
Background
Microsatellite instability (MSI) is a phenomenon in which the number of repetitions of a Microsatellite locus repeat unit (usually a tandem repeat DNA sequence consisting of 1 to 6 nucleotides) fluctuates, i.e., insertion or deletion of the repeat unit. Different MSI sites have different stabilities, and the size of a microsatellite repetitive unit, the base composition of the repetitive unit, the structure of a repetitive sequence, the repetition times and the like influence the stability of the sites to a certain extent. Depending on the extent of MSI, MSI can be classified as MicroSatellite High Instability (MSI-H), MicroSatellite Low Instability (MSI-L) and MicroSatellite stability (MSS). Since MSI is a relatively specific type of mutation in which a plurality of identical bases are added or deleted, the method for detecting MSI is also relatively complicated and has a great problem in accuracy. Currently, there are three main methods for detecting MSI, including Immunohistochemistry (IHC), next-generation sequencing (NGS) and multiplex fluorescence PCR capillary electrophoresis. IHC reflects the MSI state through detecting the expression of 4 main proteins (MLH1, MSH2, MSH6 and PMS2) in an MMR system, does not directly detect MSI mutation sites, and has low measuring accuracy due to the problems of detection accuracy, difficult standardization and normalization of operation procedures, subjective interpretation and the like. The NGS needs long time for detection, complex data analysis and clear and unified algorithm and evaluation standard to evaluate the MSI, so that the related standard is lacked; secondly, the difficulty of capturing and sequencing the repeated sequence is higher than that of the common sequence, the repeated sequence is very easily influenced by various factors in an experimental link, and the repeated sequence is more complex in aspects of library construction process, sequencing parameter adjustment, bioinformatics analysis and the like, so that the practicability is greatly limited. The multiplex fluorescence PCR capillary electrophoresis method is the 'gold standard' for detecting MSI at present, the MSI detection kit on the market is mainly the MSI Analysis system kit of the Promega company in the USA, the kit is to perform capillary electrophoresis after PCR amplification on selected MSI sites in normal and abnormal samples, and then determine the state of MSI by comparing the difference of two groups of electrophoresis results, the operation process is complex, the experiment period is longer, and the MSI detection method cannot detect the base deletion less than or equal to 3 or the increased low-frequency change, and also has the problems that the heterozygosity deletion or the low-frequency variation result caused by experiment factors cannot be judged and the like. In view of the above, there is an urgent need for a rapid, simple, sensitive, accurate, and stable detection kit for MSI.
Disclosure of Invention
The invention aims to overcome the defects of the existing MSI detection method and provide an MSI detection kit which is simple to operate, short in time consumption, ultra-sensitive and good in detection repeatability. The kit is based on the digital PCR technology, does not need a normal sample as a control, does not need complex analysis software, can overcome the condition that low frequency and loss of heterozygosity are difficult to detect, and has detection sensitivity reaching 0.1%.
In order to achieve the purpose of the invention, the technical scheme is as follows:
a kit for detecting instability of a microsatellite is composed of a digital PCR reaction solution 1, a digital PCR reaction solution 2, a digital PCR reaction solution 3, a digital PCR premix solution 1, a digital PCR premix solution 2, a negative quality control product, a positive quality control product and a denucleated enzyme solution;
wherein, the digital PCR reaction solution 1 is used for detecting MSI sites BAT-25 and BAT-26; the digital PCR reaction solution 2 is used for detecting MSI sites NR-21 and NR-24; the digital PCR reaction solution 3 is used for detecting the MSI locus MONO-27;
further, primers and probes for detection of MSI site BAT-25 were: consisting of SEQ ID No: 1, and a forward primer BAT-25-F represented by SEQ ID No: 2, and a reverse primer BAT-25-R represented by SEQ ID No: 3, and a specific probe BAT-25-P1 represented by SEQ ID No: 4, BAT-25-P2, wherein SEQ ID No: 3 has HEX mark at 5 'end and BHQ-MGB mark at 3' end, wherein SEQ ID No: 4 has a CY5 marker at the 5 'end and a BHQ-MGB marker at the 3' end;
further, primers and probes for detection of MSI site BAT-26 were: consisting of SEQ ID No: 5, and a forward primer BAT-26-F represented by SEQ ID No: 6, and a reverse primer BAT-26-R represented by SEQ ID No: 7, and a specific probe BAT-26-P1 consisting of SEQ ID No: BAT-26-P2 shown in SEQ ID No: 7 has HEX mark at 5 'end and BHQ-MGB mark at 3' end, wherein SEQ ID No: 8, the 5 'end of the nucleotide sequence is marked with FAM, and the 3' end is marked with BHQ-MGB;
further, primers and probes for detecting MSI site NR-21 were: consisting of SEQ ID No: 9, and a forward primer NR-21-F consisting of SEQ ID No: 10, reverse primer NR-21-R consisting of SEQ ID No: 11, and a specific probe NR-21-P1 consisting of SEQ ID No: 12, NR-21-P2, wherein SEQ ID No: 11, wherein the 5 'end of the nucleotide sequence is marked by HEX, and the 3' end is marked by BHQ-MGB, wherein the nucleotide sequence shown in SEQ ID No: 12 is marked by CY5 at the 5 'end and BHQ-MGB at the 3' end;
further, primers and probes for detecting MSI site NR-24 were: consisting of SEQ ID No: 13, and a forward primer NR-24-F consisting of SEQ ID No: 14, and a reverse primer NR-24-R consisting of SEQ ID No: 15, and a specific probe NR-24-P1 represented by SEQ ID No: 16, NR-24-P2, wherein SEQ ID No: 15 has HEX mark at 5 'end and BHQ-MGB mark at 3' end, wherein SEQ ID No: 16 has FAM mark at 5 'end and BHQ-MGB mark at 3' end;
further, primers and probes for detection of the MSI site MONO-27 were: consisting of SEQ ID No: 17, and a forward primer MONO-27-F represented by SEQ ID No: 18, and a reverse primer MONO-27-R consisting of SEQ ID No: 19, and a specific probe MONO-27-P1 consisting of SEQ ID No: 20, MONO-27-P2, wherein SEQ ID No: 19, wherein the 5' end of the nucleotide sequence shown in the SEQ ID No: 20 is marked by CY5 at the 5 'end and BHQ-MGB at the 3' end;
further, the digital PCR premix 1 is a 5-fold concentrate of perfect cta Multiplex qPCR ToughMix;
further, the digital PCR premix 2 is a fluorescein sodium salt solution with the concentration of 10 μ M;
further, the negative quality control product is a normal cell genome DNA solution;
furthermore, the positive quality control product is a cell line HCT-116 genome DNA solution.
See table 1 for the specific composition of the kit.
TABLE 1 compositions of the kits
| Serial number | Name of reagent | Reagent composition | Quantity of identification | Number of |
| 1 | Digital PCR reaction solution 1 | Mixture of primers and probe solutions for BAT-25 and BAT-26 | 100μL | 1 tube |
| 2 | Digital PCR reaction solution 2 | Mixed solution of NR-21 and NR-24 primers and probe solution | 100μL | 1 tube |
| 3 | Digital PCR reaction solution 3 | Mixture of MONO-27 primer and probe solution | 100μL | 1 tube |
| 4 | Digital PCR premix 1 | Perfectta Multiplex qPCR ToughMix, 5-fold concentrate | 400μL | 1 tube |
| 5 | Digital PCR premix 2 | 10 μ M fluorescein sodium salt solution | 100μL | 1 tube |
| 6 | Negative quality control product | Genomic DNA solution of normal cells | 300μL | 1 tube |
| 7 | Positive quality control product | Cell line HCT-116 genomic DNA solution | 300μL | 1 tube |
| 8 | Nuclease-free water | 1mL | 1 tube |
A use method of a kit for detecting microsatellite instability comprises a digital PCR reaction solution 1, a digital PCR reaction solution 2, a digital PCR reaction solution 3, a digital PCR premix solution 1, a digital PCR premix solution 2, a negative quality control product, a positive quality control product and enucleated enzyme water, and comprises the following steps:
(1) taking out eight components in a kit for detecting the instability of the microsatellite, namely a digital PCR reaction solution 1, a digital PCR reaction solution 2, a digital PCR reaction solution 3, a digital PCR premix solution 1, a digital PCR premix solution 2, a negative quality control product, a positive quality control product and enucleated enzyme water, melting on ice, uniformly oscillating, centrifuging for a few seconds for a short time, and preparing into a mixed solution of three digital PCR reaction systems;
(2) adding the prepared mixed solution of the three digital PCR reaction systems into a chip according to 25 mu L/hole respectively, and covering a white long cover;
(3) putting the chip loaded with 25 mu L of mixed liquid of the three digital PCR reaction systems into the droplet generation and amplification system all-in-one machine, and carrying out digital PCR reaction according to a set digital PCR reaction program;
(4) after the reaction is finished, scanning a chip to obtain data information of CY5, HEX and FAM fluorescence channels, wherein the copy number corresponding to the number of droplets containing CY5 single fluorescence signals in the result amplified by using the mixed liquid 1 of the digital PCR reaction system represents the concentration of the stable state of the MSI site BAT-25, the copy number corresponding to the number of droplets containing CY5+ HEX double fluorescence signals represents the concentration of the stable state of the MSI site BAT-25, the copy number corresponding to the number of droplets containing FAM single fluorescence signals represents the concentration of the stable state of the MSI site BAT-26, and the copy number corresponding to the number of droplets containing FAM + HEX double fluorescence signals represents the concentration of the stable state of the MSI site BAT-26; the variation frequency of the unstable state of BAT-25 at the MSI site is equal to the copy number corresponding to the number of microdroplets containing CY5 single fluorescent signal/(the copy number corresponding to the number of microdroplets containing CY5 single fluorescent signal + the sum of the copy numbers corresponding to the number of microdroplets containing CY5+ HEX double fluorescent signal) × 100%; the variation frequency of the unstable state of BAT-26 at the MSI site is equal to the number of copies corresponding to the number of droplets containing FAM monofluorescence signal/(the number of copies corresponding to the number of droplets containing FAM monofluorescence signal + the number of copies corresponding to the number of droplets containing FAM + HEX bifluorescence signal) × 100%;
(5) after the reaction is finished, scanning a chip to obtain data information of CY5, HEX and FAM fluorescence channels, wherein the copy number corresponding to the number of droplets containing CY5 single fluorescence signals in the result amplified by using the mixed liquid 2 of the digital PCR reaction system represents the concentration of the stable state of the MSI site NR-21, the copy number corresponding to the number of droplets containing CY5+ HEX double fluorescence signals represents the concentration of the stable state of the MSI site NR-21, the copy number corresponding to the number of droplets containing FAM single fluorescence signals represents the concentration of the stable state of the MSI site NR-24, and the copy number corresponding to the number of droplets containing FAM + HEX double fluorescence signals represents the concentration of the stable state of the MSI site NR-24; the variable frequency of the unstable state of NR-21 at the MSI site is equal to the number of copies corresponding to the number of droplets containing CY5 single fluorescent signal/(the number of copies corresponding to the number of droplets containing CY5 single fluorescent signal + the number of copies corresponding to the number of droplets containing CY5+ HEX double fluorescent signal) × 100%; the variable frequency of the unstable state of NR-24 at the MSI site is equal to the number of copies per number of droplets containing FAM monofluorescence signal/(number of copies per number of droplets containing FAM monofluorescence signal + number of copies per number of droplets containing FAM + HEX bifluorescence signal) × 100%;
(6) after the reaction is finished, scanning the chip to obtain the data information of CY5, HEX and FAM fluorescence channels, wherein the copy number corresponding to the number of microdroplets containing CY5 single fluorescence signals in the result amplified by using the mixed liquid 3 of the digital PCR reaction system represents the concentration of the MSI site MONO-27 unstable state, and the copy number corresponding to the number of microdroplets containing CY5+ HEX double fluorescence signals represents the concentration of the MSI site MONO-27 stable state; the variable frequency of the unstable state of MSI locus MONO-27 was 100% times the copy number corresponding to the number of droplets containing CY5 single fluorescent signal/(copy number corresponding to the number of droplets containing CY5 single fluorescent signal + copy number corresponding to the number of droplets containing CY5+ HEX double fluorescent signal);
(7) among the variation frequency of the MSI locus BAT-25 unstable state, the variation frequency of the MSI locus BAT-26 unstable state, the variation frequency of the MSI locus NR-21 unstable state, the variation frequency of the MSI locus NR-24 unstable state, and the variation frequency of the MSI locus MONO-27 unstable state, a microsatellite is highly unstable if the variation frequency of more than 2 MSI loci is 0.1% or more, and a microsatellite is less unstable if the variation frequency of 1 MSI locus is 0.1% or more.
Drawings
FIG. 1 is a graph showing fluorescence signals of the MSI site BAT-25 in example 1 (Red-Green).
