CN117683725A - Human umbilical cord mesenchymal stem cell MSC-N1 and application thereof - Google Patents

Abstract

The invention discloses a human umbilical cord mesenchymal stem cell MSC-N1 and application thereof, belonging to the field of cell therapy. The cell strain of the human umbilical cord mesenchymal stem cell MSC-N1 is preserved in the Guangdong province microorganism strain collection at 2023, 11 and 14 days, and the preservation number is GDMCC No:64018. the cell strain of the human umbilical cord mesenchymal stem cells MSC-N1 can be injected into myocardial tissues of heart failure patients, and P61 is continuously secreted into the myocardial tissues; the treatment mode enables the mesenchymal stem cells and the P61 to directly reach the heart of a patient to act, and solves the problems of short half-life and potential toxic and side effects of NRG-1 protein, especially active polypeptide (P61) thereof in the body in the prior art.

Description

Human umbilical cord mesenchymal stem cell MSC-N1 and application thereof

Technical Field

The invention belongs to the technical field of cell therapy, and particularly relates to a human umbilical mesenchymal stem cell MSC-N1 and application thereof.

Background

Neuregulin 1 (NRG-1) is one of the Neuregulin family members, and its coding gene (NRG 1) is located on chromosome 8, contains 21 exons, and can produce more than 30 transcripts. The protein structure of NRG-1 consists of an extracellular domain at the N-terminus (extracellular structural domain, ECD), a transmembrane domain, an intracellular domain at the C-terminus (intracellular structural domain, ICD). Wherein the extracellular domain further comprises an EGF-like domain (EGF-like structural domain), which is a critical region for binding of NRG-1 to ErbB receptors. The NRG-1 precursor encoded by the NRG1 gene is a transmembrane protein, and cleavage by proteases results in the release of mature NRG-1 protein to the outside of the cell.

NRG-1 is classified into six subtypes according to amino-terminal sequences, variable cleavage of EGF-like domains, and the like, wherein there are two subtypes of NRG-1 alpha and NRG-1 beta according to the EGF-like domains. Studies have shown that NRG-1 beta is a subtype that has been studied more extensively in the cardiovascular field. NRG-1 beta is secreted by vascular endothelial cells in the heart, and combines with ErbB family receptors on cell membranes to start NRG-1-ErbB signaling pathways, thereby playing an important role in heart development, maintenance of normal heart function, promotion of myocardial cell proliferation and the like. Among them, erbB family receptors include ErbB1, erbB2 (HER 2), erbB3 (HER 3) and ErbB4 (HER 4), whereas human cardiomyocytes mainly express both ErbB2 and ErbB4 receptors. ErbB2 or ErbB4 gene knockout mice macroscopically show phenotypes such as ventricular hypertrophy, ventricular wall thickening, reduced contractility and the like, microscopically show phenotypes such as abnormal sarcomere structure of myocardial cells, and suggest that two receptors such as ErbB2 and ErbB4 play an important role in maintaining the structure and function of myocardial cells.

Although NRG-1 has a variety of structurally diverse subtypes, each subtype contains a similar EGF-like domain, and only the EGF-like domain (not requiring the complete protein) can bind to ErbB family receptors and initiate downstream signaling pathways. Several studies have demonstrated that NRG-1 beta protein or its active polypeptide (polypeptide of amino acids 177-237 of NRG-1 beta 2, i.e. EGF-like domain region) is capable of promoting the treatment of various cardiac diseases including atherosclerosis, myocardial infarction, injury due to ischemia reperfusion, heart failure, cardiotoxicity, arrhythmia, etc.

Currently, clinical studies on NRG-1 β protein or its active polypeptide in the treatment of heart failure have focused mainly on the following: (1) Treatment for left heart contractile insufficiency and heart failure using human recombinant full-length NRG-1 beta 3 protein (also known as NRG-1GGF subtype, or cimaglerrmin alpha); (2) Treatment of chronic heart failure using human recombinant protein rhNRG-1; (3) Reduced ejection fraction (HFrEF) type heart failure is treated with a fusion protein comprising an NRG-1 active polypeptide and a monoclonal antibody against ErbB 3. The administration of the above proteins is intravenous injection or transdermal administration (subcutaneous sustained release). However, the above formulation and administration mode have the following problems: (1) NRG-1 proteins, particularly their active polypeptides (P61), have a short half-life in vivo and are susceptible to degradation; the NRG-1 protein or its active polypeptide eventually reaches the myocardium after undergoing in vivo circulation and metabolism by related organs; (2) Since one of the main receptors of NRG-1 protein or its active polypeptide is ErbB2 (HER 2), while HER2 is highly expressed in various malignant tumors, it is closely related to the occurrence, invasion, metastasis and recurrence of tumors, and is an important driver of tumor proliferation, invasion; thus, intravenous or transdermal injection brings NRG-1 protein or its active polypeptide into the systemic circulatory system with the potential risk of tumor formation or promotion of tumor metastasis. Furthermore, a clinical trial in the united states showed that intravenous injection of human recombinant full-length NRG-1 beta 3 protein resulted in hepatotoxicity.

Disclosure of Invention

The invention aims to solve the technical problem of constructing a human umbilical cord mesenchymal stem cell MSC-N1 cell strain capable of expressing and secreting an active polypeptide (P61) of NRG-1 protein, wherein the cell strain of the human umbilical cord mesenchymal stem cell MSC-N1 is preserved in the microorganism strain preservation center of Guangdong province at 11 months 14 of 2023, and the preservation number is GDMCC No:64018.

the construction, detection and application processes of the cell strain of the human umbilical cord mesenchymal stem cell MSC-N1 are as follows:

1. constructing a lentiviral expression vector.

2. Construction of MSC-N1 cell lines.

3. MSC-N1 expression and secretion P61 were examined.

4. MSC-N1 proved to significantly promote recovery of cardiac function after myocardial infarction.

The cell strain of the human umbilical cord mesenchymal stem cells MSC-N1 can be injected into myocardial tissues of heart failure patients, and P61 is continuously secreted into the myocardial tissues; the treatment mode enables the mesenchymal stem cells and the P61 to directly reach the heart of a patient to act, and solves the problems of short half-life and potential toxic and side effects of NRG-1 protein, especially active polypeptide (P61) thereof in the body in the prior art.

Drawings

FIG. 1 is a plasmid map of pHIV-Puro-P61 vector in example 1;

FIG. 2 shows the mRNA expression level of P61 in MSC-N1 of example 3;

FIG. 3 shows the expression of MSC-N1 and P61 in the culture supernatant thereof in example 3;

FIG. 4 is a flow chart of an animal experiment in example 4;

FIG. 5 shows LVEF and LVFS values at various time points for each group of mice in example 4;

FIG. 6 shows the rate of change of LVEF and the rate of change of LVFS in each of the mice before treatment (Day 6) and 53 days after treatment (Day 60) in example 4.

Detailed Description

The present invention will be further described with reference to the accompanying drawings for a clear and intuitive understanding to those skilled in the art.

Example 1: construction of lentiviral expression vectors

All restriction endonucleases, T4 ligase were purchased from Thermo Fisher Scientific; plasmid miniprep purification kit, plasmid miniprep extraction kit, DNA gel recovery and purification kit and PCR purification recovery kit are all purchased from Axygen; chemically competent cell DH 5. Alpha. Strain: purchased from Shanghai Bioengineering Co. The cDNA sequence of Puro-T2A-P61 was synthesized by Souzhou Jin Weizhi Biotechnology Co.

1.1 subcloning the synthesized cDNA sequence into pHIV-iRFP720-E2A-Luc vector (Addge, 104587) by conventional molecular cloning method to obtain lentiviral expression vector of pHIV-Puro-P61.

Amino acid sequence of P61:

Ser His Leu Val Lys Cys Ala Glu Lys Glu Lys Thr Phe Cys Val Asn Gly Gly Glu Cys Phe Met Val Lys Asp Leu Ser Asn Pro Ser Arg Tyr Leu Cys Lys Cys Pro Asn Glu Phe Thr Gly Asp Arg Cys Gln Asn Tyr Val Met Ala Ser Phe Tyr Lys Ala Glu Glu Leu Tyr Gln(SEQ ID NO:1)。

Puro-T2A-P61 sequence (882 bp):

GCCACCATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCCCCAGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGCCACACCGTCGATCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTCTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCTTCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAGCCCGGTGCCCCTAGGGGCAGTGGAGAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGCCCAATGCATAGCCATCTTGTAAAATGTGCGGAGAAGGAGAAAACTTTCTGTGTGAATGGAGGGGAGTGCTTCATGGTGAAAGACCTTTCAAACCCCTCGAGATACTTGTGCAAGTGCCCAAATGAGTTTACTGGTGATCGCTGCCAAAACTACGTAATGGCCAGCTTCTACAAGGCGGAGGAGCTGTACCAGCACCACCACCATCACCACTAA(SEQ ID NO:2)。

1.1.1 designing primers for introducing cleavage sites by taking the synthesized cDNA sequence as a template, wherein the sequences of the primers are shown in Table 1.

