CN117701625A - Her-2 antibody production method based on transgenic plants - Google Patents

Abstract

The application discloses a method for expressing Her-2 antibody genes by tomatoes. The Her-2 antibody gene is cloned to a eukaryotic expression vector to obtain a plasmid containing Her-2 antibody gene sequence. Subsequently, the plasmid is used for transforming agrobacterium and the transformed agrobacterium is used for infecting tomato callus, so that a transgenic tomato plant capable of expressing Her-2 antibody genes is obtained, and the tomato plant expressing the Her-2 antibody genes obtained by the application has important value in the aspect of antibody production and application.

Description

Her-2 antibody production method based on transgenic plants

Technical Field

The application belongs to the technical field of plant genetic engineering, and particularly relates to a Her-2 antibody production method based on transgenic plants.

Background

Her-2 (Her-2, p185, erbB-2) is a cell surface transmembrane glycoprotein encoded by oncogene neu/erbB-2/Her-2, and has been found to be significantly elevated in more than ten cancers, particularly breast and ovarian cancers, with 25-30% being Her-2 overexpressed, and such tumors exhibit high malignancy, rapid tumor proliferation and progression, poor prognosis and susceptibility to recurrence, and in particular they are insensitive to conventional therapies such as chemotherapy and radiotherapy, and are more detrimental.

HER-2 is taken as a target point, the anti-p 185neu/erbB-2/HER-2 antibody medicine Herceptin (Herceptin, trastuzumab) can effectively down regulate the expression of HER-2, obviously inhibit the growth of HER-2 over-expression tumor and even completely reverse the tumor, and the combination chemotherapy of the anti-HER-2 antibody is an internationally accepted first-line medicine for treating HER-2 over-expression type metastatic cancer, so that the treatment response rate reaches 45-65%, and the survival time is doubled.

The current systems for expression of genetically engineered antibodies mainly include: coli, mammalian cells, yeast cells, insect cells, plant expression systems, and the like.

The main advantages of the escherichia coli expression system are low cost, short period and easy operation, but the escherichia coli expression system lacks processing mechanisms such as phosphorylation, glycosylation and the like, and is not suitable for expressing proteins with complex structures. Yeast, however, has a strong ability to fold proteins and modify posttranslational processing, can grow rapidly and ferment at high density under simple culture conditions compared to mammalian expression systems, but glycosylation modification is significantly different from human, and has been currently engineered for human N-glycosylation (Nature Biotechnology, 2006, 24 (2): 210-215).

The insect expression system is characterized by being similar to the yeast expression system, and even more capable of processing the expression product, but differs from mammalian cells in glycosylation modification, excision and post-translational processing of the signal peptide.

Mammalian cells are currently commonly used expression systems for producing antibodies, and post-translational modifications such as glycosylation are relatively close to those of humans, and are used for producing antibodies for clinical applications and fully humanized antibodies, but mammalian cells are relatively expensive to produce.

The plants can be grown and cultivated on a large scale by using simple inorganic matters, sunlight, water and the like, the cultivation cost is low, special reaction equipment is not needed, the large-scale cultivation is easy, and the artificial production cost is low. The exogenous proteins can be expressed using roots, stems, leaves, fruits, whole plants, algae, suspended plant cells, hair roots, and the like of the plant.

Many proteins of animal origin have been produced by expression in plants, such as therapeutic monoclonal antibodies, vaccines, cytokines, blood protein components and other therapeutic recombinant proteins in tobacco, industrial enzymes, biopolymers and the like. Protein expression levels can reach 0.01% of Total Soluble (TSP) (Plant Biotechnol J, 2009.7:537-39), even up to 25% of soluble protein (Plant CellRep, 2007.26:p.1151-9) and 247mg/L (Biotechnol Prog, 2005.21:728-34).

The university of marchand and the university of Zhongshan in China have been used to produce human albumin with the expression levels of 2.75g of human albumin per kg of rice (Proc Natl Acad Sci U S A, 2011.108 (47): 19078-19083), 11.88 g/mL of cell suspension (Journal of Biotechnology, 2011.155: 164-172), recombinant human antitrypsin (OsrAAT), recombinant human acidic fibroblast growth factor (OsraFGF), recombinant human basic fibroblast growth factor (OsrbFGF), tomato-expressed inner epidermal growth factor (tomato-expressed by university of Jilin agriculture, et cetera (university of North agriculture and forestry science, nature sciences edition), 2012.40 (1): p.141-146), and vaccine against rabies virus in tomato (Biotechnology Advances.29: p.210-222), respectively.

Thus, there is an urgent need to provide suitable technical solutions to achieve expression of Her-2 antibodies in plants.

Disclosure of Invention

The embodiment of the application provides a method for expressing Her-2 antibody genes by tomatoes, which aims to solve the defects of the existing Her-2 antibody production method.

In a first aspect, embodiments of the present application provide a recombinant expression plasmid. The recombinant expression plasmid comprises: her-2 antibody genes and eukaryotic cell expression elements such that the Her-2 antibody genes can be expressed in plant cells.

In a second aspect, embodiments of the present application also provide a method for obtaining transgenic tomatoes. The method comprises the following steps: transforming agrobacterium with a eukaryotic expression vector; the eukaryotic expression vector contains Her-2 antibody gene sequences; infecting tomato callus by using transformed agrobacterium; among tomatoes after agrobacterium infection, transgenic tomato plants expressing Her-2 antibody genes are selected.

Alternatively, the eukaryotic expression vector is constructed by the following method: amplifying Her-2 gene fragments by PCR; double-enzyme digestion is carried out on the eukaryotic expression vector and the Her-2 gene fragment by using XbaI and SacI enzymes respectively, and enzyme fragments are recovered; ligating the recovered enzyme fragments using a T4 ligase; DH5 alpha E.coli was transformed with the ligation product, positive clones were picked and verified by PCR to obtain the eukaryotic expression vector.

Alternatively, the forward primer used in amplifying Her-2 gene fragment by PCR is SEQ ID No.1; the reverse primer used was SEQ ID No.2.

Optionally, the transforming agrobacterium with the eukaryotic expression vector specifically includes: transferring the constructed plant expression vector into agrobacterium, and streaking on LB solid medium containing kanamycin and rifampicin (the concentration is 50 mg/L); single colonies were picked and verified by PCR to obtain successfully transformed Agrobacterium after dark culture for two days at 28 ℃.

Optionally, in tomatoes infected by agrobacterium, screening transgenic tomato plants expressing Her-2 antibody genes, wherein the transgenic tomato plants specifically comprise: positive transgenic tomato plants were screened by PCR amplification based on NPTII marker gene.

Alternatively, the positive transgenic tomato plants are screened by PCR amplification, and the forward primer used is SEQ ID No.3; the reverse primer used is SEQ ID No.4.

At least one beneficial effect of the application is: transgenic tomato plants capable of expressing Her-2 antibody genes were obtained. The transgenic tomato plant can play an important role in the production and application of Her-2 antibodies.

Drawings

FIG. 1 is an electrophoretogram of Her-2 antibody chA21 gene fragment obtained by PCR amplification of the present application;

FIG. 2 is a schematic diagram of PCR identification results of the ChA550 and ChA570 NPTII primers of the transgenic tomato plants;

FIG. 3 is a schematic diagram of PCR identification results of total RNA extracted from transgenic tomato plants ChA550 and ChA570, reverse transcribed, and Her-2 antibody genes as primers by using cDNA as a template;

FIG. 4 is ELISA detection results of Her-2 antibody chA21 transgenic tomato plants ChA550, chA570 and wild tomato Ac+ protein extract of the present application;

FIG. 5 shows the Western-blotting detection results of Her-2 antibody chA21 transgenic tomato plants ChA550, chA570 and wild tomato Ac+ protein extract.

Reference numerals illustrate:

m: molecular weight marker (Takara, catalyst No. 3427A);

chA21: her-2 antibody chA21 gene fragment;

ac+: wild type tomato as negative control;

ch a550: transgenic tomato plant ChA550;

chu 570: transgenic tomato plants ChA570.

Detailed Description

In order to facilitate an understanding of the present application, the present application will be described in more detail below with reference to the accompanying drawings and specific examples. It will be understood that when an element is referred to as being "fixed" to another element, it can be directly on the other element or one or more intervening elements may be present therebetween. When an element is referred to as being "connected" to another element, it can be directly connected to the other element or one or more intervening elements may be present therebetween. The terms "upper," "lower," "inner," "outer," "bottom," and the like as used in this specification are used in an orientation or positional relationship based on that shown in the drawings, merely to facilitate the description of the present application and to simplify the description, and do not indicate or imply that the devices or elements referred to must have a particular orientation, be constructed and operated in a particular orientation, and therefore should not be construed as limiting the present application. Furthermore, the terms "first," "second," "third," and the like are used for descriptive purposes only and are not to be construed as indicating or implying relative importance.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used in the description of the present application in this description is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. The term "and/or" as used in this specification includes any and all combinations of one or more of the associated listed items.

In addition, the technical features described below in the different embodiments of the present application may be combined with each other as long as they do not collide with each other.

Tomato is an important economic plant, is a food safe for human beings, and has completed gene sequencing, thereby facilitating genetic modification. The embodiment of the application provides a technical scheme for expressing Her-2 antibody drugs in tomatoes and obtaining transgenic tomato plants for producing Her-2 antibodies.

Example 1: her-2 antibody gene vector construction

1) The following forward and reverse primers were designed based on Her-2 antibody gene sequences:

Her-2F: 5'GCTCTAGAATGACCTGCAAGTCCAGTCAGAC 3'；

Her-2R: 5'CGAGCTCTCATTTACCCGGAGACAGGGA 3'；

wherein the underlined nucleic acids are XbaI and SacI cleavage sites, respectively. FIG. 1 is a schematic diagram of amplified gene fragments. As shown in fig. 1, the electrophoresis lanes from left to right are in order:

lane 1: molecular weight Marker;

lane 2: her-2 antibody chA21 gene fragment (size about 1400 bp).

2) Construction of a vector for expressing Her-2 antibody genes in plants:

2.1 The amplified Her-2 antibody gene PCR fragment and eukaryotic expression vector were digested with XbaI and SacI enzymes (endonucleases are both produced by Takara Bio Inc.), and the digested fragments were recovered using a gel recovery kit (produced by Transgene Co.) respectively, and the procedure was carried out according to the instructions. The conditions for the enzyme digestion are as follows:

PCR products or eukaryotic expression vectors: 200 ng

XbaI 10 U；

SacI 10 U；

10XM buffer 5μL；

Adding double distilled water (ddH) ₂ O) to 50. Mu.L;

37. and (3) enzyme cutting for 3 hours at the temperature.

2.2 The recovered gene fragment was ligated with T4 ligase. The ligation reaction conditions were specifically as follows:

and (3) PCR enzyme digestion and recovery of fragments: 10 ng

PBI121 vector fragment: 60 ng

5X T4 buffer：2μL

T4 ligase: 100 U (U)

Adding ddH ₂ O final volume: 10 mu L

The ligation was carried out overnight at 16 ℃.

2.3 The ligation reaction system was transformed into DH 5. Alpha. E.coli, positive clones were picked and verified by PCR, plasmids were extracted using a plasmid extraction kit (product of Transgene Corp.) and identified by digestion with enzyme, and the result was sent to sequencing (Nanjing Jinsri Biotechnology Co., ltd.).

2.4 Transferring the constructed Plant expression vector into agrobacterium, streaking on LB solid medium containing kanamycin and rifampicin (the concentration is 50 mg/L), culturing in dark at 28 ℃ for two days, picking single colony, performing PCR verification, and then transforming tomato by using a dip leaf disc transformation method (Plant Cell Rep, 1986, 5:81-84), thus obtaining transgenic plants.

Example 2: agrobacterium-mediated genetic transformation of Her-2 antibody genes into tomato

The agrobacterium-mediated Her-2 antibody chA21 gene genetically transformed tomato callus, the following steps are performed:

1) Preparation of plant material

Firstly, soaking tomato seeds in warm water at about 35 ℃ for 18-30 hours, then soaking in sodium hypochlorite solution with the concentration of 10% for 10-15 minutes, shaking for 2-3 times, and finally rinsing the seeds with sterile water for 3-4 times.

Then, the seeds were sown on demand in a medium containing 1/2 of MS, and further dark culture was performed for 2 to 3 days, and after exposure to white, the seeds were transferred to culture under 25℃light.

Finally, the cotyledons are cut off before the first true leaf grows. If the cotyledon length is >1 cm, the cotyledons are cut in half and placed face down on the preculture medium.

2) Resuspension of recombinant agrobacteria

First, transformation-positive Agrobacterium was streaked on LB solid medium containing kanamycin and rifampicin, and cultured in dark at 28℃for 2 days, and single colonies were picked up and cultured at 28℃with shaking for 24 hours.

Then, 200. Mu.L of the overnight culture was taken in 5mL of LB selection medium and cultured overnight at 28℃with shaking. After overnight incubation, centrifugation was performed at 5000 rpm for 10min at room temperature.

Finally, the centrifuged supernatant was discarded and the pellet was resuspended in induction medium for transformation.

3) Regeneration and rooting of callus

3.1 Co-cultivation: the precultured cotyledons were immersed in the agrobacterial heavy suspension for 15 min, the liquid on the surface of the explant was removed and placed on sterile filter paper, placed in co-culture medium, sealed, and light-cultured at 25 ℃ for 3 days at 16h.

3.2 Regeneration culture: transferring the explants from the co-culture medium to regeneration medium (containing carbenicillin and kanamycin), with daily light for 16h,25 ℃; and replacing the culture medium after 3 weeks, performing subculture until the explant callus grows new buds, and differentiating long stems.

3.3 Rooting culture: when the plants grow to 2-3 cm, redundant callus around the bottom of the explant is cut, and the callus is transferred into rooting medium, and rooting is carried out under the condition of 16h of daily illumination and 25 ℃.

3.4 Potted culture: after the root system of the seedlings developed, the seedlings are removed, transferred to a basin, cultured in a greenhouse and subjected to 25 ℃ daily illumination for 16 hours.

4) Positive identification of transgenic tomato:

the following forward and reverse primers were designed based on the sequence of the NPTII selectable marker gene:

NPTII-F：5’ TCTCATGCTGGAGTTCTTCGC 3’；

NPTII-R：5’ GTCACCGACTTGAGCCATTTG 3’

and extracting total DNA of the transformed seedling, taking the total DNA of the non-transgenic plant as a negative control, and carrying out PCR amplification by using the primers to identify the transgenic plant. The identification results of the transgenic plants are shown in FIG. 2.

Example 3: RT-PCR (reverse transcription-polymerase chain reaction) verification of expression Her-2 antibody gene of tomato fruits

In this example, the test materials used include Taq DNA polymerase, trizol reagent, reverse transcription kit available from Transgene; PCR primers were synthesized by Nanjing Jinsri; the rest reagents are imported split charging or domestic analytically pure products.

1) RNA extraction of tomato

1.1 Respectively grinding tomato tissue with liquid nitrogen, adding Trizol at a ratio of 50-100 mg tissue/ml Trizol, shaking vigorously, and standing at room temperature for 5min.

Then, the mixture was centrifuged at 12,000 rpm for 5 minutes. After centrifugation, the supernatant was taken and chloroform was added in a ratio of 200. Mu.L chloroform/ml Trizol, vigorously shaken for 15s, and left at room temperature for 3min.

1.2 Centrifugation is carried out at 4℃and 12,000 g for 15 min. After centrifugation, the supernatant was taken, added with isopropanol in a ratio of 0.5. 0.5 mL isopropanol/mL Trizol, and mixed well, and left at room temperature for 10min.

1.3 Centrifugation is carried out at 4℃and 12,000 g for 10min. After centrifugation, the supernatant was discarded and RNA was deposited at the bottom of the tube.

1.4 1mL of 75% ethanol/mL Trizol, the tube was added with 75% ethanol, gently shaken, and the pellet was suspended.

1.5 Centrifugation was performed at 4℃and 8,000 g for 5min and the supernatant was discarded as much as possible.

1.6 After discarding the supernatant, drying at room temperature for 5-10 min.

1.7 With 50. Mu.L of DEPC-H ₂ O dissolves RNA sample at 55-60 deg.C for 5-10 min.

2) Semi-quantitative PCR (RT-PCR)

First, the following components were added, and reverse transcription was performed according to the following procedure.

The components added are as follows:

5×RT Buffer 4 μL；

dNTP mix (10 mM each) 2. Mu.L;

RNase Inhibitor(10 U/μL) 1 μL；

Oligo(dT) 20 (10 pmol/μL) 1 μL；

Total RNA 1 μL；

RNase-Free H2O 10 μL；

ReverTra Ace 1 μL；

reverse transcription procedure:

42℃ 45 min；

94℃ 5 min；

4℃ 5 min。

subsequently, her-2 antibody gene expression was identified by reverse transcription PCR. In reverse transcription PCR, the expected amplified fragment was about 1400 bp.

The PCR reaction system is as follows:

10×PCR Buffer 2 μL；

Mg ²⁺ (1.5 mM) 1.2 μL；

dNTP mix (2.5. 2.5 mM each) 1.6. Mu.L;

cDNA 1 μL；

forward primer Her-2f 0.4 μl;

reverse primer Her-2r 0.4 μl;

ddH ₂ O 12.4 μL；

1 μl of Taq DNA polymerase;

the procedure for PCR was as follows: denaturation at 94℃for 5min, annealing at 94℃for 30s, annealing at 55℃for 30s, extension at 72℃for 40s for 30 cycles, and extension at 72℃for 5min.

Finally, the authentication result shown in fig. 3 is obtained. In FIG. 3, ac+ is wild tomato and ChA550 and ChA570 are Her-2 antibody gene chA21 transgenic tomato lines. The identification results of fig. 3 show that: her-2 antibody genes were successfully expressed in tomato.

Example 4: ELISA detection of Her-2 antibody protein expressed by tomato fruits

1) Extraction of Her-2 antibody protein expressed by tomato fruits

Firstly, grinding tomato fruits in the Breaker period by liquid nitrogen, taking the ground tomato fruits to a 15 mL centrifuge tube, about 1mL, adding 1mL protein extraction buffer solution, uniformly mixing, standing on ice for 15 min, and oscillating every 5min. Then, the supernatant was centrifuged at 12,000 rpm for 15 min to obtain Her-2 antibody primary extract, which was used for ELISA detection.

2) ELISA detection of Her-2 antibody proteins

The chimeric antibody content in the supernatant was determined by sandwich ELISA, with goat anti-human Fc polyclonal antibody plated, with HRP-labeled goat anti-human Fc polyclonal antibody as labeled polyclonal antibody, and antibody concentration was determined by IgG1 standard gradient control. The specific detection steps are as follows:

2.1 Sheep anti-human Fc polyclonal antibody was diluted to a protein content of 5. Mu.g/ml with 50mM pH 9 carbonate coating buffer, and coated with 0.1ml of diluted antibody in each reaction well of polystyrene plate overnight at 4 ℃.

2.2 The solution in the wells was discarded, washed 3 times with PBST wash buffer for 3 minutes each, and beaten clean on clean absorbent paper. After cleaning, adding 0.1ml of a sample to be detected or IgG1 standard gradient with a certain dilution into the coated reaction well, placing the reaction well at 37 ℃ for incubation for 1 hour, and simultaneously making blank wells, negative control wells and positive control wells.

2.3 The solution in the wells was discarded, washed 3 times with PBST wash buffer for 3 minutes each, and beaten clean on clean absorbent paper.

2.4 HRP-labeled goat anti-human Fc polyclonal antibody was added to each reaction well and incubated at 37 ℃ for 0.5-1 hour.

2.5 The solution in the wells was discarded, washed 3 times with PBST wash buffer for 3 minutes each, and beaten clean on clean absorbent paper.

2.6 0.1ml of freshly prepared chromogenic substrate solution was added to each well at 37℃for 10-30 minutes.

2.7 0.05ml of 2M sulfuric acid was added to each reaction well to terminate the reaction.

2.8 On ELISA detector, at 490nm, the OD value of each well was measured after zeroing with a blank control well, a standard curve was made according to the IgG1 standard gradient and the OD value, and the concentration of the measured sample was calculated from the standard curve and the OD value of the sample.

3) Lowry method for determining protein concentration in supernatant

The concentration of the protein in the extract was measured using a protein assay kit (Pierce ™), a standard curve was prepared using BSA standard protein, and after the samples and standard samples were developed by adding Folin reagent, they were detected at a visible light wavelength of 750 nm.

Subsequently, the amount of antibody contained per unit amount of protein in the protein extract can be calculated from the ELISA antibody concentration and the total protein concentration in the extract.

FIG. 4 shows the results of protein concentration detection. As shown in FIG. 4, the antibody concentration in the tomato fruits of the two transgenic lines ChA550 and ChA570 obtained reached 7.94 and 2.71. Mu.g/mg protein, no antibody protein was detected in the wild type tomato fruits.

Example 5: western Blotting detection of Her-2 antibody protein expressed by tomatoes

1) Extraction of Her-2 antibody protein expressed by tomato fruits

The procedure for extracting Her-2 antibody protein is the same as that of example 4, and is not repeated here.

2) Western-blot detection protein

First, 20. Mu.L of 5 Xloading buffer was added, gel was SDS-PAGE with 10% concentration, and the electrophoresis parameters were kept at constant voltage of 100. 100V for 90-100 min. Subsequently, the gel proteins were transferred to PVDF membrane using a semi-dry transfer apparatus, and transferred to the membrane for 30 min at constant pressure of 20. 20V.

After the transfer operation was completed, the membrane was removed and blocked with Western-Blot blocking solution for 1h at room temperature. After the completion of the blocking, the blocking solution was removed, and an Anti-His mouse monoclonal antibody (Shanghai) containing blocking solution was added thereto, followed by hybridization incubation at room temperature for 1 hour, and the membrane was washed three times with 1 XTBST for 10 minutes each time.

Finally, blocking solution containing Anti-mouse antibody was added and incubated for 1h at room temperature for hybridization, the antibody was recovered, and the membrane was washed three times with 1 XTBE for 10min each time, followed by development.

FIG. 5 is a schematic representation of Western Blotting results. As shown in FIG. 5, the obtained two transgenic lines ChA550 and ChA570 expressed antibody proteins, and no antibody protein was detected in the wild type Ac+ tomato fruits.

Specifically, the bacteria and agrobacterium culture and agrobacterium-mediated genetic transformation reagents and formulations according to the examples of the present application are as follows:

coli medium: LB medium (1L): tryptone 10 g/L, yeast powder 5 g/L and NaCl 10 g/L.

Agrobacterium culture medium: YEB broth (1L): tryptone 5g, yeast extraction 1g, beef extract 5g, naCl 5g, mgCl ₂ ·7H ₂ O 0.493 g，pH 7.0。

The medium and the formula used for agrobacterium-mediated genetic transformation are as follows:

the minimal Medium (MS) per liter comprises the following components: anhydrous CaCl ₂ 330 mg；KNO ₃ 1900 mg；MgSO ₄ ·7H ₂ O 370 mg；NH ₄ NO ₃ 1650 mg；KH ₂ PO ₄ 170 mg；FeSO ₄ ·7H ₂ O 27.85 mg；Na ₂ EDTA 37.25 mg; inositol 100 mg; nicotinic Acid (niacin) 0.5. 0.5 mg; pyridoxine hydrochloride (Pyridoxine-HCl) 0.5. 0.5 mg; glycine (Glycine) 2.0 mg; 0.4mg of ammonium sulfate hydrochloride; folic Acid (Folio Acid) 25 mg; biotin (Biotin) 2 mg; KI 8.3 mg; h ₃ BO ₃ 62 mg；Na ₂ MoO ₄ ·2H ₂ O 2.5mg；MnSO ₄ ·4H ₂ O 223 mg；ZnSO ₄ ·7H ₂ O 86 mg；CuSO ₄ ·5H ₂ O 0.25 mg；CoCl ₂ ·6H ₂ O0.25 mg; sucrose: 20 g; agar powder: 7, g, wherein the organic components except sucrose and agar are sterilized by filtration, and the rest components are sterilized at 121 ℃ for 20 min.

Pre-culture medium: 1.1 mg/L6-Benzylaminopurine (6-Benzylamiopurine, 6-BA) and 0.04. 0.04 mg/L indoleacetic acid (Indoleacetic Acid, IAA) were added to MS medium.

Induction medium (100 ml): 5ml AB salts, 2 ml MES buffer, 2 ml sodium phosphate buffer, 91 ml 1% glucose.

Co-culture medium: adding final concentration of 0.2 to MS culture mediummg/L KH ₂ PO ₄ 0.1 mg/L Kinetin (Kinetin, kt), 0.2 mg/L2, 4-dichlorophenoxyacetic acid (2, 4-Dichlorophenoxyacetic Acid, 2, 4-D) and 15 mg/L Acetosyringone (ACE)

Regeneration medium: adding 500 mg/L sodium carboxymethylcellulose (Carbenicillin), 50 mg/L Kanamycin sulfate (Kanamycin), 2 mg/L6-BA and 0.2mg/LIAA into MS culture medium

Rooting medium: sodium carbenicillin and IAA were added to the MS medium at a final concentration of 500 mg/L and 2 mg/L.

Protein extraction buffer: 50. mu.L of 1M Tris-HCl pH7.5, 60. Mu.L of 2.5M NaCl, 4. Mu.L of 0.5M DTT, 10. Mu.L of 0.1M PMSF, 10. Mu.L of PPi, 10. Mu.L of 0.5M EDTA, 200. Mu.L of 50% glycerol, 200. Mu.L of 10% PVPP, ddH added ₂ O was supplemented to 1 mL.

The application discloses a novel method for expressing Her-2 antibody genes by tomatoes, which clones the Her-2 antibody genes to eukaryotic expression vectors to obtain plasmids containing Her-2 antibody gene sequences. Subsequently, the plasmid was transformed with agrobacterium and the transformed agrobacterium was used to infect tomato callus, thereby obtaining transgenic tomato plants capable of expressing Her-2 antibody genes. The tomato plant expressing the Her-2 gene of the antibody obtained by the application has important value in the aspect of antibody production and application.

The foregoing description is only of embodiments of the present application, and is not intended to limit the scope of the patent application, and all equivalent structures or equivalent processes using the descriptions and the contents of the present application or other related technical fields are included in the scope of the patent application.

Claims (8)

1. A recombinant expression plasmid comprising: her-2 antibody genes and eukaryotic cell expression elements such that the Her-2 antibody genes can be expressed in plant cells.

2. A method for obtaining transgenic tomatoes, comprising:

transforming agrobacterium with a eukaryotic expression vector; the eukaryotic expression vector contains Her-2 antibody gene sequences;

infecting tomato callus by using transformed agrobacterium;

among tomatoes after agrobacterium infection, transgenic tomato plants expressing Her-2 antibody genes are selected.

3. The method of claim 2, wherein the eukaryotic expression vector is constructed by:

amplifying Her-2 gene fragments by PCR;

double-enzyme digestion is carried out on the eukaryotic expression vector and the Her-2 gene fragment by using XbaI and SacI enzymes respectively, and enzyme fragments are recovered;

ligating the recovered enzyme fragments using a T4 ligase;

DH5 alpha E.coli was transformed with the ligation product, positive clones were picked and verified by PCR to obtain the eukaryotic expression vector.

4. A method according to claim 3, wherein the forward primer used in amplifying the Her-2 gene fragment by PCR is SEQ ID No.1; the reverse primer used was SEQ ID No.2.

5. A method according to claim 3, characterized in that said transformation of agrobacterium with eukaryotic expression vectors comprises in particular:

transferring the constructed plant expression vector into agrobacterium, and streaking on LB solid medium containing kanamycin and rifampicin (the concentration is 50 mg/L);

single colonies were picked and verified by PCR to obtain successfully transformed Agrobacterium after dark culture for two days at 28 ℃.

6. A method according to claim 3, wherein said selecting transgenic tomato plants expressing Her-2 antibody genes in tomatoes after agrobacterium infection, comprises:

positive transgenic tomato plants were screened by PCR amplification based on NPTII marker gene.

7. The method according to claim 6, wherein the positive transgenic tomato plants are screened by PCR amplification using the forward primer of SEQ ID No.3; the reverse primer used is SEQ ID No.4.

8. A method for producing Her-2 antibodies, comprising:

transgenic tomato obtainable by the method according to any one of claims 1-7 for the production of Her-2 antibodies.