CN117683722A - Preparation method of therapeutic cell or precursor cell thereof - Google Patents

Abstract

The invention relates to a preparation method of therapeutic cells or precursor cells thereof, which integrates receptor genes combined with target antigens into target gene loci of the therapeutic cells and the precursor cells at fixed points, so that the receptor genes combined with the target antigens are integrated into the target gene loci at fixed points while knocking out/destroying the target genes in the therapeutic cells and the precursor cells, and two-in-one of knocking out and fixed-point integration steps is realized in technical means; the method can knock out/destroy the target point of the receptor gene, avoids the autogenous killing among the therapeutic cells, improves the production efficiency, improves the living rate of the therapeutic cells during in-vitro amplification, improves the yield of the therapeutic cells during in-vitro amplification, reduces the exhaustion of the therapeutic cells in vitro, and more importantly, can enhance the anti-tumor curative effect of the therapeutic cells in vivo, and has good clinical application prospect.

Description

Preparation method of therapeutic cell or precursor cell thereof

Technical Field

The invention relates to a preparation method of therapeutic cells or precursor cells thereof, belonging to the technical field of biological medicine.

Background

Regarding techniques for integrating a gene of interest into cells, such as a CAR gene (chimeric antigen receptor gene) into T/NK cells, a conventional method is to infect T/NK cells with a lentivirus or retrovirus containing the CAR gene, which has a disadvantage that the CAR gene is randomly integrated into the T/NK cell genome, easily resulting in a safety hazard for random insertion, such as insertion point mutation or the risk of inducing transformation or even cancer of the cells.

Some site-directed integration techniques are disclosed in the prior art, for example, to obtain therapeutic CAR-T/NK cells using double-stranded microcarriers, or by site-directed integration of a target gene into a specific site in the cell, especially the integration of a CAR gene recognizing a tumor antigen into a specific site in a T/NK cell, by a gene editing system (such as ZFN, TALEN or CRISPR-Cas9, etc.).

Regarding the selection of specific sites for integration, conventional integration sites, currently validated by scientists in the art, mainly include: t cell receptor TCR constant region gene sites (e.g., TRAC sites), PD-1, HPK1, and AAVS1. The knockin at the specific sites after verification can ensure that the knockin exogenous target gene fragment (CAR gene fragment) can be transcribed normally to realize the expected function.

For example, eyqm J et al utilize CRISPR-Cas9 technology to site-integrate CAR genes into the TRAC site in human primary T cells, express CARs while knocking out TCRs, and prepare therapeutic CAR-T cells. Compared with the CAR-T cells prepared by the retrovirus, the CAR-T cells prepared by the method have the advantages of more uniform CAR expression, less CAR-T cell exhaustion, increased memory phenotype of the CAR-T cells and better therapeutic effect of the CAR-T cells. (Eyquem J, et al Targeting a CAR to the TRAC locus with CRISPR/Cas9 enhancements tumoure injection. Nature. 2017;543 (7643): 113-117.)

Because of the low efficiency of knock-in of large fragments of exogenous genes of interest (e.g., CAR gene expression cassettes), the prior art combines gene editing systems with homology-mediated repair mechanisms to increase the efficiency of site-directed integration. Specifically, the conventional specific site is sheared by a gene editing system (such as ZFN, TALEN or CRISPR-Cas9, etc.), a repair template repairs a broken site under a homology-mediated repair mechanism, and an exogenous target gene (for example, a CAR gene expression cassette) is knocked in to the specific site, so that a cell which can obtain the gene knockout of the specific site and stably express the exogenous target gene is prepared. The repair templates currently used are mainly plasmid DNA, double-stranded DNA, single-stranded DNA and adeno-associated viral vectors. For large fragment gene knock-in, adeno-associated viral vectors are currently relatively efficient.

In addition to the above-mentioned improvement of the site-directed integration efficiency of the target gene at a specific site, how to further improve the therapeutic effect of therapeutic cells (e.g., CAR-T/NK cells) is a technical problem to be solved by those skilled in the art.

Disclosure of Invention

The inventor breaks through the conventional thinking setting of the technicians in the field, selects an unconventional target gene locus as an integrated specific locus, tries to integrate the receptor gene combined with the target antigen into the target gene loci of therapeutic cells and precursor cells at fixed points, and discovers that two steps of target knockout and fixed point integration can be combined in a technical means, namely, the receptor gene combined with the target antigen is integrated into the target gene locus at fixed points while the target genes in the therapeutic cells and the precursor cells are knocked out/destroyed, so that the therapeutic cells (such as CAR-T/NK cells) with the anti-suicide capability are obtained, and the in-vitro anti-tumor curative effect of the cells is unexpectedly discovered to be better.

In particular, in the prior art, researchers in the field have found that in developing immune cell therapies to treat T/NK cell-related malignancies, it is desirable to develop corresponding CAR-T/NK cells, such as CD 5-targeted CAR-T/NK cells, CD 7-targeted CAR-T/NK cells, CD 38-targeted CAR-T/NK cells, for some molecules on malignant T/NK cells, such as CD5, CD7, CD38, etc. But the normal T cells or NK cells used to make CAR-T/NK themselves also express these target molecules, thereby eliciting autopsy and affecting the function of the corresponding CAR-T cells and CAR-NK cells.

To increase the anti-self-killing capacity and, in turn, the anti-tumor activity of CAR-T/NK cells, scientists in the art have attempted to engineer T/NK cells by CRISPR-Cas9 technology, e.g., to knock out or destroy genes (e.g., CD5, CD7, CD38, etc. genes) that elicit self-killing in T/NK cells using CRISPR-Cas9 technology.

