CN116254344A

CN116254344A - Composition for detecting bladder cancer, kit and application thereof

Info

Publication number: CN116254344A
Application number: CN202310300682.7A
Authority: CN
Inventors: 陈明; 郭鑫武; 洪梅; 纪博知; 戴立忠
Original assignee: Sansure Biotech Inc
Current assignee: Sansure Biotech Inc
Priority date: 2023-03-24
Filing date: 2023-03-24
Publication date: 2023-06-13

Abstract

The present invention relates to the field of molecular biology detection, and more particularly to the field of bladder cancer detection. The present invention provides a composition for detecting bladder cancer comprising a detection reagent for detecting the methylation level of: the region of SLC6A18 gene shown in SEQ ID NO. 1; the HS3ST2 gene is shown in a region shown as SEQ ID NO. 2; and a region of the SIX6 gene shown in SEQ ID NO. 3. Also provided are kits comprising the compositions, uses of the compositions. Can detect bladder cancer clinically with high sensitivity and good specificity; clinically, it can be sensitively and specifically detected at an early stage of bladder cancer.

Description

Composition for detecting bladder cancer, kit and application thereof

Technical Field

The invention belongs to the field of molecular biology detection, in particular to the field of bladder cancer detection, and more particularly relates to detection of methylation level of bladder cancer gene markers.

Background

Bladder Cancer (BC) is the tenth most common malignancy worldwide. Diagnosis and postoperative follow-up monitoring of bladder cancer mainly relies on urine cytology, cystoscopy, urine tumor marker examination and imaging. The urine abscisic cytology examination is one of the main methods of bladder cancer diagnosis and postoperative follow-up, has the advantages of no wound, high specificity and non invasiveness, but the sensitivity of the urine abscisic cytology examination is related to tumor grading, the positive rate of G3 and high-grade urothelial cancers and in-situ cancers can be up to 84%, and the sensitivity in G1 and low-grade tumors is only 16%. Early bladder cancer occurrence could not be detected by urine cytology. Endoscopy is regarded as the gold standard for diagnosing bladder cancer, but common cystoscopy is generally painful for patients, has poor patient compliance, still has anesthesia risk in painless cystoscopy, and has high fee collection, and cannot avoid the risk of negative effects such as urinary tract infection. Conventional imaging (ultrasound, CT, MRI) has limited ability to diagnose bladder carcinoma in situ and smaller tumors (< 5 mm), and is not generally used for early screening of bladder cancer and postoperative recurrence monitoring. The method for detecting whether bladder cancer cells exist in urine by detecting the most common chromosome aberration in bladder cancer through fluorescence in situ hybridization technology has the advantages of complex operation, high price, low relative sensitivity to Ta and Tis phase tumors, low tumor load, possibility of influencing sensitivity when tumor cells are not shed, and capability of being only used as supplement for urine shed cytology examination and cystoscopy. In addition, the noninvasive bladder cancer-based urine marker detection method also comprises nuclear matrix protein 22 (nuclear matrix protein, NMP 22), bladder tumor antigen (human bladder tumor antigen, BTA), fibrin (ogen) degradation products (fibrinogen and fibrin degradation products, FDP), immune-cell examination (ImmunoCyt) and the like, but the sensitivity and the specificity of the detection method are not ideal, the missed diagnosis rate and the misdiagnosis rate are high, the clinical requirements are difficult to meet, and the clinical practical application rate is low.

In recent years, based on the diagnosis technology of PCR, NGS and the like, liquid biopsy is continuously developed and broken through, and the liquid biopsy is a powerful weapon for accurate early screening of cancers. ctDNA methylation is a desirable detection marker from the standpoint of signal abundance and signal intensity of the marker. Studies have shown that elevated levels of cancer suppressor gene methylation often occur in the early stages of cancer and are a hallmark change in early tumor progression; in the CpG island of human genome, 60-80% of cytosine residues are methylation modified, and DNA methylation has become a common and abundant signal source in early screening of cancers; in addition, different cancer types have unique DNA methylation patterns, the organ specificity is strong, and the tissue tracing can be realized. Therefore, ctDNA methylation is a mainstream detection index adopted by early screening enterprises at home and abroad.

There is a need in the art for a more effective bladder cancer diagnostic product that allows for early diagnosis of bladder cancer with high sensitivity and specificity, yet is non-invasive and rapid.

Disclosure of Invention

In view of this, the present invention provides a composition for detecting bladder cancer, the composition comprising a detection reagent for detecting the methylation level of at least two of the following regions:

the region of SLC6A18 gene shown in SEQ ID NO. 1;

the HS3ST2 gene is shown in a region shown as SEQ ID NO. 2; and

the region of the SIX6 gene shown in SEQ ID NO. 3.

In some specific embodiments, the composition comprises detection reagents that detect the methylation level in:

the region of SLC6A18 gene shown in SEQ ID NO. 1; and

the HS3ST2 gene has a region shown in SEQ ID NO. 2.

the HS3ST2 gene is shown in a region shown as SEQ ID NO. 2; and

the region of the SIX6 gene shown in SEQ ID NO. 3.

the region of SLC6A18 gene shown in SEQ ID NO. 1; and

the region of the SIX6 gene shown in SEQ ID NO. 3.

the region of SLC6A18 gene shown in SEQ ID NO. 1;

the HS3ST2 gene is shown in a region shown as SEQ ID NO. 2; and

the region of the SIX6 gene shown in SEQ ID NO. 3.

The region shown in SEQ ID NO. 1 in SLC6A18 gene, the region shown in SEQ ID NO. 2 in HS3ST2 gene and the region shown in SEQ ID NO. 3 in SIX6 gene are a segment of the CpG island sequence of the respective gene regions.

Specifically, the region of SEQ ID NO:1 of the SLC6A18 (Genbank accession number: NM-182632) gene is shown below:

GCCCTGACTGAGGCTGCCAGGGACAGGGCCCTCCTGGATGAGAGGTGGG

GCGGGGGCGGGTCCATGCCTGTGGTACGGAAGCGGCCAGGCCAGGCCGG

CGGGTGGGGTGGCAGGGAGCCCTTGGGTGTGTGTGAGAAGCAGCGGTGA

CTCGGGGAGAATTAGAGATGGAGAACATGTGTGCCAGGACATCCCGGAA

GGACCTGGAAGCTGGTGTTGCCATTCACATGTGAGGTGTGAGGGAGGCCT

GGCTTTCAGCTGCGCCCTTCAGCATGTGTTATTTTATGTTGTTATTTTGTTTT

ATTCTCACTGCTTCTGGGCAGAGGGAGCTGGGAAGGAGCCCCGGGGCCA

CCTGACATGGTCCCTGTCCACAGGGCTGGGCTGTGTCACGCTGTCCTTCC

TGATCAGCCTGTACTACAACACCATCGTGGCGTGGGTGCTGTGGTACCTCCTCAACTCCTTCCAGCACCCGCTGCCCTGGA；

the SEQ ID NO:2 region of the HS3ST2 (Genbank accession number: NM-006043) gene is shown below:

GCTCCTCGACGCATCTTCAACATGTCCCGAGACACCAAGCTGATCGTGGT

TGTGCGGAACCCTGTGACCCGTGCCATCTCTGATTACACGCAGACACTCT

CCAAGAAGCCCGACATCCCGACCTTTGAGGGCCTCTCCTTCCGCAACCGC

ACCCTGGGCCTGGTGGACGTGTCATGGAACGCCATCCGCATCGGCATGTA

CGTGCTGCACCTGGAGAGCTGGCTGCAGTACTTCCCGCTAGCTCAGATTC

ACTTCGTCAGTGGCGAGCGACTCATCACTGACCCGGCCGGCGAGATGGG

GCGAGTCCAGGACTTCCTGGGCATTAAGAGATTCATCACGGACAAGCACTTCTATTTCAACAAGACCAAAGGATTCCCTTGCTTGAAAA；

the SEQ ID NO:3 region of the SIX6 (Genbank accession number: NM-007374) gene is shown below: GGCCGTTGAGCCACCGCCGCCACCCGGTAGTGTGTCCCGCTGCCCCAATCCGCCTCATCAACAAGCGCCTGGCACACTCAGCCAGGCCCGCGGGCATCTGCTGCGTGTCCCGCTCCGGGCTCAGTGCCCTCGCCGCCGCCGGCACTGCCTCGATGTTCCAGCTGCCCATCTTGAATTTCAGCCCCCAGCAAGTGGCCGGGGTATGTGAGACCCTGGAAGAGAGCGGCGATGTGGAGCGCCTGGGTCGCTTCCTCTGGTCGCTGCCCGTGGCCCCTGCGGCCTGCGAGGCCCTCAACAAGAATGAGTCGGTGCTACGCGCACGAGCCATCGTGGCCTTTCACGGTGGCAACTACCGCGAGCTCTATCATATCCTGGAAAACCACAAGTTCACCAAGGAGTCGCACGCCAAGCTGCAGGCGCTGTGGCTTGAAGCACACTACCAGGAGGCTGAGAAGCTGCGTGGAAGACCCCTGGGACCTGTGGACAAGTACCGAGTAAGGAAGAAGTTCC.

Using the composition of the invention, bladder cancer can be predicted in tissue with a specificity of at most 0.953 and a sensitivity of 0.964 and an area under the curve of 0.993, and bladder cancer samples can be detected in free DNA of urine with a sensitivity of at most 0.873, a specificity of 0.950 and an area under the curve of 0.965; the reagent combination can detect bladder cancer clinically with high sensitivity and specificity by using fewer markers, and the cost and time are saved; clinically, it can be sensitively and specifically detected at an early stage of bladder cancer malignant transformation.

In the present invention, "CpG island" is an abbreviation of cytosine (C) -phosphate (p) -guanine (G), and refers to some regions of the genome rich in CpG dinucleotides, and the length is 300-3000 bp.

In some embodiments, the methylation level of a CpG island or a sequence on a CpG island on a corresponding gene present in a sample can be detected using the detection reagents of the invention.

In the present invention, a "sample" is a biological sample selected from an individual. Specifically, for example, selected from cell lines, histological sections, tissue biopsies/paraffin-embedded tissues, body fluids, stool, colon exudates, urine, serum, whole blood, isolated blood cells, cells isolated from blood, or combinations thereof.

Preferably, the "sample" of the present invention is urine, i.e. free DNA in urine.

Free DNA in urine can be used for detecting tumors, and has the characteristics of small harm to patients, good specificity and the like. However, since the content of the fluorescent dye in urine is extremely low, there is a problem of low sensitivity. With the detection reagent of the present invention, free DNA in urine can be used as a sample, and detection can be clinically performed with a sensitivity of 0.873, a specificity of 0.950 and an area under the curve of 0.965.

In the present invention, the "detection reagent" refers to a reagent for detecting the methylation level of a gene in a sample. Wherein the methylation level is measured by means of amplification-sequencing, chip, methylation fluorescent quantitative PCR.

In some specific embodiments, the detection reagent for methylation level may also be a detection reagent for detecting the average methylation level of a gene fragment.

In some specific embodiments, the detection reagent for methylation level may also be a detection reagent for detecting one or more methylation sites within a gene segment.

In some specific embodiments, detection reagents include, but are not limited to, nucleic acid primers, sequencing Tag sequences, for measuring methylation levels by amplification-sequencing.

In some specific embodiments, the detection reagent includes, but is not limited to, a chip that is a methylation chip having probes that specifically bind to a methylation region. The chip may be Human DNA Methylation 2.1.1M Deluxe Promoter Array, human DNA Methylation Array, including, but not limited to, human CpG Island Microarrays and Human DNA Methylation Microarrays for agilent, infinium HumanMethylation27 loadchips for Illumina, infinium HumanMethylation450 loadchips and GoldenGate Methylation Assay, and Roche NimbleGen, etc., for measuring methylation levels by chip.

In some specific embodiments, detection reagents include, but are not limited to, nucleic acid primers and nucleic acid probes for measuring methylation levels by methylation fluorescent quantitative PCR.

The above reagent combinations may also include the remaining reagents, in particular, for example, various reagents required for pretreatment or pretreatment of the sample. For example, a sample releasing agent for extracting a sample nucleic acid, a purifying agent for purifying a sample nucleic acid, a bisulfite or bisulfite used for conversion, or the like.

In a second aspect, the present invention provides the use of a combination of the above agents for the preparation of a kit for the detection of bladder cancer.

Further, the invention provides the use of the reagent combination in preparing a kit for detecting bladder cancer by using free DNA of urine.

In a third aspect, the present invention provides a kit for detecting bladder cancer, the kit comprising a combination of reagents as described above. Further, the kit further includes, but is not limited to, at least one of a reagent for extracting nucleic acid, a reagent for purifying nucleic acid, and bisulfite.

Further, the kit further comprises a negative sample.

Specifically, the negative sample is human genomic DNA that was verified by sequencing to be free of methylation of the target gene.

Further, the reagent for extracting nucleic acid is a reagent for extracting tissue DNA and a reagent for urine free DNA.

Further, the reagent for extracting nucleic acid is a reagent for extracting free DNA of urine.

Further, the kit also comprises T4 polynucleotide kinase and T4 ligase.

Further, the kit also comprises dNTPs and Mg ²⁺ At least one of methylation sensitive restriction enzyme, PCR buffer, and hot start enzyme.

Drawings

FIG. 1 shows the difference in methylation level between the promoter region and the target region of the HS3ST2 gene;

FIG. 2 shows the difference in methylation levels between a segment near the target segment of the SIX6 gene and the target segment;

FIG. 3 shows the difference in methylation level between the SLC6A18 gene target region and the target region.

Detailed Description

The advantages and various effects of the present invention will be more clearly apparent from the following detailed description and examples. It will be understood by those skilled in the art that these specific embodiments and examples are intended to illustrate the invention, not to limit the invention.

Example 1 screening of methylated genes

The present invention collects tumor methylation detection data from the TCGA dataset (https:// TCGA. Xenahubs. Net) of the UCSC xenna website and the GEO database of the National Center for Biotechnology Information (NCBI). Performing differential analysis on bladder cancer and control data, annotating physical positions and gene information on differential sites, and in order to ensure that the screened fragments have consistent methylation levels, the screening of methylated gene fragments is required to simultaneously meet the following requirements: 1) Requiring that the selected gene fragment have a methylation level that is more consistent at not less than 2 sites; 2) Performing differential analysis on bladder cancer and a paracancerous tissue or a normal control tissue, and selecting methylated gene fragments which have high consistency and high difference with the paracancerous tissue or the normal tissue in a bladder cancer sample; 3) Performing differential analysis by using methylation detection data of bladder cancer and whole blood of a healthy sample, and selecting gene fragments with obvious methylation differences; 4) Finally, carrying out gene-by-gene methylation performance analysis from the sections meeting the 3 points, thereby obtaining candidate methylation genes.

And the detection target of the optimal combination of CpG island regions selected by three genes of SLC6A18, HS3ST2 and SIX6 is determined according to the modeling analysis of tissue sample data, and the model and the performance of the combination for detecting bladder cancer in urine free DNA are further verified.

Example 2 sample preparation, library construction and candidate Gene methylation level detection method

Samples were collected for detection of methylation levels of the analytical DNA methylation markers in the samples. The diagnosis of bladder cancer and healthy people is based on the final pathological diagnosis in hospitals. The sample is timely extracted, and the extracted nucleic acid is stored in a refrigerator at-80 ℃ for standby. The experimental procedure is as follows:

1. sample preparation

The tissue sample nucleic acid extraction sampling TIANamp Genomic DNA Kit kit of the invention extracts according to the instructions. Urine sample DNA was extracted from urine samples by QIAamp MinElute Virus Spin Kit kit. The extracted nucleic acid needs to meet the following quality control conditions: the total amount of extracted nucleic acid is more than 20ng.

2. Library preparation

According to the invention, all qualified nucleic acids are subjected to bisulfite treatment by adopting EZ DNA Methylation-Lightning TM Kit (Zymo Research, irvine, calif., USA). And then, constructing a pre-library by adopting a single-chain library construction method on the sample DNA treated by the bisulfite, and completing the construction of a final library by capturing and enriching a target area through liquid chip hybridization after the pre-library quality is checked to be qualified.

Pre-library construction: 1) Phosphorylation: t4 Polynucleotide kinase phosphorylates the 5-terminal of bisulfite treated DNA. 2) SS1 connection: t4 DNA ligation (Rapid) ligates the SS1 linker to the 5-end of the phosphorylated DNA. 3) Purification of nucleic acid: the remaining adaptors were removed using 2 volumes of Agencourt AMPure XP system (Beckman Co. Mu.Lter, calif., USA). 4) SS2 connection: t4 DNA ligation (Rapid) ligates the SS2 linker to the 3-terminus of phosphorylated DNA. 5) Purification of nucleic acid: the remaining adaptors were removed using 2 volumes of Agencourt AMPure XP system (Beckman Co. Mu.Lter, calif., USA). 6) Amplification: using NEBNEext Q5U Master Mix and primer1.0 (Universal primer) andbacard sequences amplify the nucleic acid of the previous step. 7) Purification of nucleic acid: 1.2 volumes of Agencourt AMPure XP system (Beckman Co. Mu.Lter, calif., USA) were used to remove primer dimer and excess primer. 8) Quality inspection: the pre-library after purification treatment is adopted

dsDNAHS Assay Kit (Life Technologies, CA, USA) library total quality control was performed using LabChip GXII Touch library fragment distribution quality control.

Chip (Twist Bioscience) hybridization capture step: 1) Chip hybridization: the library of 1.5ug qualified and mixed is concentrated in advance in vacuum to powder form and then is evenly mixed with the reagents of Panel, hybridization Mix, blocker Solution, universal Blockers and Hybridization Enhancer (the reagents used for chip hybridization are provided by Twist Bioscience), and the mixture is placed in a PCR instrument for incubation at 70 ℃ for 16hours overnight (the temperature of a thermal cover is 85 ℃). 2) Capturing magnetic beads: the captured magnetic beads were washed 3 times in advance using Streptavidin Binding Buffer, the hybridized product was added to the captured magnetic beads, incubated for 30 minutes, wash Buffer I was washed once, wash Buffer 2 was washed 3 times, and finally 42. Mu.l of ultrapure water was eluted. 3) Amplification: the captured library was amplified using KAPA HiFi HotStart ReadyMix and universal primers. 4) purification: 1-fold volume of Agencourt AMPure XP system (Beckman Co. Mu.Lter, CA, USA) was used to remove primer dimer and excess primer.

The library after purification treatment is adopted

dsDNAHS Assay Kit (Life Technologies, CA, USA) and LabChip GXII Touch were subjected to quality control of total library nucleic acid, fragment distribution and primer dimer proportion.

3. Sequencing

Mixing the library to be tested with qualified total library amount, fragment size distribution of amplified product and primer dimer proportion quality inspection according to the mass of 1:1, using

dsDNAHS Assay Kit (Life Technologies, CA, USA) to accurately quantify the library mix, willLibrary denaturation dilution was followed by on-machine sequencing using a NextSeq500 bench sequencer with PE 75.

4. Construction and evaluation of bladder cancer classification model

The original fastq data connector and the low-quality sequence obtained by sequencing are removed by using the cutadapt quality control software, the filtered sequences are compared with a reference genome by using the bismark methylation analysis software, so that the methylation level of each position in the capturing section is obtained, and the average methylation level of each candidate gene is further calculated.

Example 3 determination of bladder cancer marker combinations

Based on the collection of 64 tissue samples clinically diagnosed as bladder cancer, 56 paracancestral control tissue samples. Methylation levels of each gene in the samples were obtained by testing as described in example 2. The methylation levels of the SIX6, HS3ST2 and SLC6A18 gene fragments (SEQ ID 1-3) are finally confirmed to be used as markers for detecting the bladder cancer aiming at the performance of different combinations of candidate gene methylation in the identification of bladder cancer and control samples.

TABLE 1

The combination performance of different genes is shown in table 1, the sensitivity of the optimal classification model constructed by the SIX6, HS3ST2 and SLC6A18 genes in a tissue sample is 0.953, the specificity is 0.964, and the area under the curve is 0.993.

Example 4 results of testing clinical samples with the reagent combinations of the present invention

Based on the collection of 66 urine samples from patients with bladder cancer, 56 urine samples from normal control samples of the same age group as the group of patients with bladder cancer. Bladder cancer diagnosis is based on the final hospital pathology diagnosis. The methylation level of the target gene in urine samples was pooled, sequenced and calculated as described in example 2. The invention finally determines that the methylation model combination of SIX6, HS3ST2 and SLC6A18 gene fragments is used as a marker for detecting bladder cancer through the regression analysis of methylation data logics. A sample calculation score was obtained with the following calculation formula and judged as positive according to score > 0.5:

the prediction score s=exp (predicted value a)/(1+exp (predicted value a)),

wherein the predicted value a=x1+a1 SLC6a18+a2 hs3st2+a3 SIX6; where x1= 10.966, a1= -8.416, a2= -10.631, a3=12.987, slc6a18, HS3ST2, SIX6 represent the methylation level values of the respective genes, respectively.

TABLE 3 Table 3

Gene combination	Sensitivity to	Specificity (specificity)	AUC
				SLC6A18	0.810	0.9643	0.913
HS3ST2	0.804	0.963	0.942
				SIX6	0.803	0.937	0.917
SLC6A18+SIX6	0.859	0.95	0.953
				SIX6+HS3ST2	0.831	0.937	0.95
SLC6A18+HS3ST2	0.845	0.962	0.957
				SLC6A18+SIX6+HS3ST2	0.873	0.950	0.965

Comparative example 1 comparison of the Performance of methylation detection samples at different positions of the Gene of the present invention

The methylation level of the HS3ST2 gene in the promoter region is selected as a marker, and compared with the methylation difference and the methylation performance of the HS3ST2 gene in a cancer sample and a non-cancer sample, which are selected by selecting a segment of CpG site enriched segment of the HS3ST2 gene as the marker. As shown in FIG. 1, the methylation levels in the promoter region and selected Exon2 segments of the HS3ST2 gene are not consistent in cancer and healthy samples. In the detected clinical urine sample, the HS3ST2 gene promoter region is hypomethylated in a healthy sample, and the methylation of a cancer sample is increased, so that the sensitivity of the cancer sample and a non-cancer sample is 0.703 and the specificity is 0.892; healthy samples in the Exon2 target area are hypermethylated, cancer samples are methylation reduced, the sensitivity of distinguishing cancer samples from non-cancer samples is 0.804, the specificity is 0.963, and the performance is better than that of a promoter.

Whether the average methylation level of CpG sites of the upstream sections of the target sections selected from the SIX6 and SLC6A18 genes is used as a marker for detecting bladder cancer is examined, and methylation differences of the CpG sites in cancer and non-cancer samples are compared, wherein the results are shown in figures 2 and 3. As can be seen from fig. 2, there is a difference in the average methylation level of the site upstream of the selected target site in the SIX6 gene in cancerous and non-cancerous tissues, but the difference in the target site is significantly higher. As can be seen from fig. 3, the average methylation level of CpG guide segments in the SLC6a18 gene upstream of the selected target segment did not have a significant difference in cancer and non-cancer tissues and was not suitable as a detection marker. The combined model constructed by the methylation level of the SLC6A18, SIX6 and HS3ST2 three-gene control segments distinguishes cancer and non-cancer sample sensibility of 0.773 and specificity of 0.857, and has inferior performance to the segment combination of the invention.

Claims

1. A composition for detecting bladder cancer, comprising a detection reagent for detecting methylation levels in at least two of the following regions:

the region of SLC6A18 gene shown in SEQ ID NO. 1;

the HS3ST2 gene is shown in a region shown as SEQ ID NO. 2; and

the region of the SIX6 gene shown in SEQ ID NO. 3.

2. The composition of claim 1, wherein the detection reagent is an amplification-sequencing, chip, or detection reagent used in methylation level detection by methylation fluorescent quantitative PCR.

3. The composition of claim 2, wherein the detection reagent is any one or more of a nucleic acid primer sequencing Tag sequence, a methylation chip, a nucleic acid probe.

4. Use of a combination of reagents according to any one of claims 1 to 3 for the preparation of a kit for the detection of bladder cancer.

5. The use according to claim 4, wherein the kit is a kit for detecting bladder cancer using urine free DNA.

6. A kit for detecting bladder cancer, the kit comprising the combination of reagents of any one of claims 1-3.

7. The kit of claim 6, further comprising at least one of a reagent for extracting nucleic acid, a reagent for purifying nucleic acid, and bisulfite.

8. The kit of claim 7, further comprising a T4 polynucleotide kinase, a T4 ligase.

9. The kit of claim 7, further comprising dNTPs, mg ²⁺ At least one of methylation sensitive restriction enzyme, PCR buffer, and hot start enzyme.

10. The kit according to any one of claims 7 to 9, wherein the reagent for extracting nucleic acid is a reagent for extracting free DNA in urine.