FIG. 2 is a graph showing fluorescence signals of the MSI site BAT-26 in example 1 (Blue-Green).
FIG. 3 is a graph showing the fluorescence signal of the MSI site NR-21 in example 1 (Red-Green).
FIG. 4 is a graph showing the fluorescence signal of the MSI site NR-24 in example 1 (Blue-Green).
FIG. 5 is a graph showing the fluorescence signal of MSI site MONO-27 in example 1 (Red-Green).
FIG. 6 is a graph of the fluorescence signal of the MSI site BAT-25 detection using the kit of the invention in example 4 with the sample number CM20190624002 (Red-Green).
FIG. 7 is a graph of fluorescence signals from the MSI site BAT-26 detection of the sample number CM20190624002 using the kit of the present invention in example 4 (Blue-Green).
FIG. 8 is a graph showing detection peaks at MSI sites BAT-25 and BAT-26 in example 4 using the MSI Analysis system, version 1.2 kit (Promega corporation, USA) with the sample number CM 20190624002.
Detailed Description
In order to more clearly explain the present invention, the technical solutions of the present invention will be more fully described below with reference to the following detailed description and accompanying drawings. The present invention can be applied to various gene tests without being limited to the examples described herein, and the experimental methods of the following examples, in which specific conditions are not noted, are generally performed as described in the conventional conditions.
Example 1: kit for detecting instability of microsatellite
1.1 in Gene Bank, the Gene number of the MSI site to be detected is referred to, the main repetitive sequence of each MSI site and the base sequence about 400bp upstream and downstream of the main repetitive sequence are determined, and the related information of the micro MSI site is shown in Table 2.
Table 2: MSI site information
| Microsatellite loci | Gene | Gene numbering | Major repeat sequences |
| BAT-25 | c-KIT | L04143 | (A)25 |
| BAT-26 | hMSH2 | U41210 | (A)26 |
| NR-21 | SLC7A8 | XM_033393 | (A)21 |
| NR-24 | Zinc finger2 | X60152 | (A)24 |
| MONO-27 | MAP4K3 | Ac007684 | (A)27 |
1.2 according to the target gene sequence, aiming at each MSI locus, a plurality of primers and a plurality of specific probes are designed, the 5 'end of each probe is marked with a fluorescent group, the 3' end of each probe is marked with a quenching group, and the primers and the probes shown in the table 3 are selected through multiple screening and detection.
TABLE 3 primer and Probe sequences for detection of MSI sites
| Primer Probe name | SEQ ID No. | Sequence(5’-3’) | Decoration |
| BAT-25-F1 | SEQ ID No.1 | TGGGAGTGATTCTCTAAAG | |
| BAT-25-R1 | SEQ ID No.2 | CCACACTTCAAAATGACATTC | |
| BAT-25-P1 | SEQ ID No.3 | TGATTTTTTTTTTTTTTTTTTTTTTTTTGAGA | 5'-HEX,3'-MGB |
| BAT-25-P2 | SEQ ID No.4 | AGAGCATTTTAGAGCCATAGTT | 5'-CY5,3'-MGB |
| BAT-26-F1 | SEQ ID No.5 | TTCATATACTGGCTGAAGTC | |
| BAT-26-R1 | SEQ ID No.6 | TCTTCAGTATATGTCAATGA | |
| BAT-26-P1 | SEQ ID No.7 | ACCCTTTTTTTTTTTTTTTTTTTTTTTTTTTACC | 5'-HEX,3'-MGB |
| BAT-26-P2 | SEQ ID No.8 | AGGTTAAGGGCTCTGACTGCTGC | 5'-FAM,3'-MGB |
| NR-21-F1 | SEQ ID No.9 | TTATATTTAAATGTATGTCTC | |
| NR-21-R1 | SEQ ID No.10 | CAAGCAGATAAAAGAGAAC | |
| NR-21-P1 | SEQ ID No.11 | TGGCCTTTTTTTTTTTTTTTTTTTTTAGCA | 5'-HEX,3'-MGB |
| NR-21-P2 | SEQ ID No.12 | ACGCGAGTGACCAGAAAGTGT | 5'-CY5,3'-MGB |
| NR-24-F1 | SEQ ID No.13 | GTGATCCCCATTGCTGAAT | |
| NR-24-R1 | SEQ ID No.14 | GGAGATTGTGCCATTGCAT | |
| NR-24-P1 | SEQ ID No.15 | TCCTATTTTTTTTTTTTTTTTTTTTTTTGTG | 5'-HEX,3'-MGB |
| NR-24-P2 | SEQ ID No.16 | CAGAGTCTCACTCTGTCACCCA | 5'-FAM,3'-MGB |
| MONO-27-F1 | SEQ ID No.17 | ACTTAATATCCCTAAACAAT | |
| MONO-27-R1 | SEQ ID No.18 | GCCTGGGTGACATAATGA | |
| MONO-27-P1 | SEQ ID No.19 | CTCCAGTTTTTTTTTTTTTTTTTTTTTTTTTTTTGA | 5'-HEX,3'-MGB |
| MONO-27-P2 | SEQ ID No.20 | ACTACAGGCATGAATTACTACTGT | 5'-CY5,3'-MGB |
1.3 digital PCR reaction solution 1 was prepared from 100. mu. mol/L of upstream primer BAT-25-F1, 100. mu. mol/L of downstream primer BAT-25-R1, 100. mu. mol/L of upstream primer BAT-26-F1, 100. mu. mol/L of downstream primer BAT-26-R1, 50. mu. mol/L of probe BAT-25-P1, 50. mu. mol/L of probe BAT-25-P2, 50. mu. mol/L of probe BAT-26-P1, 50. mu. mol/L of probe BAT-26-P2, 10. mu. mol/L of upstream primer BAT-25-F1, 10. mu. mol/L of downstream primer BAT-25-R1, 10. mu. mol/L of upstream primer BAT-26-F1, 10. mu. mol/L of downstream primer BAT-26-P2, and the like all of the DNA sequence of the sequence of, The downstream primer BAT-26-R1 is 10 mu mol/L, the probe BAT-25-P1 is 5 mu mol/L, the probe BAT-25-P2 is 5 mu mol/L, the probe BAT-26-P1 is 5 mu mol/L and the probe BAT-26-P2 is 5 mu mol/L;
1.4 digital PCR reaction solution 2 was prepared from 100. mu. mol/L of upstream primer NR-21-F1, 100. mu. mol/L of downstream primer NR-21-R1, 100. mu. mol/L of upstream primer NR-24-F1, 100. mu. mol/L of downstream primer NR-24-R1, 50. mu. mol/L of probe NR-21-P1, 50. mu. mol/L of probe NR-21-P2, 50. mu. mol/L of probe NR-24-P1 and 50. mu. mol/L of probe NR-24-P2 determined by primer and probe concentration screening experiments, and the upstream primer NR-21-R1, the downstream primer NR-24-F1, the upstream primer NR-21-F1, the downstream primer NR-21-R1, and the upstream primer NR-24-F1 in the prepared digital PCR reaction solution 2 were 10. mu. mol/L, The downstream primer NR-24-R1 is 10 mu mol/L, the probe NR-21-P1 is 5 mu mol/L, the probe NR-21-P2 is 5 mu mol/L, the probe NR-24-P1 is 5 mu mol/L and the probe NR-24-P2 is 5 mu mol/L;
1.5 digital PCR reaction liquid 3 is prepared by 100 mu mol/L upstream primer MONO-27-F1, 100 mu mol/L downstream primer MONO-27-R1, 50 mu mol/L probe MONO-27-P1 and 50 mu mol/L probe MONO-27-P2 which are determined after primer and probe concentration screening experiments, and the prepared digital PCR reaction liquid 3 has the upstream primer MONO-27-F1 of 10 mu mol/L, the downstream primer MONO-27-R1 of 10 mu mol/L, the probe MONO-27-P1 of 5 mu mol/L and the probe MONO-27-P2 of 5 mu mol/L.
