CN117089593A - Method for measuring activity of DNA ligase and enzyme activity detection system of DNA ligase - Google Patents
Method for measuring activity of DNA ligase and enzyme activity detection system of DNA ligase Download PDFInfo
- Publication number
- CN117089593A CN117089593A CN202311001889.0A CN202311001889A CN117089593A CN 117089593 A CN117089593 A CN 117089593A CN 202311001889 A CN202311001889 A CN 202311001889A CN 117089593 A CN117089593 A CN 117089593A
- Authority
- CN
- China
- Prior art keywords
- dna ligase
- activity
- dna
- enzyme
- measuring
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 230000000694 effects Effects 0.000 title claims abstract description 54
- 102000012410 DNA Ligases Human genes 0.000 title claims abstract description 49
- 108010061982 DNA Ligases Proteins 0.000 title claims abstract description 49
- 102000004190 Enzymes Human genes 0.000 title claims abstract description 45
- 108090000790 Enzymes Proteins 0.000 title claims abstract description 45
- 238000000034 method Methods 0.000 title claims abstract description 21
- 238000001514 detection method Methods 0.000 title claims description 13
- 108020004414 DNA Proteins 0.000 claims abstract description 31
- 239000012634 fragment Substances 0.000 claims abstract description 31
- 238000001962 electrophoresis Methods 0.000 claims abstract description 11
- 238000004458 analytical method Methods 0.000 claims abstract description 10
- 108091008146 restriction endonucleases Proteins 0.000 claims description 9
- 238000006243 chemical reaction Methods 0.000 claims description 7
- 239000000758 substrate Substances 0.000 claims description 5
- 238000012408 PCR amplification Methods 0.000 claims description 4
- 238000003776 cleavage reaction Methods 0.000 claims description 4
- 230000007017 scission Effects 0.000 claims description 4
- 239000003153 chemical reaction reagent Substances 0.000 claims description 2
- 239000011535 reaction buffer Substances 0.000 claims description 2
- 230000002255 enzymatic effect Effects 0.000 claims 1
- 238000004519 manufacturing process Methods 0.000 claims 1
- 239000000047 product Substances 0.000 description 25
- 239000011324 bead Substances 0.000 description 11
- 239000000523 sample Substances 0.000 description 5
- 239000000203 mixture Substances 0.000 description 4
- 238000002360 preparation method Methods 0.000 description 4
- 238000000246 agarose gel electrophoresis Methods 0.000 description 3
- 230000003321 amplification Effects 0.000 description 3
- 238000003199 nucleic acid amplification method Methods 0.000 description 3
- 239000006228 supernatant Substances 0.000 description 3
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 2
- 108091028043 Nucleic acid sequence Proteins 0.000 description 2
- 238000004364 calculation method Methods 0.000 description 2
- 238000005520 cutting process Methods 0.000 description 2
- 239000000243 solution Substances 0.000 description 2
- 239000012536 storage buffer Substances 0.000 description 2
- 241000588724 Escherichia coli Species 0.000 description 1
- 238000003556 assay Methods 0.000 description 1
- 238000007664 blowing Methods 0.000 description 1
- 239000012295 chemical reaction liquid Substances 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 238000010790 dilution Methods 0.000 description 1
- 239000012895 dilution Substances 0.000 description 1
- 238000010828 elution Methods 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 238000001976 enzyme digestion Methods 0.000 description 1
- 238000001917 fluorescence detection Methods 0.000 description 1
- 239000000499 gel Substances 0.000 description 1
- 238000011534 incubation Methods 0.000 description 1
- 239000012160 loading buffer Substances 0.000 description 1
- 238000011068 loading method Methods 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- 238000002156 mixing Methods 0.000 description 1
- 150000007523 nucleic acids Chemical group 0.000 description 1
- 230000010355 oscillation Effects 0.000 description 1
- 102000004169 proteins and genes Human genes 0.000 description 1
- 108090000623 proteins and genes Proteins 0.000 description 1
- 238000000746 purification Methods 0.000 description 1
- 238000004445 quantitative analysis Methods 0.000 description 1
- 238000003260 vortexing Methods 0.000 description 1
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
- G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
- G01N27/416—Systems
- G01N27/447—Systems using electrophoresis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/25—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving enzymes not classifiable in groups C12Q1/26 - C12Q1/66
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Physics & Mathematics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Immunology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- General Physics & Mathematics (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pathology (AREA)
- Electrochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a simple, quick and low-cost method for measuring the activity of DNA ligase, which comprises the following steps: (1) obtaining a DNA fragment having a cohesive end; (2) The DNA ligase standard with known activity is used for connecting the DNA fragments with the sticky ends obtained in the step (1), connecting products are electrophoresed, the connection rate is calculated through gray level analysis, and a standard curve between the enzyme dosage and the connection rate of the standard is established; (3) The DNA ligase to-be-detected product is used for connecting the DNA fragment with the sticky end obtained in the step (1), connecting the product electrophoresis, calculating the connection rate through gray level analysis, and calculating the activity of the DNA ligase to-be-detected product according to a standard curve through the connection rate. The method is simple, has low cost, and can rapidly and accurately measure the activity of the DNA ligase.