Table 1: primer sequences

Primer name	Sequence (5 '-3')	Cleavage site
				Puro-F1	TAGAATTCGCCACCATGACCGAGTACAA	EcoRΙ	SEQ ID NO:3
P61-R1	TAATCGATTTAGTGGTGATGGTGGTGGTGC	Bsu15Ι	SEQ ID NO:4

The PCR reaction (20. Mu.l) was as follows:

the PCR amplification procedure was: 95 ℃ for 5min; cycling for 30 times at 95 ℃ for 30sec,56 ℃ for 3min and 72 ℃ for 1 min; and at 72℃for 10min.

After the reaction is completed, the target fragment is recovered by using a DNA gel recovery and purification kit.

1.1.2 cleavage of pHIV-iRFP720-E2A-Luc vector with EcoRI and Bsu 15I, the cleavage system was as follows:

after being fully and evenly mixed, the mixture is placed in a water bath at 37 ℃ for 2 hours, and then 2 mu l of the mixture is mixed with DNA loading buffer, and agarose gel electrophoresis is carried out to verify that the mixture is successfully cut. The linear pHIV-iRFP720-E2A-Luc vector fragment was obtained by recovery using a DNA gel recovery and purification kit.

1.1.3 ligation transformation: the linear vector was ligated with the PCR amplified Puro-T2A-P61 in the following manner:

after the samples were thoroughly mixed, they were reacted overnight at 16℃and then transformed. The conversion steps are as follows: 1 competent cell is taken out from a refrigerator at-80 ℃ and placed on ice for thawing, all the connection products are gently mixed with 50 mu l of competent cells, placed on ice for 30min, placed in a water bath at 42 ℃ for heat shock for 30s, immediately placed on ice for 5min, 400 mu l of sterilized LB liquid medium without antibiotics is added into the mixture in a super clean workbench, and after being gently blown and mixed, placed in a shaking table for incubation at 37 ℃ and 170rpm for 1h. After the incubation, 150. Mu.l of LB solid medium added to 150. Mu.g/mL of ampicillin was pipetted onto an ultra-clean bench, and then the plate was placed in an incubator at 37℃overnight.

1.1.4 bacterial selection verification: 1mL of LB liquid medium containing ampicillin is added into a 1.5mL centrifuge tube, a plurality of monoclonal colonies are picked up, shaking culture is carried out at a constant temperature of a shaking table 37 ℃ and 200rpm for 6 hours, and then 200ul of bacterial liquid is added into 5mL of LB liquid medium containing ampicillin, and shaking culture is carried out at a constant temperature of the shaking table 37 ℃ and 200rpm for overnight. And (3) extracting plasmids in a small quantity, carrying out sequencing to verify whether the connection is successful, carrying out amplification culture on the colony with correct sequencing, and extracting and determining a lentiviral expression vector pHIV-Puro-P61 with successful connection by using a plasmid mass extraction kit, wherein a plasmid map is shown in figure 1.

Example 2: construction of P61-expressing human umbilical mesenchymal Stem cell Strain MSC-N1

2.1 packaging lentiviruses

2.1.1 HEK293T cells were seeded in 6 well plates, cultured with D10 broth (DMEM broth+10% foetal calf serum+1% PS) and ready for transfection when cell confluence reached 70% -80%.

2.1.2 the original culture broth was discarded 1h before transfection and 2 mL/well of pre-warmed serum-free DMEM broth was added.

2.1.3 transfection with EZ Trans cell transfection reagent (Lemonnieri, AC04L 091) according to the product instructions. HEK293T cells were co-transfected with pHIV-Puro-P61 (20. Mu.g), pVSVg (10. Mu.g), psPAX2 (15. Mu.g).

2.1.4 After 6h, the broth was replaced with D10 broth.

2.1.5 after further culturing for about 60 hours, the culture broth was centrifuged at 3000rpm at 4℃for 10min, and the supernatant was obtained.

2.1.6 the supernatant was filtered through a 0.45 μm low protein binding filter (Millipore Steriflip HV/PVDF) to remove cell debris thoroughly.

2.1.7 the virus-containing culture broth was centrifuged at 10000g for 4h at 4℃with 10% sucrose buffer (50 mM Tris-HCl, pH 7.4, 100mM NaCl,0.5mM EDTA) at a volume ratio of 4:1. Carefully discarding the supernatant, draining the supernatant on a centrifuge tube by pouring on a piece of absorbent paper for 3min, adding 1 XPBS, and re-suspending to obtain concentrated virus liquid, and preserving at-80 ℃.

2.2 transfected cells

Culturing 2.2.1MSC: the culture medium comprises 10% fetal bovine serum (HyClone, SH 30396.03); 1% ps (Invitrogen, 10378016); 1% of the nonessential amino acids NEAA (Invitrogen, 11140050); the balance DMEM (Gibco, C11995500 BT), medium was changed every two days. Passaging every 3 days or when cell culture reaches 80-90% confluence. The passaging process was performed 1 XDPBS (Gibco, 14040133) and then digested with 0.05% pancreatin (Solarbio, T1320) at room temperature for no more than 5min. The passage ratio is 1:2-1:3.

2.2.2 lentiviral infection: when the confluency of MSC cells reaches 70% -80%, the cells are infected by using the lentivirus prepared by 2.1. The multiplicity of infection (MOI) is about 0.3 to 0.5. 24h after infection, the culture medium was replaced with fresh medium. After 2 days of culture, the culture broth was replaced with fresh medium containing puromycin (InvivoGen) at a final concentration of 2ug/ml for selection. Screening for 3-4 days, and selecting single clone to inoculate in different culture dishes for culturing to obtain the engineering cell strain MSC-N1.

Example 3: identification of engineered cell lines

3.1 total RNA extraction: total cellular RNA was extracted using EZ-10 Total RNA miniprep kit (Sangon Biotech, B618583-0050) (sample using RNase-Free DNA removal kit, sangon Biotech, B618253-0050) and control group was wild-type MSC in humans.

3.2 reverse transcription: using reverse transcription kitsIII 1st Strand cDNA Synthesis Kit (YEASEN, 11139ES 60) was subjected to a reverse transcription experiment.

3.3 detection of the mRNA expression level of P61 in each sample by real-time quantitative PCR. Related primers were designed using Primer3 software (Primer sequences see Table 2) using TBFast qPCR Mix (TAKARA, RR 430B) and +.>480 The (Roche) system performs real-time quantitative PCR. As a result, as shown in FIG. 2, at the mRNA level, P61 of MSC-N1 was expressed 279 times as much as MSC. * Represents p<0.001。

Table 2: primer3 software designed related Primer

Sequence name	Sequence (5 '-3')
			GAPDH-RT-F	TGGGTGTGAACCATGAGAAG	SEQ ID NO:5
GAPDH-RT-R	GTGTCGCTGTTGAAGTCAGA	SEQ ID NO:6
			P61-RT-F	TGTAAAATGTGCGGAGAAGGAG	SEQ ID NO:7
P61-RT-R	AGAAGCTGGCCATTACGTAG	SEQ ID NO:8

3.4 detection of the secretion of P61 by MSC-N1

3.4.1 collection of culture supernatants of MSC-N1: MSC-N1 or MSC were inoculated into 10cm dishes, and after the cell density reached about 70%, the cells were washed 2 times with 1 XPBS, and the culture medium was replaced with serum-free DMEM medium. The supernatant was collected every two days, and after 2 times of collection, the culture supernatant was centrifuged at 2000rpm for 10 minutes, and the supernatant was filtered using a 0.45 μm low protein binding filter membrane to remove cell debris. The filtered culture supernatant was placed in a 10cm dish, pre-cooled overnight at-80℃and then freeze-dried for 24 hours to obtain a lyophilized powder. The lyophilized powder was reconstituted with 1ml of distilled water and desalted by a desalting column (Shanghai Biotechnology, C006868). Immunoblotting identification detection can be performed after desalting.

3.4.2 immunoblotting detection of P61 expression: equal amounts of each set of desalted culture supernatants and cell lysates were separated by SDS-PAGE and transferred to polyvinylidene fluoride membranes (PVDF, merck millipore, ISEQ 00010). The membrane was blocked with 5% skim milk for 1 hour at room temperature. Then, the cells were incubated with an anti-6 XHis-Tag monoclonal antibody (Proteintech, 66005-1-Ig) overnight at 4℃and then with HRP-conjugated affinipure goat anti-rabit IgG (H+L) (Proteintech, SA 00001-2) for the second antibody. By usingThe protein expression level was detected by Plus super-sensitive chemiluminescent reagent (Shanghai service, 1810212) and the bands were visualized using a ChemiScope 6100 chemiluminescent plate imaging system. The results are shown in FIG. 3, which shows that MSC-N1 expressed and secreted P61 into the culture supernatant, but MSC did not express P61. And (3) injection: the detection method of western blot was performed by anti-HisTag antibody (because there was no specific primary antibody against P61), and only cells expressing P61-HisTag could be detected.

Example 4: method for testing therapeutic effect of MSC-N1 by using myocardial infarction mouse model

4.1 experimental materials: (1) C57BL/6J mice: age from 8 weeks to 10 weeks, body weight from 20g to 25g; all manipulations of the experimental C57BL/6J mice were performed according to the guidelines for the feeding and use of experimental animals issued by the National Institute of Health (NIH). (2) an anesthetic sedation drug: tribromoethanol (1.25%, 0.1ml/10 g). (3) MSC, MSC-N1, PBS (Gibco, 20012027).

4.2 experimental method: the experimental flow chart is shown in fig. 4.

(1) Day0: construction of Myocardial Infarction (MI) model mice and sham-operated mice: the tribromoethanol (1.25%, 0.1ml/10 g) is injected into the abdominal cavity for anesthesia, and the operation area is dehaired and tracheal intubation is carried out; left chest incision, muscle separated to expose intercostal incisions of ribs, fourth and fifth ribs. The chest was then opened to expose the heart, and the left anterior descending coronary artery was permanently ligated with an 8-0 suture needle at about 2mm from the lower edge of the left atrial appendage to form a myocardial infarction model (n=50, n is the total number of mice). In sham mice (n=8, n is the total number of mice), the heart was exposed at the 3 rd to 4 th intercostal open chest and threaded at about 2mm from the lower edge of the left atrial appendage with an 8-0 needle without ligating the left anterior descending coronary artery.

(2) Day6: on day6 post myocardial infarction, mice were examined for cardiac function using a high resolution ultrasound imaging system and MI mice with LVEF <35% were injected with cells or Placebo (PBS). Within 2 days after myocardial infarction, 5 mice died, with LVEF >40% for 2 mice, so 43 total mice received either cell or placebo injections. 2 mice in the sham group died, so 6 sham mice were subjected to the subsequent experiments.

(3) Day7: on day7 after myocardial infarction, a secondary open chest surgery was performed, and MSC cells (mi+msc group, n=14, N is the total number of mice) and MSC-N1 cells (mi+msc-N1 group, n=15, N is the total number of mice) were injected into the necrotic area around the anterior descending branch of the left coronary artery of MI mice (the number of each cell was 6×10 ⁵ Individual cells/mouse, injected at 2-3 sites), an equal volume of PBS was injected as a control group (mi+pbs group, n=14, n is the total number of mice). Wherein, on the day of surgery, 2 mice died in the MI+PBS group, 1 mouse died in the MI+MSC group, and 2 mice died in the MI+MSC-N1 group. Thus, the number of mice in each group actually subjected to subsequent tests was: MI+PBS group 12, MI+MSC group 13, MI+MSC-N1 group 13, placebo group (Sham group) 6.

(4) Day14: the cardiac function of the mice was examined using a high resolution ultrasound imaging system.

(5) Day28: the cardiac function of the mice was examined using a high resolution ultrasound imaging system.

(6) Day60: the cardiac function of the mice was examined using a high resolution ultrasound imaging system.

4.3 analysis of results:

(1) The detection results of the high-resolution ultrasonic imaging system (figure 5) show that for the LVEF index, compared with the Sham group, the LVEF values of the mi+pbs, the mi+msc and the mi+msc-N1 at each time point are obviously reduced; no significant differences in LVEF values were found for Day6 and Day14, mi+pbs, mi+msc-N1 groups; at Day28, the LVEF values were significantly higher for the mi+msc-N1 group than for the mi+pbs group (mi+msc-N1 vs. mi+pbs,27.86% vs.18.95%, p=0.014); at Day60, the LVEF values for the mi+msc-N1 group were significantly higher than those of the mi+pbs group (mi+msc-N1 vs. mi+pbs,32.57% vs.20.15%, p=0.0001) and the mi+msc group (mi+msc-N1 vs. mi+msc,32.57% vs.25.18%, p=0.021). For the LVFS index, compared with the Sham group, the LVFS values of MI+PBS, MI+MSC and MI+MSC-N1 at each time point are obviously reduced; there was no significant difference in LVFS values in Day6 and Day14, MI+PBS, MI+MSC-N1 groups; at Day28, the LVFS values were significantly higher for the mi+msc-N1 group than for the mi+pbs group (mi+msc-N1 vs. mi+pbs,12.42% vs.8.56%, p=0.019); at Day60, the LVFS values for the mi+msc-N1 group were significantly higher than those of the mi+pbs group (mi+msc-N1 vs. mi+pbs,14.66% vs.9.13%, p=0.0001) and the mi+msc group (mi+msc-N1 vs. mi+msc,14.66% vs.11.34%, p=0.021).

(2) Comparing the rate of change of LVEF values and the rate of change of LVFS values for each mouse before treatment (Day 6) and 53 days after treatment (Day 60) (rate of change= (Day 60 value-Day 6 value)/Day 6 value; fig. 6 and table 3), the average rate of change of LVEF for the mi+msc-N1 group was significantly higher than that for the mi+pbs group (mi+msc-N1 vs. mi+pbs,0.753vs. -0.036, p=0.00002) and the mi+msc group (mi+msc-N1 vs. mi+mcs,0.753vs.0.243, p=0.004); the average rate of change of LVFS in the MI + MSC-N1 group was significantly higher than that in the MI + PBS group (MI + MSC-N1vs. MI + PBS,0.761vs. -0.031, p=0.0001) and the MI + MSC group (MI + MSC-N1vs. MI + MCS,0.761vs.0.244, p=0.021).

Table 3: rate of change in LVEF values for each mouse before treatment (Day 6) and 53 days after treatment (Day 60)

(3) Conclusion: compared with MSC, MSC-N1 has more remarkable curative effect on the recovery of cardiac function after myocardial infarction. The cell strain MSC-N1 can be used for preventing or treating myocardial infarction by adopting a direct injection mode.

The previous description of the embodiments is provided to facilitate a person of ordinary skill in the art in order to make and use the present invention. It will be apparent to those skilled in the art that various modifications can be readily made to these embodiments and the generic principles described herein may be applied to other embodiments without the use of the inventive faculty. Therefore, the present invention is not limited to the embodiments described herein, and those skilled in the art, based on the present disclosure, should make improvements and modifications within the scope of the present invention.

Claims (9)

1. Human umbilical cord mesenchymal stem cells MSC-N1, the cell line of which was deposited with the Guangdong province microorganism strain collection at 2023, 11 and 14 days, with the deposit number of GDMCC No:64018.

2. use of human umbilical mesenchymal stem cells MSC-N1 according to claim 1 in the preparation of a medicament for preventing or treating myocardial infarction.

3. The use according to claim 2, wherein the medicament is in the form of an injection.

4. The use according to claim 3, wherein the injection area of the medicament is myocardial tissue or myocardial necrosis area.

5. The use according to claim 2, wherein the umbilical mesenchymal stem cells MSC-N1 highly express and secrete an active polypeptide of NRG-1 protein.

6. A medicament for preventing or treating myocardial infarction, comprising the cell line of human umbilical mesenchymal stem cells MSC-N1 according to claim 1.

7. The medicament according to claim 6, wherein the dosage form of the medicament is an injection.

8. The medicament according to claim 7, wherein the injection area of the medicament is myocardial tissue or myocardial necrosis area.

9. The drug of claim 6, wherein the drug highly expresses P61.