1.6 digital PCR premix 1 was a 5-fold concentrate of Perfecta Multiplex qPCR ToughMix, which was purchased from Quanta BioSciences, USA.
1.7 digital PCR premix 2 was sodium fluorescein salt at a concentration of 10. mu.M.
1.8 the negative quality control material is the genome DNA of normal cells.
1.9 the positive quality control substance is genome DNA of a cell line HCT-116;
1.10 the kit for detecting the instability of the microsatellite consists of eight components, namely the digital PCR reaction solution 1, the digital PCR reaction solution 2, the digital PCR reaction solution 3, the digital PCR premix solution 1, the digital PCR premix solution 2, a negative quality control product, a positive quality control product and nuclease-free water, and the components of the kit are shown in a table 4.
TABLE 4 Components of kit
| Serial number | Name of reagent | Reagent composition | Quantity of identification | Number of |
| 1 | Digital PCR reaction solution 1 | Mixture of primers and probe solutions for BAT-25 and BAT-26 | 100μL | 1 tube |
| 2 | Digital PCR reaction solution 2 | Mixed solution of NR-21 and NR-24 primers and probe solution | 100μL | 1 tube |
| 3 | Digital PCR reaction solution 3 | Mixture of MONO-27 primer and probe solution | 100μL | 1 tube |
| 4 | Digital PCR premix 1 | Perfectta Multiplex qPCR ToughMix, 5-fold concentrate | 400μL | 1 tube |
| 5 | Digital PCR premix 2 | 10 μ M fluorescein sodium salt solution | 100μL | 1 tube |
| 6 | Negative quality control product | Genomic DNA solution of normal cells | 300μL | 1 tube |
| 7 | Positive quality control product | Cell line HCT-116 genomic DNA solution | 300μL | 1 tube |
| 8 | Nuclease-free water | 1mL | 1 tube |
Example 2: use method of kit for detecting instability of microsatellite
2.1 Instrument: naicaTMStilla digital PCR instrument (Stila TECHNOLOGE, France).
2.2 extraction of DNA from samples: DNA in the sample was extracted, and the extracted DNA was diluted to 50 ng/. mu.L and used as a template for digital PCR amplification.
2.3 preparation of digital PCR amplification reagents:
eight components of the kit, namely digital PCR reaction liquid 1, digital PCR reaction liquid 2, digital PCR reaction liquid 3, digital PCR premix liquid 1, digital PCR premix liquid 2, negative quality control products, positive quality control products and enucleated enzyme water, are taken out from the kit for detecting instability of microsatellites, are melted on ice completely and are uniformly oscillated, centrifuged for a few seconds for a short time, and a digital PCR reaction system mixed liquid I, a digital PCR reaction system mixed liquid II and a digital PCR reaction system mixed liquid III are prepared according to tables 5, 6 and 7;
TABLE 5 digital PCR reaction System mixture I
| Serial number | Components | Addition amount (μ L) |
| 1 | Digital PCR reaction solution 1 | 1 |
| 2 | Digital PCR premix 1 | 5 |
| 3 | Digital PCR premix 2 | 2.5 |
| 4 | Enucleated enzyme water | 14.5 |
| 5 | DNA template (simultaneously, negative quality control and positive quality control 1) | 2 |
| Total of | 25 |
TABLE 6 digital PCR reaction System Mixed solution II
| Serial number | Components | Addition amount (μ L) |
| 1 | Digital PCR reaction solution 2 | 1 |
| 2 | Digital PCR premix 1 | 5 |
| 3 | Digital PCR premix 2 | 2.5 |
| 4 | Enucleated enzyme water | 14.5 |
| 5 | DNA template (simultaneously, negative quality control and positive quality control 1) | 2 |
| Total of | 25 |
TABLE 7 liquid mixture III of digital PCR reaction system
| Serial number | Components | Addition amount (μ L) |
| 1 | Digital PCR reaction solution 3 | 1 |
| 2 | Digital PCR premix 1 | 5 |
| 3 | Digital PCR premix 2 | 2.5 |
| 4 | Enucleated enzyme water | 14.5 |
| 5 | DNA template (simultaneously, negative quality control and positive quality control 1) | 2 |
| Total of | 25 |
2.4 sample application and amplification
Adding the prepared digital PCR reaction system mixed solution I, the digital PCR reaction system mixed solution II and the digital PCR reaction system mixed solution III into the chip according to 25 mu L/hole respectively, and covering the chip with a white long cover.
Putting a chip loaded with 25 mu L of mixed liquid of three digital PCR reaction systems into NaicaTMIn the Geode droplet generation and amplification system, the digital PCR reaction program was set up according to table 8 and the digital PCR reaction was performed.
TABLE 8 digital PCR reaction procedure
2.5 after the digital PCR reaction is finished, the chip is placed in NaicaTMprim3 droplet read assay system, and fluorescence signal acquisition and analysis was performed. Analysis of the results was performed using Crystal Miner software, as shown in FIGS. 1 to 5, by detecting the fluorescence signals of FAM (blue), HEX (Green), and CY5(Red), the copy number concentrations of the MSI sites BAT-25, BAT-26, NR-21, NR-24, and MONO-27 present in the sample and their variation frequencies were obtained.