Description
Technical Field
The invention relates to a method for measuring the activity of DNA ligase and a corresponding system for detecting the enzyme activity of the DNA ligase, belonging to the technical field of biology.
Background
At present, the DNA ligase activity is mostly determined by a semi-quantitative method, and the enzyme amount required for detecting 50% HindIII digested lambda DNA fragment ligation by running gel is defined as an active unit, and the method has large error. The molecular beacon method based on fluorescence technology development is simple and rapid, but has high cost, complex probe design, high requirement on fluorescence detection instrument and easy generation of large error and false positive signals. Therefore, there is a need to develop a simple, rapid and accurate method for measuring DNA ligase activity that overcomes the shortcomings of the prior art.
Disclosure of Invention
The invention aims to provide a method for measuring the activity of DNA ligase, which can simply, rapidly and accurately measure the activity of the DNA ligase.
The invention adopts the technical scheme that: a method for determining DNA ligase activity comprising the steps of:
(1) Obtaining a DNA fragment with a sticky end;
(2) The DNA ligase standard with known activity is used for connecting the DNA fragments with the sticky ends obtained in the step (1), connecting products are electrophoresed, the connection rate is calculated through gray level analysis, and a standard curve between the enzyme dosage and the connection rate of the standard is established;
(3) The DNA ligase to-be-detected product is used for connecting the DNA fragment with the sticky end obtained in the step (1), connecting the product electrophoresis, calculating the connection rate through gray level analysis, and calculating the activity of the DNA ligase to-be-detected product according to a standard curve through the connection rate. Preferably, the preparation method of the DNA fragment with the sticky end comprises the following steps: (1-1) obtaining a DNA fragment having a restriction enzyme cleavage site by a PCR amplification reaction; (1-2) the DNA fragment of step (1-1) is digested with a restriction enzyme to obtain a DNA fragment having a cohesive end.
Preferably, the restriction enzyme is EcoRI.
Preferably, the DNA fragment sequence in step (1-1) is shown in SEQ ID No. 3.
Preferably, the primer sequences adopted in the PCR amplification reaction in the step (1-1) are shown as SEQ ID No.1 and SEQ ID No.2, and lambda DNA is adopted as an amplification template.
Preferably, the ligation ratio = the grayscale of the ligation product electrophoretic band/(the grayscale of the ligation product electrophoretic band + the grayscale of the ligation substrate electrophoretic band).
Preferably, gray scale analysis uses Emage J or quality software.
Preferably, the activity of the DNA ligase to be detected in step (3) is calculated according to a standard curve by the ligation rate, specifically: and obtaining the corresponding actual enzyme input amount of the to-be-detected product according to the standard curve through the connection rate of the to-be-detected product, wherein the actual enzyme activity of the DNA ligase to-be-detected product=lg (actual enzyme input amount)/lg (estimated enzyme input amount) multiplied by the estimated enzyme activity.
The invention also discloses an enzyme activity detection system of the DNA ligase, which comprises: DNA fragments with sticky ends, DNA ligase standard with known activity, DNA ligation reaction Buffer, DNA electrophoresis reagents.
And the application of the enzyme activity detection system of the DNA ligase in preparing enzyme activity detection products of the DNA ligase.
The invention also discloses an enzyme activity detection kit of the DNA ligase, which contains the enzyme activity detection system of the DNA ligase.
The invention provides a simple, quick and low-cost method for measuring the activity of DNA ligase, which comprises the following steps: firstly, a DNA sequence with restriction enzyme cutting sites is obtained through PCR amplification reaction, and then restriction enzyme is utilized for enzyme cutting to obtain cohesive end fragments. The ligation reaction is then carried out: different concentrations of DNA ligase were added to ligate the cohesive end fragments. And then carrying out agarose gel electrophoresis on the connection product, calculating the connection rate through gray analysis, wherein the enzyme input amount is in direct proportion to the connection rate.
Drawings
FIG. 1 is an agarose gel electrophoresis chart obtained by the measuring method of the present invention.
FIG. 2 is a graph of lg (enzyme input) -ligation standard obtained by the assay method of the present invention.
Detailed Description
The following description of the embodiments of the invention is further illustrated in the accompanying drawings, but the description of the examples does not limit the scope of the invention in any way.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs, and the terms used herein in this description of the invention are for the purpose of describing particular embodiments only and are not intended to be limiting of the invention.
The materials or instruments used in the following examples, if not specifically described, were available from conventional commercial sources.
Example 1PCR product preparation
The following DNA single-stranded primer fragments (Shanghai) were synthesized:
F(SEQ ID NO.1)：5'TTTAGAAATGAGGCTGATGAG 3'；
R(SEQ ID NO.2)：5'ACTAGGCGATCTCCGCTTAGA 3'。
amplification containsEcoRI cleavage siteIs a nucleic acid sequence of (SEQ ID NO. 3):
TTTAGAAATGAGGCTGATGAGTTCCATATTTGAAAAGTTTTCATCACTACTTAGTTTTTTGATAGCTTCAAGCCAGAGTTGTCTTTTTCTATCTACTCTCATACAACCAATAAATGCTGAAATGAATTCTAAGCGGAGATCGCCTAGT
the PCR reaction system is as follows
The amplification procedure was as follows
EXAMPLE 2 magnetic bead purification
1. The PCR product was purified by magnetic bead, taken out of DNA Selection Beads in advance from 4℃and equilibrated to room temperature (about 30 min).
2. The beads were thoroughly mixed by inversion or vortexing, 100 μl of beads were pipetted into 50 μl of DNA sample, and the mixture was thoroughly mixed by pipetting 6 times. Incubation was performed for 5min at room temperature to allow DNA to bind to the beads.
3. The sample was placed on a magnetic rack for 5min and after the solution was clear, the supernatant was carefully removed.
4. Samples were kept on a magnetic rack, the beads were rinsed with 200 μl of freshly prepared 80% ethanol, incubated at room temperature for 30s, and the supernatant carefully removed. This operation was repeated once.
5. The sample is kept on the magnetic rack all the time, and the magnetic beads are air-dried for 5min after being uncapped. (if the beads are cracked, the beads are suggested to be excessively dried, and the elution efficiency of DNA is reduced).
6. The sample was removed from the magnet holder and 30. Mu.L ddH was added 2 And O, blowing with a pipetting gun for 6 times to fully mix, and standing at room temperature for 5min.
7. The samples were placed in a magnetic rack for 5min, after which the solution was clarified, the supernatant was carefully transferred to a new 1.5mL centrifuge tube at 30 μl.
Nanodrop concentration and purity, A260/A280 is between 1.8 and 2.0.
Example 3 preparation of a ligation substrate
Preparing enzyme digestion reaction liquid according to the following system:
mixing, and incubating at 37deg.C for 1 hr. The cleaved product was purified by magnetic beads as in example 2.
EXAMPLE 4 ligation reaction
The preparation of the coll DNA ligase was as follows:
e.coli DNA ligase standard (60U/. Mu.L) was serially diluted to 25, 20, 15, 10, 7.5, 5, 2.5U/. Mu.L with Storage Buffer and placed on ice for use. According to the estimated enzyme activity (estimated value, for example, the estimated value can be obtained by multiplying the protein concentration of the to-be-detected product by the specific activity of the standard product), the to-be-detected product is diluted to 60U/mu L by using a Storage Buffer, and then diluted according to the dilution mode of the standard product.
The system is prepared as follows
After the system is configured, the mixture is uniformly mixed by oscillation and is connected for 30 minutes at 25 ℃ in a PCR instrument. After the completion of the ligation, 5. Mu.L of 6X DNA Loading Buffer was rapidly detached, and the mixture was stirred and reacted in a PCR apparatus at 65℃for 5 minutes. The product is subjected to agarose gel electrophoresis with the concentration of 1.5%, the loading amount is 14 mu L, and the electrophoresis is carried out at 160V for 30-35 min. The result of electrophoresis is shown in FIG. 1.
EXAMPLE 5 enzyme activity calculation
And carrying out band gray level analysis on the electrophoresis diagram through Image J software to obtain gray level values of the connecting fragments and the substrate fragments in each lane, dividing the gray level value of the connecting fragments of each lane by the sum of the gray level values of the connecting fragments and the substrate fragments, and obtaining the duty ratio (namely the connection rate) of the connecting fragments. The standard curve is plotted with the lg (enzyme input) of the standard (i.e., the logarithm of the enzyme input based on 10) and the ligation rate on the ordinate. Substituting the connection rates of the to-be-detected products under different enzyme input amounts into a standard curve formula, and calculating the lg (actual enzyme input amount) of the to-be-detected products, wherein the actual enzyme activity D=B2'/B2×estimated enzyme activity of the to-be-detected products, namely the actual enzyme activity of the to-be-detected products=lg (actual enzyme input amount)/lg (estimated enzyme input amount) ×estimated enzyme activity. The results of the enzyme activity calculation are shown in FIG. 2. Wherein the enzyme input amount (U) is the total enzyme activity of the input of the standard, and the lg (enzyme input amount) of the standard is the logarithm of the enzyme input amount based on 10. The to-be-tested product tests a plurality of gradients, so that the accuracy can be further improved. If the deviation of the test data among the gradients is larger, a secondary test can be performed, and then the accurate enzyme activity of the to-be-tested product is obtained.
Claims (10)
1. A method for measuring the activity of a DNA ligase, comprising the steps of:
(1) Obtaining a DNA fragment with a sticky end;
(2) The DNA ligase standard with known activity is used for connecting the DNA fragments with the sticky ends obtained in the step (1), connecting products are electrophoresed, the connection rate is calculated through gray level analysis, and a standard curve between the enzyme dosage and the connection rate of the standard is established;
(3) The DNA ligase to-be-detected product is used for connecting the DNA fragment with the sticky end obtained in the step (1), connecting the product electrophoresis, calculating the connection rate through gray level analysis, and calculating the activity of the DNA ligase to-be-detected product according to a standard curve through the connection rate.
2. The method for measuring the activity of DNA ligase according to claim 1, wherein the method for preparing the DNA fragment having a cohesive end comprises the steps of: (1-1) obtaining a DNA fragment having a restriction enzyme cleavage site by a PCR amplification reaction; (1-2) the DNA fragment of step (1-1) is digested with a restriction enzyme to obtain a DNA fragment having a cohesive end.
3. The method for measuring the activity of a DNA ligase according to claim 2, wherein the restriction enzyme is EcoRI.
4. The method for determining the activity of DNA ligase according to claim 2, wherein the sequence of the DNA fragment having the restriction enzyme cleavage site in the step (1-1) is shown in SEQ ID No. 3.
5. The method for measuring the activity of DNA ligase according to claim 1, wherein the ligation rate=the gray level of the ligation product electrophoresis band/(the gray level of the ligation product electrophoresis band+the gray level of the ligation substrate electrophoresis band).
6. The method for measuring the activity of DNA ligase according to claim 5, wherein the gray scale analysis is performed by Emage J or quality software.
7. The method for measuring the activity of a DNA ligase according to claim 1, wherein the step (3) of calculating the activity of the DNA ligase to be measured according to the standard curve by the ligation rate comprises: obtaining the corresponding actual enzyme input amount of the to-be-detected product according to the standard curve through the connection rate of the to-be-detected product,
actual enzyme activity=lg (actual enzyme input amount)/lg (estimated enzyme input amount) ×estimated enzyme activity of the DNA ligase test sample.
8. An enzymatic activity detection system for a DNA ligase, the detection system comprising: DNA fragments with sticky ends, DNA ligase standard with known activity, DNA ligation reaction Buffer, DNA electrophoresis reagents.
9. Use of the DNA ligase enzyme activity detection system of claim 8 in the manufacture of a DNA ligase enzyme activity detection product.
10. An enzyme activity detection kit for DNA ligase, which comprises the enzyme activity detection system for DNA ligase according to claim 8.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311001889.0A CN117089593A (en) | 2023-08-09 | 2023-08-09 | Method for measuring activity of DNA ligase and enzyme activity detection system of DNA ligase |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311001889.0A CN117089593A (en) | 2023-08-09 | 2023-08-09 | Method for measuring activity of DNA ligase and enzyme activity detection system of DNA ligase |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN117089593A true CN117089593A (en) | 2023-11-21 |
Family
ID=88774404
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202311001889.0A Pending CN117089593A (en) | 2023-08-09 | 2023-08-09 | Method for measuring activity of DNA ligase and enzyme activity detection system of DNA ligase |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN117089593A (en) |
-
2023
- 2023-08-09 CN CN202311001889.0A patent/CN117089593A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113249525A (en) | qRT-PCR method for identifying novel coronavirus Indian variety | |
| AU2021100190A4 (en) | CRISPR-Cas12a-based MOF-DNA Hydrogel Colorimetric Assay Kit and Method | |
| CN112481358A (en) | Nested recombinase-polymerase amplification method and application thereof | |
| CN112176040A (en) | Method for rapidly determining activity of DNA polymerase | |
| CN113702641A (en) | One-pot nucleic acid-antibody co-detection method and application | |
| WO2022099487A1 (en) | Nested recombinase-polymerase amplification method and application thereof | |
| CN111394434B (en) | CHO host cell DNA residue detection kit adopting TaqMan probe method and application thereof | |
| CN117089593A (en) | Method for measuring activity of DNA ligase and enzyme activity detection system of DNA ligase | |
| CN111088328A (en) | Kit and detection method for high-throughput sequencing library quantitative detection | |
| CN116735729A (en) | mRNA and capping enzyme activity detection kit, detection system, detection method and application | |
| CN112592965B (en) | E.coli host DNA residue detection kit adopting TaqMan probe method | |
| CN111139285A (en) | Method for detecting contents of different target proteins in multiple samples to be detected in high-throughput manner and special kit thereof | |
| CN116926160B (en) | Enzyme activity detection kit for T4DNA ligase and enzyme activity determination method | |
| CN113186262B (en) | Method and kit for rapid quantification of MGI platform high-throughput sequencing library | |
| CN117867090B (en) | Standard substance for quantitative DNA fragmentation level and preparation method and application thereof | |
| CN115141826B (en) | RPA primer pair and application thereof, kit for visually detecting PCV4, application of kit and method for detecting PCV4 | |
| CN116555402B (en) | Telomere detection kit and telomere length detection method for non-disease diagnosis purpose | |
| CN117887812B (en) | Library for high-throughput sequencing quality control, and preparation method and application thereof | |
| CN113373200B (en) | Method for detecting transcription factor NF-kappa B p50 by biosensor | |
| CN115976221B (en) | Internally-doped reference substance for quantitative detection of BCR or TCR rearrangement as well as preparation method and application thereof | |
| CN118531105A (en) | High-throughput sequencing platform library quantitative kit and detection method | |
| CN117587168B (en) | LAMP-CRISPR/Cas12a visualized kit and method for identifying RHDV type 1 and RHDV type 2 | |
| CN114561444B (en) | Bst DNA polymerase activity detection method | |
| CN117247999A (en) | Nucleic acid integrity quality assessment method and application thereof | |
| CN118755860A (en) | QPCR method for detecting host cell DNA residue |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |