CN117757947A

CN117757947A - Primer group, probe group, kit and method for detecting methylation level of bladder cancer biomarker

Info

Publication number: CN117757947A
Application number: CN202410191160.2A
Authority: CN
Inventors: 刘婷; 朱剑梅; 刘晶; 王云霞; 秦楠
Original assignee: Shanghai Jinyi Biotechnology Co ltd
Current assignee: Shanghai Jinyi Biotechnology Co ltd
Priority date: 2024-02-21
Filing date: 2024-02-21
Publication date: 2024-03-26

Abstract

The invention provides a primer group, a probe group, a kit and a method for detecting the methylation level of a bladder cancer biomarker, wherein the bladder cancer biomarker comprisesTwist1Gene and geneZNF101genes by pairingTwist1Gene and geneZNF101The methylation level of the gene can be detected, bladder cancer can be accurately detected, and the detection method has the advantages of high accuracy, high sensitivity, high specificity and the like, is simple and quick, has low cost and convenient sampling, can realize noninvasive early diagnosis of bladder cancer, and has good application prospect.

Description

Primer group, probe group, kit and method for detecting methylation level of bladder cancer biomarker

Technical Field

the present invention relates to the field of biology. In particular, the invention relates to primer sets, probe sets, kits and methods for detecting the methylation level of a bladder cancer biomarker.

Background

Bladder cancer is one of the most common malignant tumors worldwide, particularly in men. The World Health Organization (WHO) data shows that bladder cancer has an increasing incidence worldwide, particularly in some developing countries and regions. Bladder cancer is the fifteenth most common cancer worldwide, with hundreds of thousands of new cases diagnosed each year, as counted by the international cancer research Institute (IARC). Meanwhile, bladder cancer is also one of the causes of many cancer-related deaths.

Traditional methods for diagnosing bladder cancer include urine cytology, cystoscopy, imaging, etc., however, these methods have certain limitations and disadvantages: urine cytology, while a non-invasive method of detection, has limited accuracy and sensitivity, is susceptible to sample collection and operator experience, and is particularly challenging for early diagnosis of bladder cancer. Cystoscopy, although having a high diagnostic accuracy, is invasive and does not adapt to the characteristics of some patients, limiting its clinical application, while also presenting a certain risk of complications. Imaging examinations can provide tumor morphology information for bladder cancer, but have limited diagnostic accuracy for early lesions and cannot provide histological information. Therefore, in order to improve the early diagnosis rate and accuracy of bladder cancer, there is an urgent need for a noninvasive, highly accurate, sensitive and highly specific diagnosis method to overcome the limitations and disadvantages of the conventional diagnosis methods.

Gene methylation technology is used as an emerging noninvasive detection method, and the expression state of tumor-related genes is estimated by analyzing the DNA methylation pattern in a body fluid sample, so that new possibilities are provided for early diagnosis of tumors and disease monitoring. The change of gene methylation has higher specificity and stability in tumors, and therefore becomes an important biomarker for tumor diagnosis and monitoring. In addition, the noninvasive detection method based on the gene methylation technology can also provide more convenient and comfortable diagnosis experience, and through analyzing urine or blood and other samples, the invasive operation of the traditional diagnosis method is avoided, and more acceptable diagnosis options are provided for patients. This has important significance for improving early diagnosis rate, accuracy and treatment effect monitoring of bladder cancer.

currently, the application of gene methylation technology to diagnosis of bladder cancer is yet to be studied.

Disclosure of Invention

the invention mainly aims to provide a simple, rapid, low-cost, high-accuracy and noninvasive bladder cancer detection method.

In order to achieve the above object, the present invention is achieved by the following technical scheme:

The inventors of the present invention have found that,ZNF101The gene is a gene which is obviously related to bladder cancer, the methylation degree of methylation sites of the gene has strong correlation with the occurrence of bladder cancer, and the gene has not been found at presentZNF101Related studies of genes in bladder cancer detection. For this purpose, the invention will be described for the first timeZNF101The gene is used as a biomarker for bladder cancer detection. Further, the inventors found thatZNF101Gene and geneTwist1The gene combination is used as a biomarker for judging the occurrence of bladder cancer, can better improve the detection accuracy, sensitivity and specificity, and has important significance for early diagnosis of bladder cancer.

In one aspect of the invention, the invention provides a biomarker. According to an embodiment of the invention, the biomarker comprisesTwist1Gene and geneZNF101and (3) a gene.

The inventors of the present invention have found that,Twist1Gene and geneZNF101the methylation level of the genes has obvious correlation with the occurrence of bladder cancer, the bladder cancer can be accurately diagnosed by detecting the methylation levels of the two genes, and the detection method has the advantages of high accuracy, high sensitivity, high specificity and the like, is simple and quick, has low cost and convenient sampling, can realize the early diagnosis of noninvasive bladder cancer, and has good application prospect.

further, the inventors propose another biomarker comprisingTwist1Methylation sites of regions of interest of genesZNF101methylation sites of regions of interest of the gene; GRCh38.p14 is used as reference genome, theTwist1the region of interest of the gene is selected from the negative strand Chr7:19117910-19118035, whichZNF101The gene destination region is selected from the positive strand Chr19:19670694-19670850.

according to an embodiment of the invention, theTwist1the methylation site of the region of interest of the gene is selected from at least one of the following: chr7:19117910, chr7:19117913, chr7:19117918, chr7:19117920, chr7:19117925, chr7:19117973, chr7:19117987, chr7:19118012 and Chr7:19118028; the saidZNF101the methylation site of the region of interest of the gene is selected from at least one of the following: chr19:19670699, chr19:19670714, chr19:19670729, chr19:19670833 and chr19:19670843.

The inventors of the present invention found that the aboveTwist1Methylation sites of regions of interest of genesZNF101the methylation degree of the methylation site of the gene target region has obvious correlation with the bladder cancer, and the purpose of accurately diagnosing the bladder cancer can be realized by detecting the methylation level of the methylation site, and the method has the advantages of high accuracy, high sensitivity, strong specificity and the like.

In another aspect of the invention, the invention provides the use of a reagent for detecting a biomarker as described above in the manufacture of a detection product. According to an embodiment of the invention, the detection product is used for diagnosing bladder cancer. Thus, the kit of the present invention can be used for detectionTwist1Gene and geneZNF101The level of gene methylation, thereby facilitating diagnosis of bladder cancer.

the detection reagent of the present invention is not limited to a liquid form.

According to an embodiment of the invention, the reagent for detecting a biomarker comprises a primer set and/or a probe set; the primer set includes: a first primer set, wherein the nucleotide sequences of the primers in the first primer set are SEQ ID NOs: 1 and 2; and the nucleotide sequences of the primers in the second primer group are SEQ ID NO:4 and 5; the probe set includes: a first probe having a nucleotide sequence of SEQ ID NO:3 is shown in the figure; a second probe having a nucleotide sequence of SEQ ID NO: shown at 6.

GTTATTTCGGATGGGGTTGTTATC（SEQ ID NO.1）

CGACGAACGCGAAACGAT（SEQ ID NO.2）

ATCGTTTTTTGGGTTGCG（SEQ ID NO.3）

ATTGTCGTTAGTTGTGATTGC（SEQ ID NO.4）

TACAAACGTAAACCATCGC（SEQ ID NO.5）

TTGTATTGAACGATAGAGTGAGAT（SEQ ID NO.6）

according to the embodiment of the invention, the 5 'end of the first probe is marked with a FAM fluorescence report group, and the 3' end is marked with an MGB fluorescence quenching group; and the 5 'end of the second probe is marked with a ROX fluorescence report group, and the 3' end is marked with an MGB fluorescence quenching group.

According to an embodiment of the invention, the detection product comprises a kit, a test strip or a chip.

According to an embodiment of the present invention, the detection method adopted by the detection product includes at least one of the following: methylation-specific PCR, fluorescent quantitative PCR, bisulfite sequencing, methylation-specific microarray, whole genome methylation sequencing, pyrophosphate sequencing, methylation-specific high performance liquid chromatography, digital PCR, methylation-specific high resolution dissolution profile, and methylation-sensitive restriction endonuclease.

In yet another aspect of the present invention, the present invention provides a primer set. According to an embodiment of the invention, the primer set is used for detecting the biomarker described above, the primer set comprising: a first primer set, wherein the nucleotide sequences of the primers in the first primer set are SEQ ID NOs: 1 and 2; and the nucleotide sequences of the primers in the second primer group are SEQ ID NO:4 and 5. Thus, the primer set of the present invention can be used to specifically amplifyTwist1Gene and geneZNF101Methylation sites of the genes, and diagnosing bladder cancer.

In yet another aspect of the invention, the invention provides a probe set. According to an embodiment of the invention, the probe set is for detecting the aforementioned biomarker, the probe set comprising: a first probe having a nucleotide sequence of SEQ ID NO:3 is shown in the figure; a second probe having a nucleotide sequence of SEQ ID NO: shown at 6. Thus, the probe set of the present invention can be used to realizeTwist1Gene and geneZNF101and (3) fluorescent quantitative PCR detection of the gene, thereby diagnosing bladder cancer.

According to the embodiment of the invention, the 5 'end of the first probe is marked with a FAM fluorescence report group, and the 3' end is marked with an MGB fluorescence quenching group; and the 5 'end of the second probe is marked with a ROX fluorescence report group, and the 3' end is marked with an MGB fluorescence quenching group. Different fluorescent groups are marked on different probes, so that the multi-gene detection in the same reaction system is realized, the detection efficiency is improved, and the detection cost is reduced.

In yet another aspect of the invention, the invention provides a kit. According to an embodiment of the invention, the kit is for detecting the aforementioned biomarker, the kit comprising at least one of the following: the primer set described above and the probe set described above. Thus, the kit of the invention can accurately detectTwist1Gene and geneZNF101Methylation sites of the genes, and diagnosing bladder cancer.

According to an embodiment of the invention, the kit further comprises at least one of the following: sample collection container, nucleic acid extraction reagent, methylation conversion reagent, fluorescent quantitative PCR detection reagent and detectionACTBPrimers and detection of genesACTBGene probes, e.g., negative control, positive control, PCR Master Mix, lysate, proteinase K, rinse, bisulfite solution, and ddH₂O, etc. All the reagents can be purchased independently or can be configured by self through market paths, so that the reagents can be configured into a kit according to actual needs.

According to the embodiment of the invention, the capacity of the sample collection container is 1-10 mL.

According to an embodiment of the invention, the detectionACTBThe 5 'end of the probe of the gene is marked with a VIC fluorescent reporter group, and the 3' end is marked with an MGB fluorescent quenching group.

The sample collection container is used to collect a sample, which may be urine, sweat, blood, whole blood, serum, or the like, preferably urine. The capacity of the sample collection container can be 1-10 mL or 1-3 mL, and the kit can be used for accurately detecting a small amount of samples, so that the collection difficulty of the samples is reduced, and the detection is convenient. The material and shape of the sample collection container are not critical and can be flexibly selected according to conventional operations in the art.

The nucleic acid extraction reagent is used for extracting DNA, and may be specifically a nucleic acid extraction reagent conventionally used in the art.

Methylation converting reagents can convert cytosine (C) in a nucleic acid fragment to uracil (U) without converting 5-methylcytosine (5 mC). Furthermore, by designing a primer for the methylation sequence to amplify the methylation site, if the amplified fragment can be obtained, it is indicated that methylation is present at the site of the nucleic acid fragment, and if the amplified fragment is not obtained, it is indicated that methylation is not present at the site of the nucleic acid fragment, thereby realizing diagnosis of bladder cancer. Specifically, the methylation conversion reagent can be a sulfite conversion reagent or an enzymatic conversion reagent.

the fluorescent quantitative PCR detection reagent can comprise a PCR buffer solution, dNTPs, DNA polymerase and other fluorescent quantitative PCR detection common reagents. Detection ofACTBPrimers and probes for the gene may comprise sequences conventional in the art for detecting ACTB control gene expression levels. Detection ofACTBThe 5' end of the probe of the gene is marked with a VIC fluorescent reporter group, so that multiple single-tube detection can be realized.

In addition, the invention provides a use method of the kit, which comprises the following steps:

(1) Extracting genome DNA of a biological sample to be detected;

(2) Performing sulfite conversion on genome DNA of a biological sample to be detected;

(3) The primer group and the probe group in the kit are adopted to carry out methylation quantitative PCR detection on DNA after sulfite conversion;

(4) And analyzing the detection result.

In yet another aspect of the invention, the invention provides a method for detecting methylation levels of a biomarker for bladder cancer. According to an embodiment of the invention, the method comprises: detecting the aforementioned biomarker in the biological sample using the aforementioned primer set. Thus, the method of the invention can realize accurate detection of bladder cancer genesTwist1AndZNF101Methylation level can be used for diagnosing bladder cancer, and can also be used for non-diagnosis purposes, such as physiological or pathological research of bladder cancer, screening of medicines for treating bladder cancer, and the like, and has high application value.

According to an embodiment of the invention, the method comprises: detecting the aforementioned biomarkers in the biological sample using the aforementioned primer set and the aforementioned probe set.

in yet another aspect of the invention, the invention provides a device for diagnosing bladder cancer. According to an embodiment of the invention, the apparatus comprises: a detection unit adapted to detect the methylation level in the biomarker as described above, resulting in a detection result; and an analysis unit adapted to diagnose bladder cancer based on the detection result. Therefore, the device disclosed by the invention is simple and rapid to operate, high in detection accuracy, low in cost and convenient to sample, can realize noninvasive early diagnosis of bladder cancer, and has a good application prospect.

According to an embodiment of the present invention, the detection unit includes a detection device; the detection device comprises a fluorescence quantitative PCR instrument.

According to an embodiment of the present invention, the detection unit further comprises a DNA extraction device for extracting DNA from the biological sample, including a centrifuge, a mixer, and the like.

According to an embodiment of the invention, the analysis unit is adapted to diagnose bladder cancer based on the following decision means: at the position ofACTBThe gene amplification curve is S-shaped and Ct #ACTB) If not more than 35Twist1the amplification curve of the gene target area is S-shaped, and Ct is [ (]Twist1) Less than or equal to 37, judge asTwist1Positive for gene methylation; if Ct is%Twist1) > 37 orTwist1If the amplification curve does not exist in the target gene region, the determination is thatTwist1negative for gene methylation; at the position ofACTBThe gene amplification curve is S-shaped and Ct #ACTB) If not more than 35ZNF101the amplification curve of the gene target area is S-shaped, and Ct is [ (]ZNF101) Less than or equal to 38, judge asZNF101Positive for gene methylation; if Ct is%ZNF101) > 38 orZNF101If the amplification curve does not exist in the target gene region, the determination is thatZNF101Negative for gene methylation; when (when)Twist1Gene and geneZNF101judging that the bladder cancer exists when at least one of the genes is positive in methylation; when (when)Twist1Gene and geneZNF101When the genes are methylation negative, the bladder cancer is judged not to be suffered. Specifically, the Ct value can be obtained by the matched software of a fluorescent quantitative PCR instrument.

In yet another aspect of the invention, the invention provides an analytical system for diagnosing bladder cancer. According to an embodiment of the present invention, the analysis system for diagnosing bladder cancer includes: a data acquisition module configured to acquire a detection of the methylation level of the biomarker in the biological sample; an analysis module configured to diagnose bladder cancer based on the detection result. Thus, the analysis system of the present invention can accurately diagnose bladder cancer.

According to an embodiment of the invention, the analysis module is configured to diagnose bladder cancer based on the following judgment: at the position ofACTBThe gene amplification curve is S-shaped and Ct #ACTB) If not more than 35Twist1the amplification curve of the gene target area is S-shaped, and Ct is [ (]Twist1) Less than or equal to 37, judge asTwist1Positive for gene methylation; if Ct is%Twist1) > 37 orTwist1If the amplification curve does not exist in the target gene region, the determination is thatTwist1negative for gene methylation; at the position ofACTBThe gene amplification curve is S-shaped and Ct #ACTB) If not more than 35ZNF101the amplification curve of the gene target area is S-shaped, and Ct is [ (]ZNF101) Less than or equal to 38, judge asZNF101Positive for gene methylation; if Ct is%ZNF101) > 38 orZNF101If the amplification curve does not exist in the target gene region, the determination is thatZNF101Negative for gene methylation; when (when)Twist1Gene and geneZNF101judging that the bladder cancer exists when at least one of the genes is positive in methylation; when (when)Twist1Gene and geneZNF101when the genes are methylation negative, the bladder cancer is judged not to be suffered.

In yet another aspect of the present invention, an electronic device is presented. According to an embodiment of the invention, the electronic device comprises a memory and a processor, the memory having stored thereon a program executable on the processor, which when executed by the processor enables diagnosis of bladder cancer based on the methylation level in the aforementioned biomarkers in the biological sample. Therefore, the electronic equipment can accurately diagnose the bladder cancer. Specifically, the electronic device may be any intelligent terminal including a fluorescent quantitative PCR instrument, a computer, a tablet computer, a computing cluster, and the like.

According to an embodiment of the present invention, the program is executed by the processor to diagnose bladder cancer based on the following judgment: at the position ofACTBThe gene amplification curve is S-shaped and Ct #ACTB) If not more than 35Twist1the amplification curve of the gene target area is S-shaped, and Ct is [ (]Twist1) Less than or equal to 37, judge asTwist1Positive for gene methylation; if Ct is%Twist1) > 37 orTwist1If the amplification curve does not exist in the target gene region, the determination is thatTwist1negative for gene methylation; at the position ofACTBThe gene amplification curve is S-shaped and Ct #ACTB) If not more than 35ZNF101the amplification curve of the gene target area is S-shaped, and Ct is [ (]ZNF101) Less than or equal to 38, judge asZNF101Positive for gene methylation; if Ct is%ZNF101) > 38 orZNF101If the amplification curve does not exist in the target gene region, the determination is thatZNF101Negative for gene methylation; when (when)Twist1Gene and geneZNF101judging that the bladder cancer exists when at least one of the genes is positive in methylation; when (when)Twist1Gene and geneZNF101when the genes are methylation negative, the bladder cancer is judged not to be suffered.

In yet another aspect of the invention, a computer-readable storage medium is presented. According to an embodiment of the invention, the computer readable storage medium stores one or more programs executable by one or more processors to effect diagnosis of bladder cancer based on methylation levels in the aforementioned biomarkers in a biological sample. Thus, bladder cancer can be accurately diagnosed using the computer readable storage medium of the present invention.

according to an embodiment of the present invention, the one or more programs, when executed by the one or more processors, enable diagnosing bladder cancer based on: at the position ofACTBThe gene amplification curve is S-shaped and Ct #ACTB) If not more than 35Twist1the amplification curve of the gene target area is S-shaped, and Ct is [ (]Twist1) Less than or equal to 37, judge asTwist1Positive for gene methylation; if Ct is%Twist1) > 37 orTwist1If the amplification curve does not exist in the target gene region, the determination is thatTwist1negative for gene methylation; at the position ofACTBThe gene amplification curve is S-shaped and Ct #ACTB) If not more than 35ZNF101the amplification curve of the gene target area is S-shaped, and Ct is [ (]ZNF101) Less than or equal to 38, judge asZNF101Positive for gene methylation; if Ct is%ZNF101) > 38 orZNF101If the amplification curve does not exist in the target gene region, the determination is thatZNF101Negative for gene methylation; when (when)Twist1Gene and geneZNF101judging that the bladder cancer exists when at least one of the genes is positive in methylation; when (when)Twist1Gene and geneZNF101when the genes are methylation negative, the bladder cancer is judged not to be suffered.

Compared with the prior art, the invention has the beneficial effects that:

(1) Methylation abnormalities are early events in the tumorigenesis process, and are detected by the inventionTwist1Gene and geneZNF101The methylation level of the gene can realize the diagnosis of early bladder cancer, and effectively reduce the occurrence rate and the death rate of bladder cancer. The operation is convenient, after the user obtains urine sample collection and preservation pipe, can accomplish urine sample collection at home, then express delivery sends and detects by the professional.

(2) The diagnosis method provided by the invention is completely noninvasive, takes urine as a detection sample, is simple to sample and easy to obtain, does not cause any pain and influence on patients, and has high patient acceptance.

(3) The invention can use 1-10 mL of whole urine sample for detection, can still obtain high-level sensitivity and specificity, and can be suitable for small-volume sample detection.

(4) The invention designs a specific primer and a specific probe, and adopts joint detectionTwist1Gene and geneZNF101The gene methylation method greatly improves the overall detection accuracy, sensitivity and specificity, the detection sensitivity is 95%, the specificity is 92.5%, and the problem of low sensitivity and specificity in single-gene methylation detection is avoided.

(5) Among the bladder cancer target genes employed in the present invention,Twist1The gene probe is marked by FAM,ZNF101The gene probe is marked by ROX, and the control is usedACTBThe gene probe adopts VIC mark, can realize multiple single tube detection, and compared with single detection, reagent consumption is reduced, consumable cost is reduced, experimenter operation steps are reduced, and experimental error rate is reduced.

additional aspects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention.

Drawings

the foregoing and/or additional aspects and advantages of the invention will become apparent and may be better understood from the following description of embodiments taken in conjunction with the accompanying drawings in which:

FIG. 1 showsTwist1A ROC graph of gene detection results;

FIG. 2 showsZNF101And (3) a ROC curve graph of gene detection results.

Detailed Description

The scheme of the present invention will be explained below with reference to examples. It will be appreciated by those skilled in the art that the following examples are illustrative of the present invention and should not be construed as limiting the scope of the invention. The examples are not to be construed as limiting the specific techniques or conditions described in the literature in this field or as per the specifications of the product. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.

it should be noted that the terms "first," "second," and "second" are used for descriptive purposes only and are not to be construed as indicating or implying a relative importance or implying a number of technical features being indicated. Thus, a feature defining "a first" or "a second" may explicitly or implicitly include one or more such feature. Further, in the description of the present invention, unless otherwise indicated, the meaning of "a plurality" is two or more.

The endpoints and any values of the ranges disclosed herein are not limited to the precise range or value, and are understood to encompass values approaching those ranges or values. For numerical ranges, one or more new numerical ranges may be found between the endpoints of each range, between the endpoint of each range and the individual point value, and between the individual point value, in combination with each other, and are to be considered as specifically disclosed herein.

in this document, the terms "comprise" or "include" are used in an open-ended fashion, i.e., to include what is indicated by the present invention, but not to exclude other aspects.

As used herein, the term "methylation" is a form of chemical modification of DNA that can alter genetic manifestations without altering the DNA sequence. DNA methylation refers to covalent binding of a methyl group at the 5 th carbon position of cytosine of a genomic CpG dinucleotide under the action of a DNA methyltransferase. DNA methylation can cause alterations in chromatin structure, DNA conformation, DNA stability, and the manner in which DNA interacts with proteins, thereby controlling gene expression.

as used herein, the term "methylation level" refers to whether or not a cytosine in one or more CpG dinucleotides in a DNA sequence is methylated, or the frequency/proportion/percentage of methylation, both in qualitative and quantitative terms. In practical application, different detection indexes can be adopted to compare the DNA methylation level according to practical conditions. As in some cases, the comparison may be made based on Ct values detected by the sample; in some cases, the ratio of gene methylation in the sample, i.e., number of methylated molecules/(number of methylated molecules+number of unmethylated molecules). Times.100, can be calculated and then compared; in some cases, statistical analysis and integration are also performed on each index to obtain a final judgment index.

As used herein, the term "probe" refers to a stretch of oligonucleotide sequences that includes a 5 'fluorescent reporter group and a 3' fluorescent quencher group. When the probe binds to the corresponding site on the DNA, the probe does not fluoresce because of the presence of a quenching group near the fluorescent group. During amplification, if the probe binds to the amplified strand, the 5'-3' exonuclease activity of the DNA polymerase (e.g., taq enzyme) digests the probe and the fluorescent group is far from the quenching group, its energy is not absorbed, i.e., a fluorescent signal is generated. The fluorescence signal is also identical to the target fragment with a synchronous exponential increase per PCR cycle.

In this document, the term "memory" refers to any computer program product, device, and/or system (e.g., magnetic discs, optical disks, memory, programmable Logic Systems (PLDs)) for providing machine instructions and/or data to a programmable processor, including a machine-readable medium that receives machine instructions as a machine-readable signal. The Memory may be implemented in the form of Read Only Memory (ROM), static storage, dynamic storage, or random access Memory (Random Access Memory, RAM). The memory may store operating equipment and other application programs, and when the technical solutions provided in the embodiments of the present specification are implemented by software or firmware, relevant program codes are stored in the memory, and the processor is used to invoke the diagnosis of bladder cancer based on the methylation level in the biomarker in the biological sample, which is performed in the embodiment of the present application.

In this context, the processor may be a general purpose processor or a special purpose processor or the like. For example, a baseband processor or a central processing unit. The baseband processor may be used to process communication protocols and communication data, and the central processor may be used to control communication devices (e.g., base stations, baseband chips, terminal devices, terminal device chips, DUs or CUs, etc.), execute computer programs, and process data of the computer programs. The processor may be implemented on an integrated circuit (integrated circuit, IC), analog IC, radio frequency integrated circuit RFIC, mixed signal IC, application specific integrated circuit (application specific integrated circuit, ASIC), printed circuit board (printed circuit board, PCB), electronic device, or the like. The processor and transceiver may also be fabricated using a variety of IC process technologies such as complementary metal oxide semiconductor (complementary metal oxide semiconductor, CMOS), N-type metal oxide semiconductor (NMOS), P-type metal oxide semiconductor (positive channel metal oxide semiconductor, PMOS), bipolar junction transistor (bipolar junction transistor, BJT), bipolar CMOS (BiCMOS), silicon germanium (SiGe), gallium arsenide (GaAs), etc.

In this context, a computer-readable storage medium may be any available medium that can be accessed by a computer or a data storage device, such as a server, data center, or the like, that contains an integration of one or more available media. The usable medium may be a magnetic medium (e.g., a floppy disk, a hard disk, a magnetic tape), an optical medium (e.g., a high-density digital video disc (digital video disc, DVD)), or a semiconductor medium (e.g., a Solid State Disk (SSD)), or the like.

Example 1

in this example, the methylation level of bladder cancer urine sediment cells was measured as follows:

1. Urine sample collection

40 cases of urine samples which are confirmed to be bladder cancer patients and 40 cases of non-bladder cancer patients for routine physical examination are collected in a hospital in the Shanghai, the collection volume of each urine sample is more than 10mL, the collection process of all samples is approved by the ethical committee, all volunteers sign informed consent, and all samples are anonymized.

2. Urine sample DNA extraction

urine sample DNA extraction was performed using Shanghai Shangshi Biotechnology Co., ltd nucleic acid extraction reagent (Hu Min Xiebei 20230565) as follows:

(1) To the clean centrifuge tube, 30. Mu.L of lysis buffer C solution, 2mL of urine and 100. Mu.L of lysis buffer B are sequentially added, the mixture is placed on a constant temperature mixer at 60 ℃ and 1200rpm for shaking for 20 minutes, and after incubation, the centrifuge tube is subjected to ice bath for 5-10 minutes.

(2) During the incubation, a lysate/magnetic bead mixture was prepared as shown in the following table and mixed uniformly.

TABLE 1 reaction system

(3) Adding the lysate/magnetic bead mixed solution prepared in the step (2) into the sample tube of the step (1). Vortex shaking for 1 minute, then manually upside down or mixing for 5-10 minutes by using a mixing instrument, so that the magnetic beads are always in a suspension state.

(4) Placing the centrifuge tube on a magnetic rack for standing, after the magnetic beads are adsorbed on the magnetic rack, turning over the centrifuge tube to wash the residual magnetic beads on the bottle cover after the solution in the tube becomes clear, placing for about 1 minute, and discarding the solution.

(5) 1mL of rinse buffer A (please check if absolute ethanol has been added before use) was added to the centrifuge tube, and after shaking and mixing, the suspension was transferred to a new 1.5mL centrifuge tube.

(6) The centrifuge tube was fixed on a magnetic rack for 1 minute, after which the solution was discarded.

(7) 1mL of rinse buffer A (please check whether absolute ethanol has been added before use) was added to the centrifuge tube, vortexed for 5 seconds, and then placed on a constant temperature mixer at 25℃and 1500rpm for 2 minutes with shaking.

(8) The centrifuge tube was fixed on a magnetic rack for 1 minute, after which the solution was discarded.

(9) 1mL of rinse buffer B (please check whether absolute ethanol has been added before use) was added to the centrifuge tube, vortexed for 5 seconds, and then placed on a constant temperature mixer at 25℃and 1500rpm for 2 minutes with shaking.

(10) The centrifuge tube was fixed on a magnetic rack for 1 minute, after which the solution was discarded.

(11) Repeating the steps (9) and (10).

(12) After the centrifuge tube is centrifuged briefly, the centrifuge tube is re-fixed on a magnetic rack, a liquid transfer device is used for removing the solution at the bottom of the tube, and the centrifuge tube is left at the room temperature after being uncapped for 5-10 minutes to fully volatilize ethanol (the surface of the magnetic beads is observed to be matt and the magnetic beads are free from dry crack by naked eyes).

(13) After 50. Mu.L of sample eluent is added into the centrifuge tube, the magnetic beads are fully suspended in the eluent by vortex vibration, and then the centrifuge tube is placed on a constant temperature mixer at 25 ℃ and 1500rpm for vibration elution for 10 minutes.

(14) Fixing the centrifuge tube on a magnetic rack, standing for 2 minutes, and transferring the eluent into a new centrifuge tube by using a liquid transfer device after the magnetic beads are completely adsorbed on the side wall of the centrifuge tube, thus obtaining the DNA solution.

3. Urine DNA sulfite conversion

the DNA solution obtained in the above step2 was subjected to sulfite conversion using EZ-96 DNA methyl-lightning MagPrep kit (Cat. No. D5047, cat: D5047) produced by ZYMO Research, and the sulfite-converted DNA was obtained, and the specific procedure is as follows.

(1) 130 mu L CT Conversion Reagent is added into the extracted 20 mu L urine DNA solution, and the mixture is uniformly mixed and centrifuged.

(2) The conversion reactions were carried out according to the conversion conditions in the following table:

table 2 reaction procedure

(3) Firstly, adding 600 mu L of M-Binding Buffer and 10 mu L of MagBinding (magnetic beads) into a centrifuge tube, and uniformly mixing the two materials upside down.

(4) Transferring the sample converted in the step (2) into a centrifuge tube containing M-Binding Buffer and magnetic beads, shaking and uniformly mixing, incubating for 5-10min at room temperature, and reversing and uniformly mixing every 2-3min or shaking and uniformly mixing to enable the magnetic beads to be in a suspension state.

(5) After incubation was completed, the tube was then detached instantaneously at low speed and magnetically separated on a magnetic rack for 3min, taking care to remove the supernatant.

(6) Taking down the centrifuge tube from the magnetic rack, adding 400 mu L M-Washing Buffer, vibrating to resuspend the magnetic beads, placing the centrifuge tube on the magnetic rack for magnetic separation for 3min after low-speed instantaneous separation, and carefully removing the supernatant.

(7) Taking down the centrifuge tube from the magnetic rack, adding 200 mu L L-Desulphonation Buffer, vibrating and suspending the magnetic beads, incubating for 20min at room temperature, and keeping the magnetic beads suspended by shaking or vibrating every 5 min.

(8) The constant temperature shaking incubator was turned on, set to 55℃and not shaking.

(9) After the incubation in the step (7) is completed, the centrifuge tube is placed on a magnetic rack for magnetic separation for 3min, and the supernatant is carefully removed.

(10) Taking down the centrifuge tube, adding 400 mu L M-Washing Buffer, vibrating to resuspend the magnetic beads, placing the centrifuge tube on a magnetic rack for magnetic separation for 3min after low-speed instantaneous separation, and carefully removing the supernatant.

(11) Repeating the step (10) once.

(12) The supernatant was discarded and the tube was again centrifuged briefly and placed on a magnetic rack to remove as much residual liquid as possible, but not to attract the beads.

(13) And (3) after the centrifuge tube is uncapped, placing the centrifuge tube in a constant-temperature oscillation incubator at 55 ℃ for drying, wherein the drying standard is that the color of the magnetic beads is changed from bright black to reddish brown.

(14) After drying, 50. Mu.L of eluent was added, and after resuspension of the beads, the beads were placed in a constant temperature shaking incubator at 55℃at 1500rpm for 4min. And after the completion, the DNA is placed on a magnetic rack for magnetic separation, and the supernatant containing the DNA is transferred into a new centrifuge tube to obtain the DNA after sulfite conversion for subsequent detection.

4. qPCR detection

(1) Primer probe information

Twist1gene detection primer and probe,ZNF101gene detection primer, probe and internal reference geneACTBThe sequences of the detection primers and probes are shown in Table 3 below. By means ofTwist1Gene detection primer and probe can be specifically amplifiedTwist1methylation sites of the target region of the gene, wherein the target region is a negative strand Chr7:19117910-19118035 using GRCh38.p14 as a reference genome, and the methylation sites are Chr7:19117910, chr7:19117913, chr7:19117918, chr7:19117920, chr7:19117925, chr7:19117973, chr7:19117987, chr7:19118012 and Chr7:19118028. By means ofZNF101Gene detection primer and probe can be specifically amplifiedZNF101Methylation sites of a target region of a gene, wherein the target region is a forward strand Chr19:19670694-19670850 using GRCh38.p14 as a reference genome, and the methylation sites are Chr19:19670699, chr19:19670714, chr19:19670729, chr19:19670833 and Chr19:19670843.

TABLE 3 primer and probe sequence information

Note that: the CG position of the marked double underline in the primer probe sequence isTwist1Gene and geneZNF101methylation sites for gene detection.

(2) And (3) performing methylation quantitative PCR on the DNA subjected to the sulfite conversion obtained in the step (3) by using the primer and the probe in the kit.

1) In this embodiment, for the same sampleTwist1Genes (gene),ZNF101Gene and geneACTBThe single tube multiplex detection of the genes, i.e. the PCR tube is added with all the primer pairs and probes for detecting the target genes and the reference genes except the necessary reaction components and templates, the PCR reaction configuration system is shown in tables 1-2, and the PCR amplification is carried out according to the amplification procedures shown in tables 1-3. 3 kinds of PCR primer probe premix liquid of genes can be prepared first, and the PCR primer probe premix liquid comprises: 0.1 mu MTwist1gene detection probe, 0.3. Mu.MTwist1Gene forward primer, 0.3. Mu.MTwist1Gene reverse primer, 0.1. Mu.MZNF101Gene detection probe, 0.3 mu M ZNF101Gene forward primer, 0.3. Mu.MZNF101Gene reverse primer, 0.1. Mu.MACTBgene detection probe, 0.3. Mu.MACTBGene forward primer, 0.3. Mu.MACTBAnd (3) a gene reverse primer.

2) The PCR reaction system is shown in Table 4.

TABLE 4 reaction system

3) The PCR amplification procedure is shown in Table 5.

TABLE 5 PCR amplification procedure

4) The prepared reaction system is amplified by an ABI7500 instrument.

5) Analysis of PCR results:

a. Baseline and threshold line adjustments:

After the PCR is completed, a baseline is independently adjusted for each gene, a fluorescence value before a minimum Ct value of a sample in one PCR is advanced by 1-2 cycles is set as a baseline value, and a threshold value is set at the inflection point of an S-shaped amplification curve, so that the Ct value of each gene of the sample is obtained.

b. Sample validity confirmation:

① Reference geneACTBthe VIC channel amplification curve is required to be S-shaped, the Ct value is less than or equal to 35, and the sample is effective;

② Reference geneACTBthe VIC channel amplification curve is S-shaped, and if the Ct value is more than 35 or the amplification curve is not used, the sample is invalid.

c. Methylation confirmation of the target gene:

① When (when)Twist1the amplification curve of the gene FAM channel is S-shaped, and the Ct value is less than or equal to 37, namely the sample is consideredTwist1Positive for gene methylation; ct > 37 or no amplification curve, the sample is consideredTwist1negative for gene methylation;

② When (when)ZNF101the amplification curve of the gene FAM channel is S-shaped, and the Ct value is less than or equal to 38, namely the sample is consideredZNF101positive for gene methylation; ct > 38 or no amplification curve, the sample is consideredZNF101negative for gene methylation;

6) On the premise that the sample is effective, judging the detection result:

① When the sample to be measured isTwist1Gene and geneZNF101When at least one of the genes is methylation positive, diagnosing the sample as bladder cancer positive sample;

② When the sample to be measured isTwist1Gene and geneZNF101When the genes are methylation negative, the sample is diagnosed as a bladder cancer negative sample.

5. sample detection results

(1) Respectively utilizeTwist1Genes (gene),ZNF101gene alone as biomarker and use thereofTwist1AndZNF101the two genes are combined to serve as biomarkers, and 80 samples are detected and analyzed.

(2) The detection results are shown in figure 1, figure 2 and table 6 respectively,Twist1When the gene is singly used as a biomarker, the sensitivity of detecting bladder cancer is 87.5 percent, the specificity is 95 percent, and the area under the curve of a subject is 0.955;ZNF101When the gene is singly used as a biomarker, the sensitivity of detecting bladder cancer is 82.5%, the specificity is 92.5%, and the area under the curve of a subject is 0.926;Twist1AndZNF101when the two genes are combined to serve as biomarkers, the sensitivity of detecting bladder cancer is 95%, and the specificity is 92.5%.

note that: sensitivity (true positive rate) =true positive number/(true positive number+false negative number) ×100%. Refers to the degree to which a patient is correctly judged, i.e., the percentage of actual illness that is correctly diagnosed.

Specificity (true negative rate, specificity) =true negative population/(true negative population+false positive population) ×100%. Refers to the degree to which a non-patient, i.e., the percentage of actually being disease-free and correctly diagnosed as disease-free, is positively judged.

From the above results, it can be seen that: by means ofTwist1AndZNF101when the two genes are combined to serve as biomarkers for detection, the detection rate of bladder cancer can be obviously improved on the premise of keeping higher specificity, so that the performance of double-gene combined detection is better than that of single-gene detection.

The detection method provided by the invention has the advantages of high sensitivity and strong specificity, is simple and quick, has low cost and is noninvasive, and higher sensitivity and specificity can be obtained even if the detection is carried out under the small sample volume of 2mL, so that the detection method has great application value in the aspects of early screening and diagnosis of bladder cancer.

TABLE 680 sample test results

/>

note that: "Undetermined" represents a target gene amplification-free curve, and Ct value calculation is not performed, so that a target gene methylation detection result is negative.

While embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and not to be construed as limiting the invention, and that variations, modifications, alternatives and variations may be made to the above embodiments by one of ordinary skill in the art within the scope of the invention.

Claims

1. use of a reagent for detecting a biomarker in the preparation of a detection product, wherein the detection product is for diagnosing bladder cancer;

The biomarker comprisesTwist1Methylation sites of regions of interest of genesZNF101Methylation sites of regions of interest of the gene;

GRCh38.p14 is used as reference genome, theTwist1the region of interest of the gene is selected from the negative strand Chr7:19117910-19118035, whichZNF101The gene destination region is selected from the positive strand Chr19:19670694-19670850.

2. The use according to claim 1, wherein theTwist1The methylation site of the region of interest of the gene is selected from at least one of the following: chr7:19117910, chr7:19117913, chr7:19117918, chr7:19117920, chr7:19117925, chr7:19117973, chr7:19117987, chr7:19118012 and Chr7:19118028;

The saidZNF101the methylation site of the region of interest of the gene is selected from at least one of the following: chr19:19670699, chr19:19670714, chr19:19670729, chr19:19670833 and chr19:19670843.

3. the use according to claim 1, wherein the reagent for detecting a biomarker comprises a primer set and/or a probe set;

The primer set includes:

A first primer set, wherein the nucleotide sequences of the primers in the first primer set are SEQ ID NOs: 1 and 2;

and the nucleotide sequences of the primers in the second primer group are SEQ ID NO:4 and 5;

the probe set includes:

A first probe having a nucleotide sequence of SEQ ID NO:3 is shown in the figure;

a second probe having a nucleotide sequence of SEQ ID NO: shown at 6.

4. the use according to claim 3, wherein the first probe is labeled at the 5 'end with a FAM fluorescent reporter group and at the 3' end with an MGB fluorescence quencher group;

And the 5 'end of the second probe is marked with a ROX fluorescence report group, and the 3' end is marked with an MGB fluorescence quenching group.

5. The use according to claim 1, wherein the detection product comprises a kit, a test strip or a chip.

6. A primer set for detecting a biomarker, the biomarker comprisingTwist1Methylation sites of regions of interest of genesZNF101Methylation sites of regions of interest of the gene;

GRCh38.p14 is used as reference genome, theTwist1the region of interest of the gene is selected from the negative strand Chr7:19117910-19118035, whichZNF101the gene target region is selected from a positive strand Chr19:19670694-19670850;

The primer set includes:

and the nucleotide sequences of the primers in the second primer group are SEQ ID NO:4 and 5.

7. The primer set of claim 6, wherein the primer set comprisesTwist1The methylation site of the region of interest of the gene is selected from at least one of the following: chr7:19117910, chr7:19117913, chr7:19117918, chr7:19117920, chr7:19117925, chr7:19117973, chr7:19117987, chr7:19118012 and Chr7:19118028;

8. A probe set for detecting a biomarker comprisingTwist1Methylation sites of regions of interest of genesZNF101Methylation sites of regions of interest of the gene;

the probe set includes:

a second probe having a nucleotide sequence of SEQ ID NO: shown at 6.

9. The probe set of claim 8, wherein the probe set comprisesTwist1The methylation site of the region of interest of the gene is selected from at least one of the following: chr7:19117910, chr7:19117913, chr7:19117918, chr7:19117920, chr7:19117925, chr7:19117973, chr7:19117987, chr7:19118012 and Chr7:19118028;

10. the probe set of claim 8, wherein the first probe is labeled with a FAM fluorescent reporter group at the 5 'end and an MGB fluorescent quenching group at the 3' end;

11. A kit for detecting a biomarker comprisingTwist1Methylation sites of regions of interest of genesZNF101Methylation sites of regions of interest of the gene;

the kit comprises the primer set of claim 6 or 7 and the probe set of any one of claims 8 to 10.

12. The kit of claim 11, wherein theTwist1The methylation site of the region of interest of the gene is selected from at least one of the following: chr7:19117910, chr7:19117913, chr7:19117918, chr7:19117920, chr7:19117925, chr7:19117973, chr7:19117987, chr7:19118012 and Chr7:19118028;

13. The kit of claim 11, further comprising at least one of the following: sample collection container, nucleic acid extraction reagent, methylation conversion reagent, fluorescent quantitative PCR detection reagent and detectionACTBPrimers and detection of genesACTBProbes for genes.

14. The kit of claim 13, wherein the sample collection container has a capacity of 1-10 mL;

the detectionACTBThe 5 'end of the probe of the gene is marked with a VIC fluorescent reporter group, and the 3' end is marked with an MGB fluorescent quenching group.

15. A non-diagnostic method for detecting methylation levels of a bladder cancer biomarker, the non-diagnostic method comprising:

detecting a biomarker in a biological sample using the primer set of claim 6 or 7 and the probe set of any of claims 8-10;

16. The method of claim 15, wherein theTwist1The methylation site of the region of interest of the gene is selected from at least one of the following: chr7:19117910, chr7:19117913, chr7:19117918, chr7:19117920, chr7:19117925, chr7:19117973, chr7:19117987, chr7:19118012 and Chr7:19118028;

17. A device for diagnosing bladder cancer, the device comprising:

the detection unit is suitable for detecting methylation level in the biomarker to obtain a detection result;

An analysis unit adapted to diagnose bladder cancer based on the detection result;

18. the apparatus of claim 17, wherein theTwist1The methylation site of the region of interest of the gene is selected from at least one of the following: chr7:19117910, chr7:19117913, chr7:19117918, chr7:19117920, chr7:19117925, chr7:19117973, chr7:19117987, chr7:19118012 and Chr7:19118028;

19. the device according to claim 17, wherein the detection unit comprises a detection device;

The detection device comprises a fluorescence quantitative PCR instrument;

The analysis unit is adapted to diagnose bladder cancer based on the following decision:

At the position ofACTBThe gene amplification curve is S-shaped and Ct #ACTB) If not more than 35Twist1the amplification curve of the gene target area is S-shaped, and Ct is [ (]Twist1) Less than or equal to 37, judge asTwist1Positive for gene methylation; if Ct is%Twist1) > 37 orTwist1If the amplification curve does not exist in the target gene region, the determination is thatTwist1negative for gene methylation;

At the position ofACTBThe gene amplification curve is S-shaped and Ct #ACTB) If not more than 35ZNF101the amplification curve of the gene target area is S-shaped, and Ct is [ (]ZNF101) Less than or equal to 38, judge asZNF101Positive for gene methylation; if Ct is%ZNF101) > 38 orZNF101If the amplification curve does not exist in the target gene region, the determination is thatZNF101negative for gene methylation;

When (when)Twist1Gene and geneZNF101Judging that the bladder cancer exists when at least one of the genes is positive in methylation;

When (when)Twist1Gene and geneZNF101when the genes are methylation negative, the bladder cancer is judged not to be suffered.

20. an analytical system for diagnosing bladder cancer, the analytical system for diagnosing bladder cancer comprising:

A data acquisition module configured to acquire a detection result of a biomarker methylation level in a biological sample;

An analysis module configured to diagnose bladder cancer based on the detection result;

21. the analytical system of claim 20, wherein theTwist1The methylation site of the region of interest of the gene is selected from at least one of the following: chr7:19117910, chr7:19117913, chr7:19117918, chr7:19117920, chr7:19117925, chr7:19117973, chr7:19117987, chr7:19118012 and Chr7:19118028;

22. the analysis system of claim 20, wherein the analysis module is configured to diagnose bladder cancer based on the following determination:

23. An electronic device comprising a memory and a processor, the memory having stored thereon a program executable on the processor, the program when executed by the processor effecting diagnosis of bladder cancer based on a level of methylation in a biomarker in a biological sample;

24. The electronic device of claim 23, wherein theTwist1The methylation site of the region of interest of the gene is selected from at least one of the following: chr7:19117910, chr7:19117913, chr7:19117918, chr7:19117920, chr7:19117925, chr7:19117973, chr7:19117987, chr7:19118012 and Chr7:19118028;

25. The electronic device of claim 23, wherein the program is executed by the processor to diagnose bladder cancer based on the following determination:

26. a computer readable storage medium, wherein the computer readable storage medium stores one or more programs executable by one or more processors to effect diagnosis of bladder cancer based on methylation levels in biomarkers in a biological sample;

27. The computer readable storage medium of claim 26, wherein theTwist1The methylation site of the region of interest of the gene is selected from at least one of the following: chr7:19117910, chr7:19117913, chr7:19117918, chr7:19117920, chr7:19117925, chr7:19117973, chr7:19117987, chr7:19118012 and Chr7:19118028;

28. the computer-readable storage medium of claim 26, wherein the one or more programs, when executed by the one or more processors, implement diagnosing bladder cancer based on: