RU2431669C2 - Method for producing preparation of genetically modified cells - Google Patents
Method for producing preparation of genetically modified cells Download PDFInfo
- Publication number
- RU2431669C2 RU2431669C2 RU2009123656/10A RU2009123656A RU2431669C2 RU 2431669 C2 RU2431669 C2 RU 2431669C2 RU 2009123656/10 A RU2009123656/10 A RU 2009123656/10A RU 2009123656 A RU2009123656 A RU 2009123656A RU 2431669 C2 RU2431669 C2 RU 2431669C2
- Authority
- RU
- Russia
- Prior art keywords
- cells
- genetically modified
- vegf
- gdnf
- modified cells
- Prior art date
Links
Landscapes
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Description
Изобретение относится к способам получения лекарственных препаратов, содержащих генетический материал. Может быть использовано в медицине.The invention relates to methods for producing drugs containing genetic material. It can be used in medicine.
Известен способ [1] стимуляции ангиогенеза. Недостатком способа [1] является неудовлетворительная эффективность действия препаратов, получаемых применением известного способа, из-за того, что используют ограниченное разнообразие генов - только один (из многих возможных) терапевтический ген сосудистого эндотелиального фактора роста - VEGF. Это ограничивает лечебные свойства трансплантируемых клеток. Кроме того, для получения модифицированных клеток (трансфекции рекомбинантной ДНК в клетки-мишени) по способу [1] используют «японский гемагглютинирующий вирус», в результате чего увеличивается аллергентность и иммуногенность лечебного препарата, с угрозой здоровью и жизни.A known method [1] stimulation of angiogenesis. The disadvantage of the method [1] is the unsatisfactory effectiveness of the drugs obtained by using the known method, due to the fact that they use a limited variety of genes - only one (out of many possible) therapeutic gene of vascular endothelial growth factor - VEGF. This limits the healing properties of the transplanted cells. In addition, to obtain modified cells (transfection of recombinant DNA into target cells) according to the method [1], a “Japanese hemagglutinating virus” is used, as a result of which the allergenicity and immunogenicity of the drug are increased, with a threat to health and life.
Известен способ [2] для лечения бокового амиотрофического склероза. Недостатком способа является неудовлетворительная эффективность препаратов, получаемых применением известного способа, из-за того, что для повышения лечебных свойств трансплантируемых клеток используют только один (из многих возможных) терапевтический ген глиального фактора роста - GDNF. Кроме того, используемый для получения модифицированных клеток (трансфекции рекомбинантной ДНК в клетки-мишени) ретровирусный вектор (генетическую конструкцию) приводит к интеграции рекомбинантной ДНК в хромосому клетки-мишени. Это сопровождается риском возникновения мутаций с последующим раковым перерождением клеток.A known method [2] for the treatment of amyotrophic lateral sclerosis. The disadvantage of this method is the unsatisfactory effectiveness of the preparations obtained by using the known method due to the fact that only one (of many possible) therapeutic gene of glial growth factor - GDNF is used to increase the healing properties of transplanted cells. In addition, the retroviral vector (genetic construct) used to produce modified cells (transfecting recombinant DNA into target cells) leads to the integration of recombinant DNA into the chromosome of the target cell. This is accompanied by the risk of mutations followed by cancerous cell degeneration.
Известен способ [3] для лечения бокового амиотрофического склероза. Недостатком способа [3] является неудовлетворительная эффективность препаратов, получаемых применением известного способа, из-за того, что используют ограниченное разнообразие генов - только один (из многих возможных) терапевтический ген сосудистого эндотелиального фактора роста - VEGF. Кроме того, используемый для получения модифицированных клеток (трансфекции рекомбинантной ДНК в клетки тканей) аденовирусный вектор (являющийся вирусной генетической конструкцией), который вызывает сильную иммунологическую реакцию у пациентов при наличии у пациента аденовирусной инфекции и/или при повторном применении. Иммунологическая реакция несет угрозу жизни и здоровью.A known method [3] for the treatment of amyotrophic lateral sclerosis. The disadvantage of the method [3] is the unsatisfactory effectiveness of the preparations obtained by using the known method, due to the fact that a limited variety of genes is used - only one (out of many possible) therapeutic gene of vascular endothelial growth factor - VEGF. In addition, an adenoviral vector (which is a viral genetic construct), which causes a strong immunological response in patients with adenovirus infection and / or with repeated use, is used to obtain modified cells (transfection of recombinant DNA into tissue cells). An immunological reaction poses a threat to life and health.
Способ [3] основан на прямом введении генетического материала в ткани пациента и не позволяет проводить адресную доставку терапевтических генов в очаги поражения на клеточном уровне. Это приводит к эффекту неспецифической экспрессии терапевтических генов, например, вызывающей формирование и рост новых кровеносных сосудов в ненужных местах.The method [3] is based on the direct introduction of genetic material into the patient’s tissue and does not allow targeted delivery of therapeutic genes to the lesion foci at the cellular level. This leads to the effect of nonspecific expression of therapeutic genes, for example, causing the formation and growth of new blood vessels in unnecessary places.
Наиболее близким по существу предлагаемого изобретения (прототипом) является известный способ получения генетически модифицированных клеток [4].The closest to the essence of the invention (prototype) is a known method for producing genetically modified cells [4].
Недостатком прототипа является низкая эффективность действия препарата, изготовленного по способу [4], из-за низкого выхода продукта в виде генетически модифицированных клеток. Низкий выход продукта обусловлен следующим. Для приготовления эффективной лекарственной формы препарата по способу [4] необходимо одновременное введение двух независимых генетических конструкций. Использование двух отдельных генетических конструкций сопровождается получением недостаточной доли (из общей численности используемых клеток) клеток, генетически модифицированных одновременно двумя терапевтическими генами. Этим недостатком объясняется первая причина низкой эффективности препарата. Другим недостатком является низкая терапевтическая эффективность препарата, получаемого путем использования способа, из-за того, что второй ген представляет собой молекулу адгезии клеток. Этот второй ген выполняет лишь роль механической связи и не действует в качестве лекарственного компонента. Поэтому прототип обладает недостаточной эффективностью действия при применении.The disadvantage of the prototype is the low effectiveness of the drug manufactured by the method [4], due to the low yield of the product in the form of genetically modified cells. The low yield of the product is due to the following. To prepare an effective dosage form of the drug according to the method [4], the simultaneous introduction of two independent genetic constructs is necessary. The use of two separate genetic constructs is accompanied by the receipt of an insufficient proportion (of the total number of cells used) of cells genetically modified simultaneously by two therapeutic genes. This disadvantage explains the first reason for the low effectiveness of the drug. Another disadvantage is the low therapeutic efficacy of the drug obtained by using the method, due to the fact that the second gene is a cell adhesion molecule. This second gene serves only as a mechanical bond and does not act as a drug component. Therefore, the prototype has a lack of effectiveness in use.
Целью предлагаемого изобретения является получение лекарственного препарата генетически модифицированных клеток повышенной эффективности действия препарата.The aim of the invention is to obtain a medicinal product of genetically modified cells with increased effectiveness of the drug.
Цели достигают тем, что получают двухкассетную генетическую плазмидную конструкцию pBud-VEGF-GDNF, содержащую фрагменты ДНК, кодирующие VEGF и GDNF. Из пуповинной крови человека выделяют мононуклеарные клетки. Выделенные клетки генетически модифицируют генетической конструкцией pBud-VEGF-GDNF. Генетически модифицированные клетки культивируют, концентрируют, очищают от культуральной среды, ресуспензируют. Генетически модифицированные клетки анализируют на количество, концентрацию, жизнеспособность и по результатам анализа определяют оптимальную терапевтическую дозу генетически модифицированных клеток, которая является лекарственным препаратом генетически модифицированных клеток.The goals are achieved by obtaining a two-cassette genetic plasmid construct pBud-VEGF-GDNF containing DNA fragments encoding VEGF and GDNF. Mononuclear cells are isolated from human umbilical cord blood. Isolated cells are genetically modified with the pBud-VEGF-GDNF genetic construct. Genetically modified cells are cultured, concentrated, purified from the culture medium, and resuspended. Genetically modified cells are analyzed for quantity, concentration, viability, and the optimal therapeutic dose of genetically modified cells, which is a drug of genetically modified cells, is determined by the results of the analysis.
Лекарственный препарат применяют для лечения нейродегенеративных заболеваний.The drug is used to treat neurodegenerative diseases.
Лекарственный препарат замораживают для хранения и последующего применения.The drug is frozen for storage and subsequent use.
Сущность предлагаемого изобретения иллюстрируется примером осуществления предлагаемого способа для изготовления лечебного препарата. Изготовление препарата производят, например, в три этапа.The essence of the invention is illustrated by an example implementation of the proposed method for the manufacture of a medicinal product. The manufacture of the drug is carried out, for example, in three stages.
Первый этапFirst step
Генетическую конструкцию pBud-VEGF-GDNF создают на основе плазмиды pBud СЕ4.1 с использованием стандартного метода генетической инженерии [5] следующим путем.The genetic construct of pBud-VEGF-GDNF is created on the basis of plasmid pBud CE4.1 using the standard method of genetic engineering [5] in the following way.
Субклонирование фрагментов ДНК (несущих последовательности, кодирующие синтез изоформы 165 человеческого VEGF) в двухкассетный экспрессионный плазмидный вектор pBudCE 4.1 проводят с использованием рестрикционных сайтов, например рестрикционных ферментов Kpnl и Xhol. Ферменты (Kpnl и Xhol) являются несовместимыми по составу реакционных буферов. По данной причине рестрикционное расщепление плазмиды pcDNA-VEGF165 указанными выше ферментами проводят раздельно, с промежуточной очисткой фрагментов. Результат рестрикционного расщепления анализируют, например, с помощью электрофореза в агарозном геле с окраской ДНК бромистым этидием. Субклонируемые ДНК-фрагменты вырезают из геля и очищают, например, с использованием набора EZ-10 Spin Column DNA Gel Extraction Kit (фирма-производитель BioBasic Inc., Китай). Векторный фрагмент плазмиды pBudCE4.1 очищают от других компонентов реакционной смеси, например, с использованием набора EZ-10 Spin Column PCR Purification Kit (фирма-производитель BioBasic Inc., Китай). Векторный фрагмент обрабатывают щелочной фосфатазой - для уменьшения количества клонов, не несущих вставку. Векторный и вставочные фрагменты ковалентно сшивают, например, с использованием ДНК-лигазы бактериофага Т4. Продукты реакции лигирования трансформируют в компетентные клетки Е. coli, например в штамм XLIblue с использованием CaCl2-метода [5]. Проводят скрининг колоний на наличие потребной (создаваемой для достижения цели) плазмиды pBud-VEGF, например, с помощью полимеразной цепной реакции (далее по тексту - ПЦР) с использованием праймеров:Subcloning of DNA fragments (carrying sequences encoding the synthesis of human VEGF isoform 165) into the two-cassette expression plasmid vector pBudCE 4.1 is carried out using restriction sites, for example, Kpnl and Xhol restriction enzymes. Enzymes (Kpnl and Xhol) are incompatible in the composition of reaction buffers. For this reason, the restriction digestion of the pcDNA-VEGF165 plasmid by the above enzymes is carried out separately, with intermediate purification of the fragments. The result of restriction digestion is analyzed, for example, by agarose gel electrophoresis with DNA staining with ethidium bromide. Subcloned DNA fragments are excised from the gel and purified, for example, using the EZ-10 Spin Column DNA Gel Extraction Kit (manufactured by BioBasic Inc., China). The vector fragment of plasmid pBudCE4.1 was purified from other components of the reaction mixture, for example, using the EZ-10 Spin Column PCR Purification Kit (manufactured by BioBasic Inc., China). The vector fragment is treated with alkaline phosphatase - to reduce the number of clones that do not carry the insert. Vector and insertion fragments are covalently crosslinked, for example, using T4 bacteriophage DNA ligase. The ligation reaction products are transformed into competent E. coli cells, for example, to the XLIblue strain using the CaCl2 method [5]. Colonies are screened for the presence of the required (created to achieve the goal) plasmid pBud-VEGF, for example, using polymerase chain reaction (hereinafter - PCR) using primers:
VEGF165-F-Kpnl (CCGGTACCATGAACTTTCTGCTGTCTTGGG) иVEGF165-F-Kpnl (CCGGTACCATGAACTTTCTGCTGTCTTGGG) and
VEGF165-R-Stop-Xhol (CCGGTACCATGAACTTTCTGCTGTCTTGGG), специфичных к клонируемым ДНК-последовательностям. Получение создаваемой для достижения цели плазмиды pBud-VEGF подтверждают путем применения ДНК-секвенирования, например, с использованием праймеров EF-1a-forward (TCAAGCCTCAGACAGTGGTTC) и BGH-reverse (TAGAAGGCACAGTCGAGG) на автоматическом секвенаторе ABI Prism 310 Genetic Analyzer (фирма-производитель Applied Biosystems, США). В результате клонирования гена VEGF в плазмиду pBudCE 4.1 получают промежуточную генетическую конструкцию pBud-VEGF.VEGF165-R-Stop-Xhol (CCGGTACCATGAACTTTCTGCTGTCTTGGG) specific for cloned DNA sequences. The preparation of the pBud-VEGF plasmid created to achieve the goal is confirmed by DNA sequencing, for example, using EF-1a-forward primers (TCAAGCCTCAGACAGTGGTTC) and BGH reverse (TAGAAGGCACAGTCGAGG) on an ABI Prism 310 Genetic Analyzer automated sequencer (manufacturer-manufacturer Applied , USA). By cloning the VEGF gene into the pBudCE 4.1 plasmid, an intermediate pBud-VEGF genetic construct is obtained.
Далее полученную плазмиду pBud-VEGF используют для второго этапа субклонирования, в ходе которого в плазмиду встраивают ген GDNF. Для этого плазмиды pBud-VEGF и pcDNA-GDNF подвергают расщеплению рестрикционными ферментами, имеющими сайты рестрикции в используемых генетических конструкциях, например рестрикционных ферментов Hindlll и Xbal. Результаты рестрикционного расщепления анализируют, например, с помощью электрофореза в агарозном геле с окраской ДНК бромистым этидием. Субклонируемые ДНК-фрагменты вырезают из геля и очищают, например, с использованием набора EZ-10 Spin Column DNA Gel Extraction Kit (фирма-производитель BioBasic Inc., Китай). Векторный фрагмент плазмиды pBud-VEGF очищают от других компонентов реакционной смеси, например - с использованием набора EZ-10 Spin Column PCR Purification Kit (BioBasic Inc., Китай). Векторный фрагмент обрабатывают щелочной фосфатазой с целью уменьшения количества клонов, не несущих вставку.Next, the obtained plasmid pBud-VEGF is used for the second stage of subcloning, during which the GDNF gene is inserted into the plasmid. For this, the plasmids pBud-VEGF and pcDNA-GDNF are digested with restriction enzymes having restriction sites in the used genetic constructs, for example, the Hindlll and Xbal restriction enzymes. The results of restriction digestion are analyzed, for example, by agarose gel electrophoresis with DNA staining with ethidium bromide. Subcloned DNA fragments are excised from the gel and purified, for example, using the EZ-10 Spin Column DNA Gel Extraction Kit (manufactured by BioBasic Inc., China). The vector fragment of pBud-VEGF plasmid was purified from other components of the reaction mixture, for example, using the EZ-10 Spin Column PCR Purification Kit (BioBasic Inc., China). The vector fragment is treated with alkaline phosphatase in order to reduce the number of clones that do not carry the insert.
Векторный и вставочные фрагменты ковалентно сшивают, например, с использованием ДНК-лигазы бактериофага Т4. Продукты реакции лигирования трансформируют в компетентные клетки Е.coli, например в штамм XL1blue с использованием CaCl2-метода [5]. Проводят скрининг колоний на наличие потребной (создаваемой для достижения цели) плазмиды pBud-VEGF-GDNF, например, с помощью ПЦР с использованием праймеров:Vector and insertion fragments are covalently crosslinked, for example, using T4 bacteriophage DNA ligase. The ligation reaction products are transformed into competent E. coli cells, for example, to strain XL1blue using the CaCl2 method [5]. Colonies are screened for the presence of the required (created to achieve the goal) plasmid pBud-VEGF-GDNF, for example, by PCR using primers:
GDNF-F-Kpnl (GGTACCACCATGAAGTTATGGGATGTCGTG) иGDNF-F-Kpnl (GGTACCACCATGAAGTTATGGGATGTCGTG) and
GDNF-R-Xhol (CTCGAGTCAGATACATCCACACCTTTTAGC), специфичных к клонируемым ДНК-последовательностям. Подтверждение получения создаваемой для достижения цели плазмиды pBud-VEGF подтверждают путем применения ДНК-секвенирования, например, с использованием праймеров SV40polyA-seqR (CTGCATTCTAGTTGTGGTTTGTCC) и Т7 (TAATACGACTCACTATAGGG).GDNF-R-Xhol (CTCGAGTCAGATACATCCACACCTTTTAGC) specific for cloned DNA sequences. Confirmation of the production of the pBud-VEGF plasmid created to achieve the goal is confirmed by DNA sequencing, for example, using SV40polyA-seqR primers (CTGCATTCTAGTTGTGGTTTGTCC) and T7 (TAATACGACTCACTATAGGG).
В результате клонирования гена GDNF в плазмиду pBud-VEGF получают генетическую конструкцию pBud-VEGF-GDNF.By cloning the GDNF gene into the pBud-VEGF plasmid, the pBud-VEGF-GDNF genetic construct is obtained.
Полученный продукт (генетическая конструкция pBud-VEGF-GDNF) является генетическим компонентом лекарственного препарата, обладающего повышенным (по сравнению с прототипом) лечебным действием.The resulting product (the genetic construct of pBud-VEGF-GDNF) is the genetic component of the drug with an increased (compared to the prototype) therapeutic effect.
Получением генетического компонента завершают ПЕРВЫЙ этап осуществления предлагаемого способа и приступают ко второму этапу.Obtaining the genetic component completes the FIRST stage of the implementation of the proposed method and proceed to the second stage.
Второй этапSecond phase
Далее получают клеточный компонент лекарственного препарата повышенного (по сравнению с прототипом) лечебного действия.Next, get the cellular component of the drug increased (compared with the prototype) therapeutic effect.
Для этого ядросодержащие белые клетки (мононуклеарную фракцию) биологической ткани человека, например пуповинной крови, выделяют с помощью центрифугирования в градиенте фиколла [6]. Для выделения используют свежую кровь, хранящуюся не более 24 часов после сбора. В пробирку, например объемом 50 мл, вносят раствор фиколла, например, в количестве 10 мл, плотностью 1,077 г/мл. Затем поверх слоя фиколла медленно наносят пуповинную кровь, например, в количестве 30 мл. Пробирку с содержимым центрифугируют, например, 20 минут при 1900 об/мин на центрифуге LMC-3000 (фирма-производитель BioSan, Латвия). Мононуклеарные клетки (мононуклеарная фракция крови) концентрируют на границе фиколла и плазмы крови. Серологической пипеткой клетки отбирают и переносят их в другую, чистую, пробирку. Объем содержимого пробирки доводят до 50 мл, например, добавлением раствора PBS, не содержащим ионы Ca и Mg.For this, nucleated white cells (mononuclear fraction) of human biological tissue, such as umbilical cord blood, are isolated by centrifugation in a ficoll gradient [6]. Fresh blood is used for isolation, stored no more than 24 hours after collection. In a test tube, for example with a volume of 50 ml, a solution of ficoll is added, for example, in an amount of 10 ml, with a density of 1.077 g / ml. Then, cord blood is slowly applied over a layer of ficoll, for example, in an amount of 30 ml. The tube with the contents is centrifuged, for example, 20 minutes at 1900 rpm on a LMC-3000 centrifuge (manufacturer BioSan, Latvia). Mononuclear cells (mononuclear fraction of blood) are concentrated on the border of ficoll and blood plasma. Using a serological pipette, the cells are taken and transferred to another clean tube. The volume of the contents of the tube is adjusted to 50 ml, for example, by adding a PBS solution that does not contain Ca and Mg ions.
Содержимое пробирки перемешивают и центрифугированием, например, в течение 15 мин при 1400 об/мин на центрифуге LMC-3000 (фирма-производитель BioSan, Латвия) осаждают клетки мононуклеарной фракции крови. Супернатант сливают и клеточный осадок ресуспензируют, например, в 50 мл гипотонического раствора для лизиса эритроцитов (8,99 г NH4Cl, 1 г KHCO3, 37 мг EDTA, растворить в 1 л воды).The contents of the tube are mixed and centrifuged, for example, for 15 min at 1400 rpm on a LMC-3000 centrifuge (manufacturer BioSan, Latvia) mononuclear blood fraction cells are pelleted. The supernatant is drained and the cell pellet is resuspended, for example, in 50 ml of a hypotonic erythrocyte lysis solution (8.99 g of NH 4 Cl, 1 g of KHCO 3 , 37 mg of EDTA, dissolved in 1 l of water).
Клетки инкубируют в течение от 3 до 12 минут при комнатной температуре и осаждают на дне пробирки центрифугированием, например, в течение 15 мин при 1400 об/мин на центрифуге LMC-3000 (фирма-производитель BioSan, Латвия). Клеточный осадок ресуспензируют, например, в 50 мл раствора PBS, не содержащим ионы Ca и Mg. Ресуспензированные клетки повторно осаждают центрифугированием, например, в течение 15 мин при 1400 об/мин на центрифуге LMC-3000 (фирма-производитель BioSan, Латвия). Клеточный осадок повторно ресуспензируют в питательной среде, например в RPMI-1640, не содержащей сыворотки крови. Полученный продукт является клеточным компонентом лекарственного препарата. Получением клеточного компонента завершают второй этап и переходят к выполнению третьего этапа осуществления предлагаемого способа.Cells are incubated for 3 to 12 minutes at room temperature and pelleted at the bottom of the tube by centrifugation, for example, for 15 minutes at 1400 rpm in a LMC-3000 centrifuge (manufacturer BioSan, Latvia). The cell pellet is resuspended, for example, in 50 ml of a PBS solution containing no Ca and Mg ions. Resuspended cells are re-pelleted by centrifugation, for example, for 15 min at 1400 rpm on a LMC-3000 centrifuge (manufacturer BioSan, Latvia). The cell pellet is resuspended in culture medium, for example, in serum-free RPMI-1640. The resulting product is a cellular component of the drug. The preparation of the cellular component completes the second stage and proceeds to the third stage of the implementation of the proposed method.
Третий этапThird stage
Получают генно-клеточный лекарственный препарат повышенного (по сравнению с прототипом) лечебного действия. Для этого генетический и клеточный компоненты объединяют, например, в соотношении 20 мкг плазмидной ДНК pBud-VEGF-GDNF на 1×106 очищенных клеток мононуклеарной фракции пуповинной крови. Проводят генетическую модификацию клеток, например, с помощью электропорации (электропорация - пропускание электрического разряда через клеточную суспензию, что приводит к временному образованию пор в клеточной мембране, через которую рекомбинантная ДНК проникает внутрь клетки). Для электропорации 400 мкл смеси плазмидной ДНК и клеток помещают в кювету электропоратора Gene Pulser Xcell (фирма-производитель BioRad, Великобритания). Параметры электропорации: кювета 4 мм, напряжение 300 В, конденсатор 1000 мкф, режим экспоненциального затухания. После электропорации клетки (находящиеся в суспензии) помещают в питательную среду, например DMEM, содержащую 10% телячьей эмбриональной сыворотки и однократного (далее по тексту - 1х) раствора пенициллина-стрептомицина. Генетически модифицированные клетки инкубируют в питательной среде, например, в течение 12-24 часов. Генетически модифицированные клетки концентрируют, например, центрифугированием в течение 15 мин при 1400 об/мин на центрифуге LMC-3000 (фирма-производитель BioSan, Латвия). Концентрат клеток очищают от культуральной среды, например, раствором PBS, не содержащим ионы Ca и Mg. Клетки ресуспензируют, например, в физиологическом растворе. Затем проводят оценку количества, концентрации и жизнеспособности клеток, например, окраской трипановым синим и подсчетом окрашенных (мертвых) и неокрашенных (живых) клеток в камере Горяева. По результату анализа определяют оптимальную терапевтическую дозу генетически модифицированных клеток. Так завершают третий, заключительный, этап осуществления предлагаемого способа.Get gene-cell drug increased (compared with the prototype) therapeutic effect. For this, the genetic and cellular components are combined, for example, in a ratio of 20 μg of plasmid DNA pBud-VEGF-GDNF per 1 × 10 6 purified cells of the mononuclear fraction of umbilical cord blood. Cells are genetically modified, for example, by electroporation (electroporation is the passage of an electric discharge through a cell suspension, which leads to the temporary formation of pores in the cell membrane, through which recombinant DNA penetrates into the cell). For electroporation, 400 μl of a mixture of plasmid DNA and cells is placed in a cuvette of the Gene Pulser Xcell electroporator (manufacturer BioRad, UK). Electroporation parameters: 4 mm cuvette, voltage 300 V, capacitor 1000 microfarads, exponential decay mode. After electroporation, the cells (in suspension) are placed in a nutrient medium, for example DMEM, containing 10% calf fetal serum and a single (hereinafter, 1x) solution of penicillin-streptomycin. Genetically modified cells are incubated in a nutrient medium, for example, for 12-24 hours. Genetically modified cells are concentrated, for example, by centrifugation for 15 min at 1400 rpm on a LMC-3000 centrifuge (manufacturer BioSan, Latvia). The cell concentrate is purified from the culture medium, for example, with a PBS solution not containing Ca and Mg ions. Cells are resuspended, for example, in physiological saline. Then, the number, concentration and viability of cells are evaluated, for example, by trypan blue staining and counting stained (dead) and unpainted (living) cells in the Goryaev’s chamber. According to the result of the analysis, the optimal therapeutic dose of genetically modified cells is determined. So complete the third, final, stage of the implementation of the proposed method.
Полученный по завершении третьего этапа продукт является лекарственным препаратом, содержащим генетически модифицированные клетки, обладающий повышенным (по сравнению с прототипом) лечебным действием.Obtained at the end of the third stage, the product is a drug containing genetically modified cells with an increased (compared to the prototype) therapeutic effect.
Полученный лекарственный препарат, содержащий генетически модифицированные клетки, обладает преимуществом перед известными препаратами. Предлагаемая генетическая конструкция, одновременно и независимо экспрессирующая два терапевтических гена VEGF и GDNF, существенно повышает выход генетически модифицированных клеток по сравнению с прототипом, в котором используют две отдельные генетические конструкции.The resulting drug containing genetically modified cells has an advantage over known drugs. The proposed genetic construct, simultaneously and independently expressing two therapeutic genes VEGF and GDNF, significantly increases the yield of genetically modified cells compared to the prototype, which uses two separate genetic constructs.
Одновременное использование двух терапевтических генов (в отличие от прототипа с одним терапевтическим геном) позволяет существенно повысить лечебные свойства предлагаемого препарата за счет комплексной стимуляции нейропротекции и нейротрофии (функции питания нервных клеток).The simultaneous use of two therapeutic genes (in contrast to the prototype with one therapeutic gene) can significantly improve the therapeutic properties of the proposed drug due to the complex stimulation of neuroprotection and neurotrophy (the function of nerve cell nutrition).
Лекарственный препарат по способу используют в лечебных целях по конкретному назначению, например, путем непосредственного введения (трансплантации) пациенту. При необходимости препарат замораживают для хранения и последующего примененияThe drug according to the method is used for therapeutic purposes for a specific purpose, for example, by direct administration (transplantation) to the patient. If necessary, the drug is frozen for storage and subsequent use
Приведенный пример осуществления предлагаемого способа не ограничивает применение иных, по сравнению с приведенными в примере, генных и клеточных компонентов.The example implementation of the proposed method does not limit the use of other, compared with those in the example, gene and cellular components.
Полученный препарат полезен для лечения нейродегенеративных заболеваний, например болезни Хантигтона, Паркинсона, Апьцгеймера, бокового амиотрофического склероза, инсульта, травмы спинного мозга и периферических нервов.The resulting preparation is useful for the treatment of neurodegenerative diseases, such as Huntington’s disease, Parkinson’s, Apzeimer’s disease, amyotrophic lateral sclerosis, stroke, spinal cord injury and peripheral nerves.
Приведенный пример применения предлагаемого изобретения показывает его полезность для лечения людей в медицине. Применение предлагаемого способа способствует получению лекарственного препарата с высоким лечебным свойством и повышению качества лечения. Предлагаемое изобретение удовлетворяет критериям новизны, так как при определении уровня техники не обнаружено средство, которому присущи признаки, идентичные (то есть совпадающие по исполняемой ими функции и форме выполнения этих признаков) всем признакам, перечисленным в формуле изобретения, включая характеристику назначения.The given example of the application of the invention shows its usefulness for treating people in medicine. The application of the proposed method contributes to the production of a drug with a high healing property and to improve the quality of treatment. The present invention satisfies the criteria of novelty, since when determining the level of technology, no means have been found that have characteristics that are identical (that is, they coincide in the functions performed by them and the form in which these signs are performed) to all the signs listed in the claims, including the purpose of the application.
Предлагаемый способ имеет изобретательский уровень, поскольку не выявлены технические решения, имеющие признаки, совпадающие с отличительными признаками данного изобретения, и не установлена известность влияния отличительных признаков на указанный технический результат.The proposed method has an inventive step, because it has not been identified technical solutions having features that match the distinguishing features of this invention, and the popularity of the influence of distinctive features on the specified technical result is not established.
Заявленное техническое решение можно реализовать в промышленном производстве лекарственного препарата генетически модифицированных клеток и применять препарат в деятельности организаций здравоохранения посредством использования известных стандартных технических устройств и оборудования. Это соответствует критерию «промышленная применимость», предъявляемому к изобретениям.The claimed technical solution can be implemented in the industrial production of a medicinal product of genetically modified cells and to use the drug in the activities of health organizations through the use of well-known standard technical devices and equipment. This meets the criterion of "industrial applicability" presented to the invention.
Использованные источникиUsed sources
1. Ikeda, Y., et al., Development of angiogenic cell and gene therapy by transplantation of umbilical cord blood with vascular endothelial growth factor gene. Hypertens Res, 2004.27(2): p.119-28.1. Ikeda, Y., et al., Development of angiogenic cell and gene therapy by transplantation of umbilical cord blood with vascular endothelial growth factor gene. Hypertens Res, 2004.27 (2): p. 119-28.
2. Suzuki, M., et al., Direct muscle delivery of GDNF with human mesenchymal stem cells improves motor neuron survival and function in a rat model of familial ALS. Mol Ther, 2008.16(12): p.2002-10.2. Suzuki, M., et al., Direct muscle delivery of GDNF with human mesenchymal stem cells improves motor neuron survival and function in a rat model of familial ALS. Mol Ther, 2008.16 (12): p.2002-10.
3. Zavalishin, I.A., et al., Gene therapy of amyotrophic lateral sclerosis. Bull Exp Biol Med, 2008. 145(4): p.483-6.3. Zavalishin, I. A., et al., Gene therapy of amyotrophic lateral sclerosis. Bull Exp Biol Med, 2008.145 (4): p. 483-6.
4. Rizvanov, A.A., et al., Human umbilical cord blood cells transfected with VEGF and L(1)CAM do not differentiate into neurons but transform into vascular endothelial cells and secrete neuro-trophic factors to support neuro-genesis-a novel approach in stem cell therapy. Neurochem Int, 2008. 53(6-8): p.389-94.4. Rizvanov, AA, et al., Human umbilical cord blood cells transfected with VEGF and L (1) CAM do not differentiate into neurons but transform into vascular endothelial cells and secrete neuro-trophic factors to support neuro-genesis-a novel approach in stem cell therapy. Neurochem Int, 2008.53 (6-8): p. 389-94.
5. Sambrook, J. and D.W. Russell, Molecular Cloning: A Laboratory Manual. 3 ed. 2001: Cold Spring Harbor Laboratory Press. 2344.5. Sambrook, J. and D.W. Russell, Molecular Cloning: A Laboratory Manual. 3 ed. 2001: Cold Spring Harbor Laboratory Press. 2344.
6. Fuss, I.J., et al., Isolation of whole mononuclear cells from peripheral blood and cord blood. Curr Protoc Immunol, 2009. Chapter 7: p. Unit7 1.6. Fuss, I.J., et al., Isolation of whole mononuclear cells from peripheral blood and cord blood. Curr Protoc Immunol, 2009. Chapter 7: p. Unit7 1.
Claims (2)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2009123656/10A RU2431669C2 (en) | 2009-06-23 | 2009-06-23 | Method for producing preparation of genetically modified cells |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2009123656/10A RU2431669C2 (en) | 2009-06-23 | 2009-06-23 | Method for producing preparation of genetically modified cells |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| RU2009123656A RU2009123656A (en) | 2010-12-27 |
| RU2431669C2 true RU2431669C2 (en) | 2011-10-20 |
Family
ID=44055347
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| RU2009123656/10A RU2431669C2 (en) | 2009-06-23 | 2009-06-23 | Method for producing preparation of genetically modified cells |
Country Status (1)
| Country | Link |
|---|---|
| RU (1) | RU2431669C2 (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2527169C2 (en) * | 2012-10-15 | 2014-08-27 | Федеральное государственное бюджетное учреждение науки Институт биологии гена Российской академии наук (ИБГ РАН) | GENETIC CONSTRUCT CONTAINING hGDNF CONTROLLED BY TEMPERATURE-SENSITIVE PROMOTOR FOR REGULATED NEUROTROPHIC FACTOR EXPRESSION IN MAMMALIAN CELLS AND BODIES DIRECTLY |
| RU2557385C1 (en) * | 2014-06-18 | 2015-07-20 | Общество с ограниченной ответственностью "НекстГен" | Codon-optimised sequences and pharmaceutical composition for recovery of blood vessels |
| RU2595377C2 (en) * | 2014-10-24 | 2016-08-27 | Общество с ограниченной ответственностью "АптаНова" | GENETIC NUCLEOTIDE SEQUENCES OF ARTIFICIALLY MODIFIED GDNF WITH DELETED pro-REGION, PRODUCT OF WHICH HAS IMPROVED PROPERTIES NEURAL INDUCTOR AND STIMULATOR OF FORMATION OF NEURAL PROCESSES, SUITABLE FOR THERAPY OF NEURAL INJURIES, ISCHEMIC STROKES AND NEURODEGENERATIVE DISEASES, EXPRESSION VECTOR, MODIFIED WITH GDNF |
| RU2612497C2 (en) * | 2015-05-26 | 2017-03-09 | Общество с ограниченной ответственностью "НекстГен" | Optimized nucleotide sequence and pharmaceutical compositions based thereon with sustained vegf transgene expression |
| RU2716013C2 (en) * | 2019-05-27 | 2020-03-05 | Федеральное государственное бюджетное образовательное учреждение высшего образования "Казанский Государственный медицинский университет" Министерства здравоохранения Российской Федерации | Method for preparing a cell-mediated gene therapy agent and a cell-mediated gene therapy agent |
-
2009
- 2009-06-23 RU RU2009123656/10A patent/RU2431669C2/en active
Non-Patent Citations (1)
| Title |
|---|
| RIZVANOV А.А. et al. Human umbilical cord blood cells transfected with VEGF and L(1)CAM do not differentiate into neurons but transform into vascular endothelial cells and secrete neuro-trophic factors to support neuro-genesis-a novel approach in stem cell therapy. Neurochem Int. 2008 Dec; 53(6-8):389-94. Epub 2008 Sep 26. * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2527169C2 (en) * | 2012-10-15 | 2014-08-27 | Федеральное государственное бюджетное учреждение науки Институт биологии гена Российской академии наук (ИБГ РАН) | GENETIC CONSTRUCT CONTAINING hGDNF CONTROLLED BY TEMPERATURE-SENSITIVE PROMOTOR FOR REGULATED NEUROTROPHIC FACTOR EXPRESSION IN MAMMALIAN CELLS AND BODIES DIRECTLY |
| RU2557385C1 (en) * | 2014-06-18 | 2015-07-20 | Общество с ограниченной ответственностью "НекстГен" | Codon-optimised sequences and pharmaceutical composition for recovery of blood vessels |
| RU2595377C2 (en) * | 2014-10-24 | 2016-08-27 | Общество с ограниченной ответственностью "АптаНова" | GENETIC NUCLEOTIDE SEQUENCES OF ARTIFICIALLY MODIFIED GDNF WITH DELETED pro-REGION, PRODUCT OF WHICH HAS IMPROVED PROPERTIES NEURAL INDUCTOR AND STIMULATOR OF FORMATION OF NEURAL PROCESSES, SUITABLE FOR THERAPY OF NEURAL INJURIES, ISCHEMIC STROKES AND NEURODEGENERATIVE DISEASES, EXPRESSION VECTOR, MODIFIED WITH GDNF |
| RU2612497C2 (en) * | 2015-05-26 | 2017-03-09 | Общество с ограниченной ответственностью "НекстГен" | Optimized nucleotide sequence and pharmaceutical compositions based thereon with sustained vegf transgene expression |
| US9896493B2 (en) | 2015-05-26 | 2018-02-20 | “Nextgen” Company Limited | Nucleotide sequence and pharmaceutical composition based thereon with prolonged VEGF transgene expression |
| US10040837B2 (en) | 2015-05-26 | 2018-08-07 | “Nextgen” Company Limited | Nucleotide sequence and pharmaceutical composition based thereon with prolonged VEGF transgene expression |
| RU2716013C2 (en) * | 2019-05-27 | 2020-03-05 | Федеральное государственное бюджетное образовательное учреждение высшего образования "Казанский Государственный медицинский университет" Министерства здравоохранения Российской Федерации | Method for preparing a cell-mediated gene therapy agent and a cell-mediated gene therapy agent |
Also Published As
| Publication number | Publication date |
|---|---|
| RU2009123656A (en) | 2010-12-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11197895B2 (en) | Method for collecting functional cells in vivo with high efficiency | |
| AU2014238305B2 (en) | Methods and non-immunogenic compositions for treating inflammatory disorders | |
| AU2014238304B2 (en) | Treatment of inflammatory respiratory disease using biological solutions | |
| Okada et al. | Augmentation of the migratory ability of DC-based vaccine into regional lymph nodes by efficient CCR7 gene transduction | |
| US20200054715A1 (en) | Treatment of collagen defects using protein solutions | |
| AU2014238363B2 (en) | Methods and acellular compositions for treating inflammatory disorders | |
| RU2431669C2 (en) | Method for producing preparation of genetically modified cells | |
| CN115364227A (en) | Methods of treating peripheral vascular disease using protein solutions | |
| US10441635B2 (en) | Methods of treating pain using protein solutions | |
| EP3074507A1 (en) | Methods of mediating macrophage phenotypes | |
| CN106754723B (en) | Immune cell with anti-tumor function and application thereof | |
| CN106892974B (en) | Long peptide ERE1 based on tumor antigen ECM1 and application thereof in tumor immunotherapy | |
| CN110157686B (en) | Replication type oncolytic adenovirus activated by immune checkpoint and immune co-stimulation and construction method and application thereof | |
| CN107427535A (en) | Blood clot through modification | |
| JP2021509290A (en) | Bidirectionally activated co-stimulating molecular receptors and their uses | |
| US20220025006A1 (en) | An Interleukin 21 Protein (IL21) Mutant and Use Thereof | |
| CN109593725A (en) | A kind of recombination mescenchymal stem cell and its application | |
| CN114729320A (en) | Compositions, methods and uses thereof for reprogramming cells to dendritic cell type 2 capable of presenting antigen | |
| CN112538462A (en) | Cell membrane for rapid amplification of NK cells and application thereof | |
| CN106822869B (en) | Application of compound of polypeptide of DEF8 protein and heat shock protein gp96 in preparation of medicine for treating and preventing cancer | |
| CN114875069B (en) | Recombinant vector of genetically modified IL2 cytokine, host cell and application thereof | |
| CN109748974B (en) | Preparation and application of gene modified dendritic cell vaccine | |
| CN114712393B (en) | Application of Hnf-1 alpha gene modified mesenchymal stem cells in preventing and treating liver cancer | |
| RU2716013C2 (en) | Method for preparing a cell-mediated gene therapy agent and a cell-mediated gene therapy agent | |
| JP2022541293A (en) | p21-expressing monocytes for cancer cell therapy |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PD4A | Correction of name of patent owner |