As shown in FIG. 1, the copy number corresponding to the number of droplets containing CY5(Red) single fluorescent signal in quadrant IV represents the concentration of the unstable state of BAT-25 at the MSI site; the copy number corresponding to the number of droplets containing CY5+ HEX (Red + Green) double fluorescent signal in quadrant I represents the steady-state concentration of BAT-25; the variation frequency of the unstable state of BAT-25 was equal to the copy number corresponding to the number of droplets containing CY5 monofluorescent signal/(the copy number corresponding to the number of droplets containing CY5 monofluorescent signal + the sum of the copy numbers corresponding to the number of droplets containing CY5+ HEX bifluorescent signal) × 100%.
As shown in FIG. 2, the number of copies corresponding to the number of droplets containing FAM (blue) single fluorescent signal in quadrant IV represents the concentration of the unstable state of BAT-26 at the MSI site; the number of copies corresponding to the number of droplets containing FAM + HEX (Blue + Green) dual fluorescent signal in quadrant I represents the stable concentration of BAT-26; the variation frequency of the unstable state of BAT-26 was equal to the number of droplets containing FAM monofluorescence signal/(the number of droplets containing FAM monofluorescence signal + the number of droplets containing FAM + HEX bifluorescence signal) × 100%.
As shown in FIG. 3, the number of copies corresponding to the number of droplets containing CY5(Red) single fluorescent signal in the IV quadrant represents the concentration of the MSI site NR-21 unstable state; the number of copies corresponding to the number of droplets containing CY5+ HEX (Red + Green) double fluorescent signal in quadrant I represents the concentration of NR-21 in the steady state; the frequency of variation of the NR-21 unstable state is equal to the number of copies corresponding to the number of droplets containing CY5 monofluorescent signal/(number of copies corresponding to the number of droplets containing CY5 monofluorescent signal + number of copies corresponding to the number of droplets containing CY5+ HEX bifluorescent signal) × 100%.
As shown in FIG. 4, the number of copies corresponding to the number of droplets containing FAM (blue) single fluorescent signal in quadrant IV represents the concentration of the MSI site NR-24 unstable state; the number of copies corresponding to the number of droplets containing FAM + HEX (Blue + Green) dual fluorescent signals in quadrant I represents the NR-24 steady-state concentration; the frequency of variation of the NR-24 unstable state is equal to the number of copies corresponding to the number of droplets containing FAM monofluorescence signal/(the number of copies corresponding to the number of droplets containing FAM monofluorescence signal + the number of copies corresponding to the number of droplets containing FAM + HEX bifluorescence signal) × 100%.
As shown in fig. 5, the number of copies corresponding to the number of droplets containing CY5(Red) single fluorescence signal in quadrant iv represents the concentration of MSI site MONO-27 instability status; the number of copies corresponding to the number of droplets containing CY5+ HEX (Red + Green) double fluorescent signal in quadrant I represents the steady state concentration of MONO-27; the frequency of variation of the MONO-27 instability state was equal to the number of copies corresponding to the number of droplets containing CY5 monofluorescent signal/(number of copies corresponding to the number of droplets containing CY5 monofluorescent signal + number of copies corresponding to the number of droplets containing CY5+ HEX bifluorescent signal) × 100%;
as described above, we can clearly and directly determine the states of five MSI sites BAT-25, BAT-26, NR-21, NR-24 and MONO-27 and calculate the variation frequency of the five MSI sites and determine the MSI states by the states of five single nucleotide repeat sites recommended by the National Cancer Institute (NCI), and the criteria are shown in Table 9.
TABLE 9 determination criteria Table for MSI State recommended by NCI
| Number of MSI sites | MSI type |
| Not less than 2 | Microsatellite high instability (MSI-H) |
| 1 is provided with | Low instability of microsatellite (MSI-L) |
| 0 number of | Microsatellite stability (MSS) |
Example 3: determination of sensitivity of kit for detecting instability of microsatellite
In order to verify the detection sensitivity of the kit of the invention, genomic DNA solutions of the MSI highly unstable cell line HCT-116 and the stable cell line K562 were mixed in proportion to obtain four DNA mixtures in which the proportions of HCT-116 were 10%, 1%, 0.1% and 0.05%, respectively.
The four DNA mixtures of 10%, 1%, 0.1% and 0.05% above were tested using the kit described in example 1 and the kit usage described in example 2 and the average was calculated after three replicates. The results show that the kit of the present invention is close to the lowest limit of detection when the MSI highly unstable ratio is 0.1%, and when the MSI highly unstable ratio is 0.0.5%, only 1 MSI site can be detected, so that the determination result of detection is changed, therefore, the detection sensitivity of the kit of the present invention is 0.1%, and the detection results are shown in Table 10.
TABLE 10 detection results of sensitivity of the kit of the present invention
Example 4: the kit and the capillary electrophoresis method of the invention are used for detecting clinical samples
In the embodiment, two methods are adopted to respectively detect the MSI of the clinical samples, and the method 1 is the kit disclosed by the invention; method 2 is a capillary electrophoresis method.
4.1 the detection method of the kit described in example 1 and the kit described in example 2 is adopted to detect the FFPE tissue DNA of eight tumors. Eight cases of tumor and paracarcinoma paraffin sections were taken and sample DNAs were extracted, and the DNA concentrations were diluted to 50 ng/. mu.L for use, respectively, and the results of the measurements are shown in Table 11.
TABLE 11 results of DNA detection in paraffin sections of eight tumors using the kit of the present invention
The results of the measurement of the specimen with the kit of the present invention, which was CM20190624002, are shown in FIGS. 6 and 7, and the positive droplet of CY5(Red) in the IV quadrant shown in FIG. 6 is in the presence of MSI site BAT-25, and the variation frequency of MSI site BAT-25 in the specimen with the kit of FIG. 20190624002 in Table 11 is 2.4%, indicating that MSI site BAT-25 is unstable. As shown in FIG. 7, the FAM (blue) positive droplet in quadrant IV is in the presence of the MSI site BAT-26, and the variation frequency of the MSI site BAT-26 in Table 11 with the sample number CM20190624002 is 46%, indicating that the MSI site BAT-26 is unstable. According to the determination criteria table of MSI status in Table 9, that is, the number of unstable mononucleotide repeat sites is not less than 2, the determination is made as the high instability of microsatellite (MSI-H), and the sample CM20190624002 is determined as the high instability of MSI.
4.2 samples were tested using the MSI Analysis system, version 1.2 kit (Promega corporation, USA, cat # MD 1641). Since capillary electrophoresis requires a control for data analysis, when the capillary electrophoresis is used to detect MSI in these 8 tumor tissues, DNA of the para-carcinoma tissues corresponding to the 8 tumor tissues must be used as a control. Therefore, in this example, if the capillary electrophoresis method is used to detect MSI, 16 samples must be detected to obtain the MSI data. The results of detecting MSI BAT-25 and BAT-26 in CM20190624002 using the MSI Analysis system, version 1.2 kit, are shown in FIG. 8, where the peak of the detection result in cancer-side tissue is used as a control, the position of MSI BAT-25 in cancer-side tissue in the control is 122.99, the position in tumor tissue is 122.98, and the size of the fragment is unchanged, indicating that the BAT-25 at the MSI site is in a stable state; the location of MSI BAT-26 in the cancer-adjacent tissue of the control sample was 112.97, and the location in the tumor tissue sample was 116.68, indicating that the size of 4bp fragment of MSI BAT-26 was changed, indicating that MSI BAT-26 was unstable. The determination was made based on the criterion of MSI status in Table 9, that is, the method of low microsatellite instability (MSI-L) when the number of MSI sites is 1, and it was determined that the sample CM20190624002 was low MSI instability.
4.3 comparison of the test results of the kit of the present invention with the MSI Analysis system, version 1.2 kit is shown in Table 12.
TABLE 12, two methods test result comparison table
As can be seen from example 4, the kit and the capillary electrophoresis method of the present invention are used to detect clinical paraffin section samples, six of eight samples are all detected as microsatellite instability, wherein five of six samples detected by the kit of the present invention are microsatellite high instability (MSI-H) and one is microsatellite low instability (MSI-L). In contrast, four of the six samples tested in the MSI Analysis system, version 1.2 kit were microsatellite high instability (MSI-H) and two were microsatellite low instability (MSI-L). The result shows that the detection sensitivity of the kit disclosed by the invention to the high instability of the microsatellite is higher than that of the detection kit of the capillary electrophoresis method commonly used in the market at present.
Sequence listing
<110> Epraka Biotechnology (Suzhou) Ltd
<120> kit for detecting instability of microsatellite
<141> 2021-09-17
<160> 20
<170> SIPOSequenceListing 1.0
<210> 1
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
tgggagtgat tctctaaag 19
<210> 2
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ccacacttca aaatgacatt c 21
<210> 3
<211> 32
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
tgattttttt tttttttttt ttttttttga ga 32
<210> 4
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
agagcatttt agagccatag tt 22
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
ttcatatact ggctgaagtc 20
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
tcttcagtat atgtcaatga 20
<210> 7
<211> 33
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
accctttttt tttttttttt tttttttttt acc 33
<210> 8
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
aggttaaggg ctctgactgc tgc 23
<210> 9
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
ttatatttaa atgtatgtct c 21
<210> 10
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
caagcagata aaagagaac 19
<210> 11
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
tggccttttt tttttttttt ttttttagca 30
<210> 12
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
acgcgagtga ccagaaagtg t 21
<210> 13
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
gtgatcccca ttgctgaat 19
<210> 14
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
ggagattgtg ccattgcat 19
<210> 15
<211> 32
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
tcctattttt tttttttttt tttttttttg tg 32
<210> 16
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
cagagtctca ctctgtcacc ca 22
<210> 17
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
acttaatatc cctaaacaat 20
<210> 18
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
gcctgggtga cataatga 18
<210> 19
<211> 35
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
ctccagtttt tttttttttt tttttttttt tttga 35
<210> 20
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
actacaggca tgaattactg t 21
Claims (2)
1. A kit for detecting instability of a microsatellite is characterized by comprising a digital PCR reaction solution 1, a digital PCR reaction solution 2, a digital PCR reaction solution 3, a digital PCR premix solution 1, a digital PCR premix solution 2, a negative quality control product, a positive quality control product and nuclease-free water;
the digital PCR reaction solution 1 is used for detecting microsatellite loci BAT-25 and BAT-26; the digital PCR reaction solution 2 is used for detecting microsatellite loci NR-21 and NR-24; the digital PCR reaction solution 3 is used for detecting a microsatellite locus MONO-27;
the primers and the probes for detecting the microsatellite locus BAT-25 are as follows: consisting of SEQ ID No: 1, and a forward primer BAT-25-F represented by SEQ ID No: 2, and a reverse primer BAT-25-R represented by SEQ ID No: 3, and a specific probe BAT-25-P1 represented by SEQ ID No: 4, BAT-25-P2, wherein SEQ ID No: 3 has HEX mark at 5 'end and BHQ-MGB mark at 3' end, wherein SEQ ID No: 4 has a CY5 marker at the 5 'end and a BHQ-MGB marker at the 3' end;
the primers and the probes for detecting the microsatellite locus BAT-26 are as follows: consisting of SEQ ID No: 5, and a forward primer BAT-26-F represented by SEQ ID No: 6, and a reverse primer BAT-26-R represented by SEQ ID No: 7, and a specific probe BAT-26-P1 consisting of SEQ ID No: BAT-26-P2 shown in SEQ ID No: 7 has HEX mark at 5 'end and BHQ-MGB mark at 3' end, wherein SEQ ID No: 8, the 5 'end of the nucleotide sequence is marked with FAM, and the 3' end is marked with BHQ-MGB;
the primer and the probe for detecting the microsatellite locus NR-21 are as follows: consisting of SEQ ID No: 9, and a forward primer NR-21-F consisting of SEQ ID No: 10, reverse primer NR-21-R consisting of SEQ ID No: 11, and a specific probe NR-21-P1 consisting of SEQ ID No: 12, NR-21-P2, wherein SEQ ID No: 11, wherein the 5 'end of the nucleotide sequence is marked by HEX, and the 3' end is marked by BHQ-MGB, wherein the nucleotide sequence shown in SEQ ID No: 12 is marked by CY5 at the 5 'end and BHQ-MGB at the 3' end;
the primer and the probe for detecting the microsatellite locus NR-24 are as follows: consisting of SEQ ID No: 13, and a forward primer NR-24-F consisting of SEQ ID No: 14, and a reverse primer NR-24-R consisting of SEQ ID No: 15, and a specific probe NR-24-P1 represented by SEQ ID No: 16, NR-24-P2, wherein SEQ ID No: 15 has HEX mark at 5 'end and BHQ-MGB mark at 3' end, wherein SEQ ID No: 16 has FAM mark at 5 'end and BHQ-MGB mark at 3' end;
the primers and the probes for detecting the microsatellite locus MONO-27 are as follows: consisting of SEQ ID No: 17, and a forward primer MONO-27-F represented by SEQ ID No: 18, and a reverse primer MONO-27-R consisting of SEQ ID No: 19, and a specific probe MONO-27-P1 consisting of SEQ ID No: 20, MONO-27-P2, wherein SEQ ID No: 19, wherein the 5' end of the nucleotide sequence shown in the SEQ ID No: 20 is marked by CY5 at the 5 'end and BHQ-MGB at the 3' end;
the digital PCR premix 1 is 5 times of concentrated solution of Perfecta Multiplex qPCR Toughmix;
the digital PCR premix solution 2 is a fluorescein sodium salt solution with the concentration of 10 mu M;
the negative quality control product is a normal cell genome DNA solution;
the positive quality control product is a cell line HCT-116 genome DNA solution.
2. A method for using a kit for detecting microsatellite instability, which comprises the steps of:
(1) taking out eight components in a kit for detecting instability of a microsatellite, namely a digital PCR reaction solution 1, a digital PCR reaction solution 2, a digital PCR reaction solution 3, a digital PCR premix solution 1, a digital PCR premix solution 2, a negative quality control product, a positive quality control product and nuclease-free water, melting on ice, uniformly oscillating, centrifuging for a few seconds for a short time, and respectively preparing a digital PCR reaction system mixed solution I, a digital PCR reaction system mixed solution II and a digital PCR reaction system mixed solution III;
(2) adding the prepared digital PCR reaction system mixed solution I, the prepared digital PCR reaction system mixed solution II and the prepared digital PCR reaction system mixed solution III into a chip according to 25 mu L/hole respectively, and covering a white long cover;
(3) putting a chip loaded with 25 mu L of digital PCR reaction system mixed liquor I, digital PCR reaction system mixed liquor II and digital PCR reaction system mixed liquor III into a droplet generation and amplification system all-in-one machine, and carrying out digital PCR reaction according to a set digital PCR reaction program;
(4) after the reaction is finished, scanning a chip to obtain data information of CY5, HEX and FAM fluorescence channels, wherein the copy number corresponding to the number of microdroplets containing CY5 single fluorescence signals in the amplified result of the mixed liquid I of the digital PCR reaction system represents the concentration of the stable state BAT-25 at the MSI site, the copy number corresponding to the number of microdroplets containing CY5+ HEX double fluorescence signals represents the concentration of the stable state BAT-25, the copy number corresponding to the number of microdroplets containing FAM single fluorescence signals represents the concentration of the stable state BAT-26 at the MSI site, and the copy number corresponding to the number of microdroplets containing FAM + HEX double fluorescence signals represents the concentration of the stable state BAT-26; the variation frequency of the unstable state of BAT-25 is equal to the copy number corresponding to the number of droplets containing CY5 monofluorescent signal/(the sum of the copy number corresponding to the number of droplets containing CY5 monofluorescent signal + the copy number corresponding to the number of droplets containing CY5+ HEX bifluorescent signal) × 100%; the variation frequency of the unstable BAT-26 state was equal to the number of droplets containing FAM monofluorescence signal (copy number corresponding to the number of droplets containing FAM monofluorescence signal + copy number corresponding to the number of droplets containing FAM + HEX bifluorescence signal) × 100%;
(5) after the reaction is finished, scanning a chip to obtain data information of CY5, HEX and FAM fluorescence channels, wherein the copy number corresponding to the number of microdroplets containing CY5 single fluorescence signals in the result amplified by using the mixed liquid II of the digital PCR reaction system represents the concentration of the stable state of the MSI site NR-21, the copy number corresponding to the number of microdroplets containing CY5+ HEX double fluorescence signals represents the concentration of the stable state of NR-21, the copy number corresponding to the number of microdroplets containing FAM single fluorescence signals represents the concentration of the stable state of the MSI site NR-24, and the copy number corresponding to the number of microdroplets containing FAM + HEX double fluorescence signals represents the concentration of the stable state of NR-24; the NR-21 instability had a frequency of copy number corresponding to the number of droplets containing CY5 monofluorescent signal/(copy number corresponding to the number of droplets containing CY5 monofluorescent signal + copy number corresponding to the number of droplets containing CY5+ HEX bifluorescent signal) × 100%; the NR-24 unstable state has a frequency of variation of copy number corresponding to the number of droplets containing FAM monofluorescence signal/(copy number corresponding to the number of droplets containing FAM monofluorescence signal + copy number corresponding to the number of droplets containing FAM + HEX bifluorescence signal) × 100%;
(6) after the reaction is finished, scanning the chip to obtain the data information of CY5, HEX and FAM fluorescence channels, wherein the copy number corresponding to the number of microdroplets containing CY5 single fluorescence signals in the result amplified by using the mixed liquid III of the digital PCR reaction system represents the concentration of the MSI locus MONO-27 unstable state, and the copy number corresponding to the number of microdroplets containing CY5+ HEX double fluorescence signals represents the concentration of the MONO-27 stable state; the frequency of variation of the MONO-27 instability state was equal to the number of copies corresponding to the number of droplets containing CY5 monofluorescent signal/(number of copies corresponding to the number of droplets containing CY5 monofluorescent signal + number of copies corresponding to the number of droplets containing CY5+ HEX bifluorescent signal) × 100%;
(7) among the MSI sites, BAT-25 unstable state variation frequency, BAT-26 unstable state variation frequency, NR-21 unstable state variation frequency, NR-24 unstable state variation frequency, and MONO-27 unstable state variation frequency, a microsatellite high instability is determined if the MSI sites having a variation frequency of not less than 2 MSI sites are not less than 0.1%, and a microsatellite low instability is determined if the MSI sites having a variation frequency of not less than 1 MSI site are not less than 0.1%.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111090896.3A CN114107453A (en) | 2021-09-17 | 2021-09-17 | Kit for detecting instability of microsatellite |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111090896.3A CN114107453A (en) | 2021-09-17 | 2021-09-17 | Kit for detecting instability of microsatellite |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114107453A true CN114107453A (en) | 2022-03-01 |
Family
ID=80441408
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111090896.3A Pending CN114107453A (en) | 2021-09-17 | 2021-09-17 | Kit for detecting instability of microsatellite |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114107453A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4335930A1 (en) * | 2022-09-06 | 2024-03-13 | Fuzhou Maixin Biotech Co., Ltd. China | Kit for detecting microsatellite instability and method therefor |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106701978A (en) * | 2017-01-24 | 2017-05-24 | 厦门艾德生物医药科技股份有限公司 | Human microsatellite instability (MSI) detection amplification primer composition and kit |
| CN107217103A (en) * | 2017-07-14 | 2017-09-29 | 常州桐树生物科技有限公司 | Detect the multiple fluorescence PCR amplifing reagent and kit of microsatellite instability |
| CN108504742A (en) * | 2018-06-25 | 2018-09-07 | 北京爱普拜生物技术有限公司 | A kind of kit and method detecting HER-2 gene copy number variations based on digital pcr technology |
| WO2019011971A1 (en) * | 2017-07-12 | 2019-01-17 | Institut Curie | Method for detecting a mutation in a microsatellite sequence |
| US20190256925A1 (en) * | 2018-02-20 | 2019-08-22 | Roche Molecular Systems, Inc. | Detection of microsatellite instability |
| CN111225985A (en) * | 2017-10-19 | 2020-06-02 | 南托米克斯有限责任公司 | MSI from liquid biopsy |
-
2021
- 2021-09-17 CN CN202111090896.3A patent/CN114107453A/en active Pending
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106701978A (en) * | 2017-01-24 | 2017-05-24 | 厦门艾德生物医药科技股份有限公司 | Human microsatellite instability (MSI) detection amplification primer composition and kit |
| WO2019011971A1 (en) * | 2017-07-12 | 2019-01-17 | Institut Curie | Method for detecting a mutation in a microsatellite sequence |
| US20200291466A1 (en) * | 2017-07-12 | 2020-09-17 | Institut Curie | Method for Detecting a Mutation in a Microsatellite Sequence |
| CN107217103A (en) * | 2017-07-14 | 2017-09-29 | 常州桐树生物科技有限公司 | Detect the multiple fluorescence PCR amplifing reagent and kit of microsatellite instability |
| CN111225985A (en) * | 2017-10-19 | 2020-06-02 | 南托米克斯有限责任公司 | MSI from liquid biopsy |
| US20190256925A1 (en) * | 2018-02-20 | 2019-08-22 | Roche Molecular Systems, Inc. | Detection of microsatellite instability |
| CN108504742A (en) * | 2018-06-25 | 2018-09-07 | 北京爱普拜生物技术有限公司 | A kind of kit and method detecting HER-2 gene copy number variations based on digital pcr technology |
Non-Patent Citations (6)
| Title |
|---|
| ELISA BOLDRIN等: "MSI Analysis in Solid and Liquid Biopsies of Gastroesophageal Adenocarcinoma Patients: A Molecular A", 《INT J MOL SCI》 * |
| KOLODNER,R.D.等: "Human mutator hMSH2 gene, exon 5", 《GENBANK》 * |
| NCBI: "Homo sapiens KIT proto-oncogene, receptor tyrosine kinase (KIT), RefSeqGene (LRG_307)on chromosome 4", 《GENBANK》 * |
| 吕建新等: "《检验与临床诊断分子诊断学分册》", 31 May 2010, 人民军医出版社 * |
| 王嵌等: "筛查结直肠癌DNA错配修复基因缺失的方法分析", 《中国肿瘤临床》 * |
| 缪小兵等: "214例胃癌微卫星不稳定状态分析", 《临床与实验病理学杂志》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4335930A1 (en) * | 2022-09-06 | 2024-03-13 | Fuzhou Maixin Biotech Co., Ltd. China | Kit for detecting microsatellite instability and method therefor |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103451311B (en) | The test kit of the fluorescence labeling composite amplification of analyst's genomic dna 26 locus and using method thereof and application while of a kind of | |
| CN108753965B (en) | Composite amplification detection system for microsatellite unstable state and application thereof | |
| US7662595B2 (en) | Compounds and methods for assessment of microsatellite instability (MSI) status | |
| CN102321748A (en) | Test kit and the method for use and the application of the fluorescence labeling composite amplification of 22 locus of a kind of while analyst genomic dna | |
| CN114107453A (en) | Kit for detecting instability of microsatellite | |
| CN110218772A (en) | A kind of Primer composition, kit, detection method and its application detecting microsatellite instability | |
| CN109593832A (en) | A kind of detection method of ARMS-ddPCR point mutation | |
| CN111304329A (en) | Kit for detecting mutation of BRAF gene V600E site | |
| CN108103220A (en) | A kind of method of the transgenic element selective mechanisms of high throughput | |
| CN102994617B (en) | HRAS gene mutation detection specificity primer and liquid chip thereof | |
| CN114085926A (en) | Primer, probe, kit and detection method for SNP site polymorphism of ABCB1 gene C3435T | |
| CN112029836A (en) | Nucleic acid composition and kit for detecting BRAF gene mutation and detection method of BRAF gene mutation | |
| CN111705132A (en) | Primer probe set, kit and method for detecting liver cancer prognosis marker TP53R249S by ddPCR (double-stranded polymerase chain reaction) | |
| US20090142767A1 (en) | Method for nucleic acid quantitation | |
| KR20220056665A (en) | Marker composition and primer set for Microsatellite Instability (MSI) Diagnosis | |
| CN112391450A (en) | High-specificity and high-sensitivity nucleic acid detection method based on modified dNTP | |
| CN117247999B (en) | Nucleic acid integrity quality assessment method and application thereof | |
| KR102353064B1 (en) | Composition for detecting copy number variation of HER2 and kit comprising the same | |
| CN109504772A (en) | A kind of detection method based on digital pcr platform POLE gene mutation | |
| CN114807407B (en) | Primer pair combination, kit and detection method for detecting soybean transgenic strain | |
| CN108330171A (en) | Detect kit, the method and its application of the 19th exon deletion mutation of EGFR gene | |
| CN107090512A (en) | The fluorogenic quantitative detection primer and probe of BRAF gene V600E mutation | |
| CN112921082B (en) | Specific probe and kit for detecting polymorphism of CYP2C19 x 2 gene | |
| CN116640854B (en) | Marker, method and primer probe composition for analyzing microsatellite instability | |
| CN115074422A (en) | Detection method of unknown fusion gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20220301 |
|
| WD01 | Invention patent application deemed withdrawn after publication |