However, regarding the selection of specific sites for CAR gene knock-in, as described in the background, conventional knock-in sites, which are currently validated by scientists in the art, mainly include: t cell receptor TCR constant region gene sites (e.g., TRAC sites), PD-1, HPK1, and AAVS1. The knockin at the specific sites after verification can ensure that the knockin exogenous target gene fragment (CAR gene fragment) can be transcribed normally to realize the expected function.

Thus, based on the limitations of theory and manipulation of the current prior art, the conventional thinking of those skilled in the art is to add a knockout/disruption step before the current step of knocking the CAR gene into the conventional specific site described above by site-directed integration technique or randomly integrating the CAR gene by reverse transcription/lentiviral transduction technique; namely, the CRISPR-Cas9 technology is adopted to knock out or destroy genes possibly causing self-phase killing (such as genes of CD5, CD7, CD38 and the like) in T/NK cells, and then the CAR genes are knocked into the conventional specific sites through the site-specific integration technology or are randomly integrated into the genome by using retroviruses/lentiviruses.

Specifically, the technical scheme for solving the self-phase killing is as follows:

the Maksim Mamonkin group reported that knocking out CD7 genes from T cells by CRISPR-Cas9 prior to transfection of CD7 CARs with retroviruses reduced CAR-T autopsy and promoted CAR-T expansion without affecting the cytotoxic effects of CAR-T (Gomes-Silva D, et al, CD7-edited T cells expressing a CD7-specific CAR for the therapy of T-cell MALIGnances. Blood 2017;130 (3): 285-296.). CD7 CAR-T therapy based thereon has now entered the clinical stage (NCT 03690011) for the treatment of T cell tumors. Another general UCART7 study also uses CRISPR-Cas9 technology to knock out CD7 and tcra prior to transfection of CD7 CAR with lentiviral virus to solve the phase stuttering and rejection problems.

The Michael O' Dwyer problem group reports that disruption of the CD38 gene by CRISPR-Cas9 technology in NK cells expressing CD38 CAR can reduce the autophagy and kill between CAR-NK cells, and promote efficient killing of tumor cells by CAR-NK cells (Gunney M, et al, CD38 knockout natural killer cells expressing an affinity optimized CD38 chimeric antigen receptor successfully target acute myeloid leukemia with reduced effector cell fratricide, haemato logica.2022; 107 (2): 437-445.).

However, the inventors of the present application have broken through the conventional thinking set by those skilled in the art, have tried to integrate receptor genes binding target antigens into target gene loci of therapeutic cells and precursor cells in a site-directed manner, and have found that two steps of knockout and site-directed integration can be technically realized. According to the technical scheme of the method, two steps are combined, the production efficiency is improved, and meanwhile, the inventor also unexpectedly discovers that compared with the prior art, the therapeutic cells obtained by the method can also improve the living rate of the therapeutic cells in-vitro amplification, improve the yield of the therapeutic cells in-vitro amplification, reduce the exhaustion of the therapeutic cells in-vitro, and more importantly, can enhance the anti-tumor curative effect of the therapeutic cells in-vivo, and have good clinical application prospects.

In a first aspect, the invention provides a method for the preparation of a therapeutic cell or precursor cell thereof, wherein,

the preparation method comprises the following steps:

step 1), obtaining immune cells or precursor cells thereof; the immune cells or the precursor cells thereof have target genes which express target antigens;

step 2) delivering a gene editing system to the immune cell or precursor cell thereof to disrupt the site of the target gene, and

Delivering a homologous recombination repair template vector comprising a receptor gene that binds to the target antigen to the immune cell or precursor cell thereof, thereby site-directed integrating the receptor gene into the cleavage site of the target gene and disrupting or knocking out the target gene;

the therapeutic cell or its precursor cell prepared by the above steps 1) and 2) expresses a receptor binding to the target antigen, and lacks the target antigen, thereby having an ability to resist self-killing.

In the expression "disruption or knockdown of the target gene", the "knockdown" refers to the expression of the target antigen being knocked out (target antigen not being expressed), and the "disruption" refers to the expression of the nonfunctional antigen (expressed antigen not having the target function).

In a specific embodiment of the invention, the immune cells are T cells, NK cells, B cells, macrophages, dendritic cells, monocytes. In a preferred embodiment of the invention, the immune cells are T cells, NK cells.

In a specific embodiment of the invention, the precursor cells are iPSC, HSC stem cells.

Precursor cells not genetically engineered (precursor cells not treated by the methods of the invention), which, although comprising a target gene, typically do not express the target antigen before differentiation, and only express the target antigen after differentiation.

In another specific embodiment of the invention, said immune cells or said precursor cells are of autologous or allogeneic origin.

In a specific embodiment of the invention, the target antigen is CD38, CD7, CD5, CD3, CD4 or CD1a.

In a preferred embodiment of the invention, the receptor gene is a CAR gene, TCR gene, STAR gene or HIT receptor gene.

In a preferred embodiment of the present invention, the homologous recombination repair template vector is an adeno-associated viral vector, a plasmid, single-stranded DNA, double-stranded linear DNA or microcircular DNA; preferably, the homologous recombination repair template vector is an adeno-associated viral vector.

In a specific embodiment of the present invention, the homologous recombination repair template comprises, in order from 5 'to 3': right homology arm, exogenous promoter, receptor gene, polyA sequence, left homology arm.

In a preferred embodiment of the present invention, an exogenous promoter is used in the homologous recombination repair template, and the immune cell is a T cell or NK cell; the target antigen is CD7 and the receptor gene is a CAR gene that binds CD 7. In another preferred embodiment of the invention, an exogenous promoter is used in the homologous recombination repair template, the immune cell is a T cell, the target antigen is CD38, and the receptor gene is a CAR gene that binds CD 38.

More preferably, the exogenous promoter may be an EF1 a exogenous promoter.

In a specific embodiment of the present invention, the homologous recombination repair template comprises, in order from 5 'to 3': left homology arm, 2A sequence, receptor gene, right homology arm. The endogenous promoter is upstream of the knock-in site.

In a preferred embodiment of the present invention, the homologous recombination repair template comprises a 2A sequence and a receptor gene, wherein the immune cell is an NK cell, the target antigen is CD38, and the receptor gene is a CAR gene binding to CD 38.

In a preferred embodiment of the present invention, the length of the left homology arm and the right homology arm have a length of 10-1000bp, respectively, and fragment lengths of, for example, 200bp, 300bp, 400bp, 500bp, 600bp, 700bp, 800bp, 900bp, 1000bp may be selected; preferably 200bp, 300bp, 800 bp.

In a preferred embodiment of the invention, the receptor gene is a CAR gene. Preferably, the CAR gene comprises a signal peptide, an antigen binding region, a hinge region, a transmembrane region, one or two co-stimulatory structures, and an activation region.

Preferably, the signal peptide is selected from the group consisting of CD8, IL2, GM-CSF signal peptide domains, more preferably CD8 signal peptide domains, and more preferably CD8a signal peptide domains.

The antigen binding region is a portion that binds to a target antigen, preferably an antibody scFv or a corresponding ligand.

Preferably, the hinge region is selected from the group consisting of IgG1, igG4, igD, and CD8 hinge domains, preferably CD28 hinge domains.

Preferably, the transmembrane region is selected from the group consisting of CD3, CD4, CD5, CD8, CD9, CD16, CD22, CD27, CD28, CD33, CD37, CD45, CD64, CD80, CD86, CD134, CD137, CD152, CD154 and PD1 transmembrane domain, preferably the CD28 transmembrane domain.

Preferably, the co-stimulatory structure is selected from the group consisting of CD2, CD7, CD27, CD28, CD30, CD40, CD54, CD83, CD134, CD137, CD150, CD152, CD223, CD270, CD273, CD274, CD278, CARD11, NKD2C, DAP10, LAT, SLP76, ZAP70 and 4-1BB co-stimulatory domain; preferably the CD28 co-stimulatory domain.

Preferably, the activation region is a cd3ζ activation domain.

In a specific embodiment of the invention, the gene editing system is selected from ZFN, TALEN, CRISPR; CRISPR is preferred.

In a specific embodiment of the invention, the nuclease of the CRISPR system is selected from SpCas9, saCas9, eSpcas9, cas12a, cas13 or cpf1; preferably, the nuclease of the CRISPR system is SpCas9.

In a specific embodiment of the invention, the gRNA of the CRISPR system further comprises a chemical modification of the base; preferably, the chemical modification is a methylation modification or a thio modification or a combination of both; more preferably, 1-5 bases at the 5 'and/or 3' end of the gRNA are 2 '-0-methylation modified and/or 3' thiosulfate modified.

In a specific embodiment of the invention, the gRNA of the CRISPR system is a gRNA targeting the target gene. Preferably, the sequence of the gRNA is designed to target the gRNA of the CD7 gene or CD38 gene.

In a specific embodiment of the present invention, in said step 2), the means for delivering the gene editing system to said immune cells or precursor cells thereof are selected from the group consisting of: electroporation, vector transformation, transfection, heat shock, transduction, microinjection; preferably, electroporation.

In a second aspect, the invention provides therapeutic cells or precursor cells thereof obtained by the preparation method described above.

In a third aspect, the invention provides the use of a therapeutic cell or precursor thereof as described above in the preparation of a gene therapy drug.

In a preferred embodiment of the invention, the disease for which the gene therapy agent is used is selected from the group consisting of: malignant tumor, autoimmune disease, immune rejection;

The malignancy is selected from: lymphoma, chronic lymphocytic leukemia, acute myelogenous leukemia, non-hodgkin lymphoma, diffuse large cell lymphoma, multiple myeloma, T-line malignancy, NK-related malignancy.

Preferably, the autoimmune disease is aids.

The invention relates to a preparation method of therapeutic cells or precursor cells thereof, which integrates receptor genes combined with target antigens into target gene loci of therapeutic cells and precursor cells at fixed points, realizes two-in-one steps of knockout and fixed point integration (knockout/destruction of the target genes in the therapeutic cells and the precursor cells and simultaneously integrates the receptor genes combined with the target antigens into the target gene loci) from technical means, can knockout/destroy targets of the receptor genes, avoids self-phase killing among the therapeutic cells (such as CAR-T/NK cells), improves production efficiency, can also improve the survival rate of the therapeutic cells during in-vitro amplification, improves the yield of the therapeutic cells during in-vitro amplification, reduces the exhaustion of the therapeutic cells in vitro, and more importantly, can enhance the antitumor effect of the therapeutic cells in vivo, and has good clinical application prospect.

Specifically, 1) therapeutic cells (e.g., CAR-T/NK cells) obtained by the preparation method of the present invention have better anti-tumor effects in mice than CAR-T/NK cells produced by the conventional method of random integration of CAR genes by lentiviruses and retroviruses. 2) Compared with the method of integrating the receptor gene into the conventional site (such as TRAC site) after knocking out the target gene in the prior art, the whole preparation process of the invention only needs one gRNA (only targets one target gene), only breaks one target gene site, obviously improves the integration efficiency of the receptor gene, reduces the off-target effect, and obviously improves the survival rate of therapeutic cells (such as CAR-T/NK cells); in addition, when the same receptor gene integration efficiency is achieved, the total amount of the required gRNA is lower, and the cost can be reduced.

Drawings

FIG. 1 is a schematic diagram of the technical scheme of embodiments 1-4 of the present invention;

FIG. 2 is a schematic diagram of the CD38 CAR gene structure in example 1;

FIG. 3 is a schematic diagram showing the modification of the CD38 gene in example 1;

FIG. 4 is a flow chart showing the knock-out efficiency of the CD38 gene in example 1;

FIG. 5 is a flow assay result of CD38 CAR expression on the surface of human primary T cells in example 1;

FIG. 6 is the result of killing tumor cells by CD38 CAR-T cells in example 1;

FIG. 7 shows the results of specific proliferation of CD38 CAR-T cells stimulated by tumor cells in example 1;

FIG. 8 is a graph showing the results of cytokine release from CD38 CAR-T cells stimulated by tumor cells in example 1;

FIG. 9 is the results of anti-tumor activity of CD38 CAR-T cells in a mouse model in example 1;

FIG. 10 is a schematic diagram showing the modification of CD38 gene in NK cells in example 2;

FIG. 11 is a flow assay result of CD38 CAR expressed on the surface of human primary NK cells in example 2;

FIG. 12 is the result of killing tumor cells by CD38 CAR-NK cells in example 2;

FIG. 13 is the result of anti-tumor activity of CD38 CAR-NK cells in the mouse model in example 2;

FIG. 14 is a schematic diagram of the CD7 CAR gene structure in example 3;

FIG. 15 is a schematic diagram showing the modification of the CD7 gene in example 3;

FIG. 16 is a flow chart showing the knock-out efficiency of the CD7 gene in example 3;

FIG. 17 is a flow assay result of CD7 CAR expression on the surface of human primary T cells in example 3;

FIG. 18 is the result of killing tumor cells by CD7 CAR-T cells in example 3;

FIG. 19 is the result of specific proliferation of CD7 CAR-T cells stimulated by tumor cells in example 3;

FIG. 20 is a graph showing the results of cytokine release from CD7 CAR-T cells stimulated by tumor cells in example 3;

FIG. 21 is a graph showing the results of anti-tumor activity of CD7 CAR-T cells in a mouse model as described in example 3;

FIG. 22 is a flow chart showing the knock-out efficiency of the CD7 gene in example 4;

FIG. 23 is a flow assay result of CD7 CAR expressed on the surface of human primary NK cells in example 4;

FIG. 24 is the result of killing tumor cells by CD7 CAR-NK cells in example 4;

FIG. 25 is the result of anti-tumor activity of CD7 CAR-NK cells in the mouse model in example 4.

Detailed Description

The present invention will be described in detail with reference to specific embodiments. These embodiments are not intended to limit the invention and structural, methodological, or functional modifications of these embodiments that may be made by one of ordinary skill in the art are included within the scope of the invention.

Example embodiments will now be described more fully. However, the exemplary embodiments can be embodied in many forms and should not be construed as limited to the embodiments set forth herein; rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the concept of the example embodiments to those skilled in the art.

Referring to FIG. 1, the schematic diagrams of the embodiments 1-4 of the present invention specifically show that receptor genes binding to target antigens are site-directed integrated into target gene sites in therapeutic cells and precursor cells and target genes are knocked out/destroyed.

The invention will be further explained with reference to examples and figures. The following examples verify through experiments that the inventive concepts of the inventors of the present application can be technically implemented; specifically, in example 1, CD38 CAR-T cells were obtained in which CD38 was knocked out; in example 2, CD38 CAR-NK cells were obtained with CD38 knocked out; in example 3, CD7 CAR-T cells were obtained with CD7 knocked out; in example 4, CD7 CAR-NK cells with CD7 knocked out were obtained.

In examples 1-4, the expression of the obtained T or NK cell surface CAR gene was examined by flow cytometry and its function was examined. Experiments prove that the CAR-T/NK cells prepared by adopting the embodiments 1-4 can not only avoid autogenous killing, but also effectively kill tumors in vitro and in vivo.

The following examples are only illustrative of the present invention and are not intended to limit the scope of the invention.

Example 1: preparation of CD38 CAR-T cells

1. Synthesis of CAR genes and homologous arm sequences

The amino acid sequence of the CD38 CAR gene is shown in SEQ ID NO:1, a schematic structure is shown in FIG. 2, which mainly comprises scFv (Single-Chain fragment Variable, single-chain variable region fragment capable of binding to target) recognizing specific tumor antigen CD38, extracellular CD28 transmembrane region and co-stimulatory signal CD28 and activation signal CD3 zeta. The left homology arm sequence is shown in SEQ ID NO:2, the right homology arm sequence is shown as SEQ ID NO: 3. And (3) synthesizing the CAR gene and the homologous arm sequence fragment by PCR, and synthesizing a forward primer shown as SEQ ID NO:4, the reverse primer is shown as SEQ ID NO: shown at 5.

2. Construction of CAR gene and homologous arm sequence onto adeno-associated viral vector and virus production

After cleavage of the adeno-associated viral vector with MluI and SpeI, the synthesized CAR gene and homologous arm sequence fragments were ligated to the adeno-associated viral vector by T4 ligase, and AAV CAR virus (Shandong Vietnam Biotechnology Co., ltd.) was produced.

3. Synthesis of guide RNA recognizing the integrated CD38 site

1. The guide RNA sequence of the targeted CD38 gene is shown in SEQ ID NO:6 is shown as follows: 5'-C T G AACTCGCAGTTGGCCATGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU U-3'. The guide RNA is modified RNA, wherein the guide RNA represents 2 '-O-methyl 3' -phosphorothioate.

2. In this embodiment, the CRISPR-Cas9 system is used to edit the CD38 gene, wherein Cas9 protein is purified in this laboratory, and details of purification are described in patent: CN 112210573A.

4. The complex of guide RNA and Cas9 protein is mixed with human primary T cells, and adeno-associated virus with CD38 CAR gene is added to the cell culture system after electrotransformation so that CAR gene is site-directed integrated into T cells.

1. Acquisition of human primary T cells

The volunteer venous blood (10 mL) was withdrawn, diluted with an equal volume of PBS, and 20mL of ficoll lymphocyte isolate was slowly added to the system to isolate peripheral blood mononuclear cells. T cells were isolated from peripheral blood mononuclear cells using Pan T Cell Isolation Kit (Meitian and Geneva), and the isolated T cells were cultured using X-VIVO15 medium containing 10% fetal bovine serum, 1% penicillin mixed solution (P/S) and IL-7 and IL-15 at a final concentration of 5 ng/mL, while activating the T cells with CD3/CD28 magnetic beads, and removing the magnetic beads 48 hours after activation.

2. Electrotransport guide RNA and Cas9 protein Complex (RNP) to T cells

Human primary T cells after 48. 48 h activation in step 1 were collected, centrifuged, and the cells were washed 1-2 times with serum-free X-VIVO15 medium and resuspended. Preparing an RNP complex: after 60 pmol of guide RNA was mixed with 6. Mu.g of Cas9 protein at room temperature or 37℃for 10 min, RNP complex was formed. RNP complex and human primary T cells were mixed to a final volume of 20. Mu.L (corresponding to 0.5-1million of human primary T cells) and electrotransferred using a Celetrix electrotransfer apparatus. Electric conversion conditions: voltage 520V, pulse time 20 ms. Immediately after electrotransformation, T cells were resuspended in X-VIVO15 medium (containing 10% fetal bovine serum and 1% p/S), a certain amount of CAR adeno-associated virus particles containing the CD38 gene homology arms and expressed under the control of different promoters were added to the culture system after electrotransformation for 20 min, IL-7 and IL-15 were added to the system after overnight culture at a final concentration of 5 ng/mL for continued culture, and CD38 CAR-T cells expressed under the control of the endogenous CD38 promoter (labeled CD38 KO/KI) and CD38 CAR-T cells expressed under the control of the exogenous EF1 a promoter (labeled CD38KO/KIEF1 a) were obtained, the corresponding reprogramming process being shown in fig. 3. Wherein, by way of comparison, CD38KORV CD38 CAR-T cells were also prepared simultaneously in this step: electrotransformation and previous steps were the same, T cells were resuspended in X-VIVO15 medium (containing 10% fetal bovine serum and 1% p/S) immediately after electrotransformation in this step, a quantity of CAR-containing retroviral particles was added to the culture system after electrotransformation 24 h, and culture was continued after 24 h medium exchange to a final concentration of 5 ng/mL IL-7 and IL-15 in X-VIVO15 medium; CD38KOTRACKI CD38 CAR-T cells: the procedure before electrotransformation was the same as above, in this procedure, the complex of CD38 guide RNA and Cas9 protein and the complex of TRAC guide RNA and Cas9 protein were mixed with human primary T cells and electrotransformed (to ensure that the cells with the TRAC site knocked in the CAR gene had the CD38 gene knocked out simultaneously, where the amount of CD38 RNP complex was 1.5 fold), the T cells were resuspended in X-VIVO15 medium (containing 10% fetal bovine serum and 1% P/S) immediately after electrotransformation, and after 20 min electrotransformation, a defined amount of CAR adeno-associated virus particles containing the TRAC gene homology arms were added to the culture system, and IL-7 and IL-15 were added to the system at a final concentration of 5 ng/mL after overnight culture for continued culture. The corresponding reprogramming process of CD38KORV CD38 CAR-T cells and CD38 KOTTRACKI CD38 CAR-T cells is shown below in FIG. 3.

5. Detecting expression of a target gene and function of a CAR-T cell

1. After 7 days of cell culture following electrotransformation, the efficiency of CD38 gene knockout (knockout, KO) and CAR gene integration (knockin, KI) was flow tested. The specific experiment: KO of CD38 in T cells was detected by flow antibody of CD38, while the site-directed KI efficiency of the CAR gene was detected using Alexa Fluor 647 anti-HA.11. As shown in FIG. 4, the abscissa represents the expression of CD38 on T cells, and the result shows that the KO efficiency of CD38 is 80% or more. The results of the CAR gene integration are shown in fig. 5, and the results indicate that the integration efficiency of CD38 CAR is above 60%.

As can be seen from the results of fig. 4 and 5, the inventors have broken through the conventional thinking and the innovative concept of site-directed integration of the CD38 binding CAR gene into the site of the CD38 gene of T cells for the antigen CD38 that may lead to self-phase disablement is technically achievable (two steps of knockout and site-directed integration can be achieved).

In comparison with the CD38KOTRACKI CD38 CAR-T cells obtained by the prior art method (CD 38 gene knocked out before CD38 binding CAR gene was integrated into the conventional TRAC site), the CD38KO/KICAR-T cells and CD38KO/KIEF1 a CAR-T cells obtained in this example showed less cell damage (3 rd day after preparation, CAR-T cell viability was CD38 KOTRACKI: 76.72%; CD38KO/KI: 85.28%; CD38KO/KIEF1 a: 87.39%) with a final cell count obtained (16 th day after preparation, cell expansion fold was CD38 KOTRACKI: 60 times; CD38KO/KI: 113 times; CD38KO/KIEF1 a: 118 times) with the final product integration efficiency comparable to CD38KOTRACKI CAR-T cells.

Furthermore, in order to obtain integration efficiencies comparable to CD38KO/KICAR-T and CD38KO/KIEF1 a CAR-T, CD38KOTRACKI CD38 CAR-T requires the addition of 2.5 times the total amount of Cas9 and gRNA during the preparation process. This illustrates: only one gRNA (only targeting CD38 gene) is needed in the whole preparation process of the embodiment, and only one target gene locus is broken, so that the CAR-T cell obtained by the embodiment has higher preparation efficiency, lower cost, lower off-target effect, higher cell activity and stronger in-vitro amplification capability.

2. Detection of killing Capacity of CAR-T cells obtained by two-in-one method

The killing capacity of CAR-T cells was calculated from the fluorescence values. As shown in fig. 6, the CD38KO/KIEF1 a CAR-T cells prepared by the two-in-one method significantly improved the killing ability of T cells to target cells Jurkat compared to CD38KORV CD38 CAR-T cells prepared by retroviruses, and had a killing ability similar to that of CD38KOTRACKI CD38 CAR-T cells prepared by site-directed integration of the CAR gene into the TRAC locus.

From the results of fig. 6, it can be seen that 1) compared with the CD38KORV CD38 CAR-T cells produced by the conventional method for randomly integrating the CAR gene by using the retrovirus, the CD38KO/KIEF1 α CAR-T cells obtained in this example significantly improved the killing ability of T cells to the target cell Jurkat. 2) CD38KOTRACKI CD38 CAR-T cells obtained by the prior art method (CD 38 gene knocked out before CD38 binding CAR gene was integrated into the conventional TRAC site) have similar killing ability to target cell Jurkat as compared with CD38KO/KIEF1 α CAR-T cells obtained in this example if compared with the same cell number. Of course, the experiment in the 1 st part shows that the CD38 CAR gene of the CD38KO/KIEF1 α CAR-T cell obtained in this example has higher integration efficiency and higher survival rate of the CAR-T cell, so that the CAR-T cell prepared according to the method in this example can obtain stronger killing effect of the target cell Jurkat from the viewpoint of comprehensive results.

3. Detecting proliferation capacity of CAR-T cells obtained by two-in-one method

After each week of CAR-T cell stimulation with Jurakt target cells, the ratio of CAR-T cells was examined by flow cytometry and the change in CAR-T cell number was recorded by counting with a cytometer, as shown in fig. 7, the proliferation potency of CD38KO/KIEF1 a CAR-T cells prepared by the two-in-one method was stronger than that of CD38KORV CD38 CAR-T cells prepared by retrovirus, and the proliferation potency of CD38KOTRACKI CD38 CAR-T cells prepared by site-directed integration of the CAR gene into the TRAC locus was similar.

As can be seen from the results of fig. 7, 1) the CD38KO/KIEF1 a CAR-T cells obtained in this example significantly improved the proliferation capacity of CAR-T cells compared to CD38KORV CD38 CAR-T cells produced by the conventional method for random integration of CAR genes by retroviruses. 2) The CD38KOTRACKI CD38 CAR-T cells obtained by the prior art method have similar proliferation capacity compared to the CD38KO/KIEF1 a CAR-T cells obtained in this example, if compared with the same cell number. Of course, the experiment in the 1 st part shows that the CD38 CAR gene of the CD38KO/KIEF1 α CAR-T cell obtained in this example has higher integration efficiency and higher survival rate of the CAR-T cell, so that from the comprehensive result, the CAR-T cell prepared according to the method in this example can obtain higher proliferation effect.

4. Detection of cytokine secretion Capacity of CAR-T cells obtained by two-in-one method

CAR-T cells and target cells at 4:1, and after incubation of 24 h, cell culture supernatants were collected and assayed for IFN- γ, IL2 and TNF- α cytokine concentrations in the supernatants, as shown in fig. 8, CD38KO/KIEF1 α CAR-T cells prepared by the two-in-one method were able to secrete similar levels of IFN- γ, and higher levels of IL2 and TNF- α as CD38KOTRACKI CD38 CAR-T cells.

As can be seen from the results of fig. 8, the CD38KOTRACKI CD38 CAR-T cells obtained by the prior art method have similar IFN- γ secretion capacity, but higher secretion levels of IL2 and TNF- α, than the CD38KO/KIEF1 αcar-T cells obtained in this example, if compared with the same cell number.

5. Detection of in vivo anti-tumor Capacity of CAR-T cells obtained by two-in-one method

NPSG mice of 6-12 weeks of age were selected and vaccinated with Jurkat-luciferase cells by tail vein injection, and after 4 days, 1106 different groups (5 replicates per group) of CD38 CAR-T cells were back-transfused, tumor burden was monitored by Biospace Optima small animal imaging system, as shown in FIG. 9, CD38KO/KIEF 1. Alpha. CAR-T cells prepared by the two-in-one method were able to significantly control tumor growth, prolong survival of mice, and control effect on tumors was similar to that of CD38KOTRACKI CD38 CAR-T group prepared by site-directed integration of the CAR gene into TRAC site, compared to the blank T control group.

As can be seen from fig. 9, 1) compared with the blank T control group, the CD38KO/KIEF1 α CAR-T cells obtained in this example can significantly improve the anti-tumor ability in the mouse. 2) The CD38 KOTACKI CD38 CAR-T cells obtained by the prior art method are similar to the CD38KO/KIEF1 alpha CAR-T cells obtained in the example, if compared with the same cell number, the anti-tumor capability of the two cells is similar. However, from the viewpoint of the comprehensive effect, the CD38 CAR gene of the CD38KO/KIEF1 α CAR-T cell obtained in this example has higher integration efficiency and higher survival rate of the CAR-T cell, and thus, the CAR-T cell prepared according to the method of this example has better antitumor effect.

Example 2: preparation of CD38 CAR-NK cells

1. Synthesis of CD38 CAR Gene and homology arm sequence (same as in example 1)

2. The CAR gene and homologous arm sequence are constructed on an adeno-associated virus vector, and the virus is produced. (same as in example 1)

3. Guide RNA recognizing the CD38 site of the integrated NK cell was synthesized. (same as in example 1)

4. The complex of guide RNA and Cas9 protein is mixed with human primary NK cells, and adeno-associated virus with CD38 CAR gene is added to NK cell culture system after electrotransformation so that CAR gene is site-directed integrated into NK cells.

1. Acquisition of human primary NK cells

The volunteer venous blood 10 mL was withdrawn, diluted with an equal volume of PBS, and 20mL ficoll lymphocyte isolate was slowly added to the system to isolate peripheral blood mononuclear cells. NK cells were isolated from peripheral blood mononuclear cells using CD56 Microbeads (Meitian-Geneva), and the isolated NK cells were cultured using RPMI1640 medium containing 10% fetal bovine serum, 1% green streptomycin mixture (P/S), 1% glutamine and IL-2 and IL-15 at a final concentration of 200U/mL and 5 ng/mL, while activating NK cells with irradiated K562-41BBL-IL21 cells.

2. Electrotransport guide RNA and Cas9 protein Complex (RNP) to NK cells

Human primary NK cells after 4 days of stimulation in step 1 were collected, centrifuged, and the cells were washed 1-2 times with serum-free RPMI1640 medium and resuspended. Preparing an RNP complex: after 60 pmol of guide RNA was mixed with 6. Mu.g of Cas9 protein at room temperature or 37℃for 10 min, RNP complex was formed. RNP complex and human primary NK cells were mixed to a final volume of 20. Mu.L (corresponding to 0.5-1million of human primary NK cells) and electrotransformed using CeletixTM electrotransformation apparatus. Electric conversion conditions: voltage 520V, pulse time 20 ms. Immediately after electrotransformation, NK cells were resuspended in RPMI1640 medium (containing 10% fetal calf serum, 1% P/S, 1% glutamine), after electrotransformation for 20 min, a certain amount of CAR adeno-associated virus particles containing CD38 gene homology arms and expressed under the control of endogenous CD38 promoter were added to the culture system, after overnight culture IL-2 and IL-15 were added to the system at a final concentration of 200U/mL and continued to culture, obtaining CD38 CAR-NK cells, labeled as CD38KO/KI-NK. In which, by contrast, CD38KO/KI EF 1. Alpha. -NK cells were also prepared simultaneously in this step: electrotransformation and the previous steps are the same as that of CD38KO/KI-NK cells, NK cells are resuspended in RPMI1640 medium (containing 10% fetal bovine serum, 1% P/S and 1% glutamine) immediately after electrotransformation in the step, a certain amount of CAR adeno-associated virus particles containing CD38 gene homology arms and expressed under the control of exogenous EF1 alpha promoter are added into a culture system after electrotransformation for 20 min, and IL-2 and IL-15 with the final concentration of 200U/mL are added into the system for continuous culture after overnight culture; CD38KO-NK cells: electrotransformation and the previous steps are the same as that of CD38KO/KI-NK cells, NK cells are resuspended in RPMI1640 medium (containing 10% fetal bovine serum, 1% P/S and 1% glutamine) immediately after electrotransformation in this step, and IL-2 and IL-15 with a final concentration of 200U/mL are added to the system after overnight culture for continuous culture.

5. Detecting the expression of a target gene and the function of a CAR-NK cell

1. After 7 days of cell culture following electrotransformation, the efficiency of CD38 gene knockout (knockout, KO) and CAR gene integration (knockin, KI) was flow tested. The specific experiment: KO of CD38 in NK cells was detected by a streaming antibody of CD38 while the site-directed KI efficiency of the CAR gene was detected using Alexa Fluor 647 anti-HA.11. As shown in FIG. 10, the abscissa represents the expression of CD38 on NK cells, and the result shows that the KO efficiency of CD38 is about 80%. The results of CAR gene integration are shown in fig. 11, which shows that the integration efficiency of CD38 CAR is about 30%.

As can be seen from the results of fig. 10 and 11, for the antigen CD38 that may cause self-phase disablement, the inventors broken through the conventional thinking and set the innovative concept of site-directed integration of the CD 38-binding CAR gene into the site of the CD38 gene of NK cells was technically feasible (two steps of knockout and site-directed integration could be achieved).

2. Detection of killing ability of CAR-NK cells obtained by two-in-one method

The killing capacity of CAR-NK cells was calculated from the fluorescence values. As shown in fig. 12, when the killing time is 3h, under different gradient effect target ratio conditions, the CD38 CAR can improve the killing ability of NK cells to target cells Jurkat, and the killing ability of CD38 KO/KI-NK cells using endogenous promoters to Jurkat has an effect target ratio of 1:8 is significantly better than CD38KO/KI EF1 alpha-NK using exogenous promoter. And when the killing time is 15h, the CD38 CAR can improve the killing capacity of NK cells to target cells Jurkat, and the killing capacity of CD38 KO/KI-NK and CD38KO/KI EF1 alpha-NK cells to Jurkat is not obviously different under different effective target ratio conditions.

3. Detection of in vivo anti-tumor Capacity of CAR-NK cells obtained by two-in-one method

NPSG mice of 6-12 weeks of age were selected and vaccinated with Jurkat-luciferase cells by tail vein injection, and after 4 days, the CD38 CAR-NK cells were returned to 9106 different groups (wherein CD38KO-NK and CD38KO/KI EF1 alpha-NK cell groups each had 4 replicates, CD38 KO/KI-NK group 5 replicates) and tumor burden was monitored by Biospace Optima small animal imaging system, as shown in FIG. 13, CD38 CAR was able to enhance the anti-tumor effect of NK cells in mice, and the in vivo anti-tumor effect of CD38 KO/KI-NK cells using endogenous promoters was superior to that of CD38KO/KI EF1 alpha-NK cells using exogenous promoters, compared to CD38KO-NK group and CD38KO/KI EF1 alpha-NK group, CD38 KO/KI-NK group small mice. .

As can be seen from the results of FIG. 13, the CD38KO/KI EF 1. Alpha. -NK cell group and the CD38 KO/KI-NK group both have a superior antitumor effect, and it was unexpectedly found that the antitumor effect of the CD38 KO/KI-NK group using the endogenous promoter is superior to that of the CD38KO/KI EF 1. Alpha. -NK cell group using the exogenous promoter.

Example 3: preparation of CD7 CAR-T cells

1. Synthesis of CAR genes and homologous arm sequences

The amino acid sequence of the CD7 CAR gene is shown in SEQ ID NO:7, the schematic structure is shown in FIG. 14, and mainly includes scFv recognizing specific tumor antigen CD7, extracellular CD28 transmembrane region and co-stimulatory signal CD28, and activation signal CD3 zeta. The left homology arm sequence is shown in SEQ ID NO:8, the right homology arm sequence is shown as SEQ ID NO: shown at 9. And (3) synthesizing the CAR gene and the homologous arm sequence fragment by PCR, and synthesizing a forward primer shown as SEQ ID NO:10, the reverse primer is shown as SEQ ID NO: 11.

2. Construction of CAR gene and homologous arm sequence onto adeno-associated viral vector and virus production

After cleavage of the adeno-associated viral vector with MluI and SpeI, the synthesized CAR gene and homologous arm sequence fragments were ligated to the adeno-associated viral vector by T4 ligase, and AAV CAR virus (Shandong Vietnam Biotechnology Co., ltd.) was produced.

3. Synthesis of guide RNA recognizing the integrated CD7 site

1. The guide RNA sequence of the targeted CD7 gene is shown in SEQ ID NO:12, as shown in: 5'-G A GCAGGUGAUGUUGACGGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU U-3' the guide RNA is modified RNA, wherein X represents 2 '-O-methyl 3' phosphorothioate.

2. In this embodiment, the CRISPR-Cas9 system is used to edit the CD7 gene, wherein the Cas9 protein used is purified in this laboratory, and details of purification are described in the patent: CN 112210573A.

4. The complex of guide RNA and Cas9 protein is mixed with human primary T cells, and adeno-associated virus with CD7 CAR gene is added to the cell culture system after electrotransformation so that CAR gene is site-directed integrated into T cells.

1. Acquisition of human primary T cells

The volunteer venous blood (10 mL) was withdrawn, diluted with an equal volume of PBS, and 20mL of ficoll lymphocyte isolate was slowly added to the system to isolate peripheral blood mononuclear cells. T cells were isolated from peripheral blood mononuclear cells using Pan T Cell Isolation Kit (Meitian and Geneva), and the isolated T cells were cultured using X-VIVO15 medium containing 10% fetal bovine serum, 1% penicillin mixed solution (P/S) and IL-7 and IL-15 at a final concentration of 5 ng/mL, while activating the T cells with CD3/CD28 magnetic beads, and removing the magnetic beads 48 hours after activation.

2. Electrotransport guide RNA and Cas9 protein Complex (RNP) to T cells

Human primary T cells after 48. 48 h activation in step 1 were collected, centrifuged, and the cells were washed 1-2 times with serum-free X-VIVO15 medium and resuspended. Preparing an RNP complex: 60 pmol of guide RNA targeting CD7 gene was mixed with 6. Mu.g of Cas9 protein at room temperature or 37℃and left for 10 min to form the RNP complex targeting CD7 gene. RNP complex and human primary T cells were mixed to a final volume of 20. Mu.L (corresponding to 0.5-1million of human primary T cells) and electrotransferred using a Celetrix electrotransfer apparatus. Electric conversion conditions: voltage 520V, pulse time 20 ms. Immediately after electrotransformation, re-suspending the T cells in an X-VIVO15 culture medium (containing 10% of fetal calf serum and 1% of P/S), adding a certain amount of CAR adeno-associated virus particles containing CD7 gene homology arms into a culture system after electrotransformation for 20 min, adding IL-7 and IL-15 with the final concentration of 5 ng/mL into the system after overnight culture for continuous culture to obtain CD7 CAR-T cells, wherein the CD7 CAR-T cells are marked as CD7KO/KIEF1 alpha CD7 CAR-T, and the corresponding reprogramming process is shown in FIG. 15; wherein, by way of comparison, CD7KORV CD7 CAR-T cells were also prepared simultaneously in this step: that is, after electrotransformation of the mixture of CD7 gene targeting RNP complex and human primary T cells according to this procedure, the T cells were resuspended in X-VIVO15 medium (containing 10% fetal bovine serum and 1% P/S), a certain amount of retroviral particles containing CAR gene was added to the culture system after overnight culture, and the culture was continued after 24 h infection by changing the solution to X-VIVO15 medium with final concentrations of IL-7 and IL-15 of 5 ng/mL. By contrast, CD7KOTRACKI CD7 CAR-T cells were also prepared simultaneously in this step: the preparation of RNA complexes is carried out according to the steps, wherein the RNP complexes targeting CD7 genes and the RNP complexes targeting TRAC genes are simultaneously prepared (the CD7 genes of cells in which the TRAC site is knocked into the CAR genes are knocked out simultaneously, the dosage of the CD7 RNP complexes is 1.5 times that of the cells), two RNP complexes are respectively formed and then are mixed with human primary T cells, a certain amount of CAR adeno-associated virus particles containing TRAC gene homology arms are added into a culture system after 20 minutes of electrotransformation, and IL-7 and IL-15 with the final concentration of 5 ng/mL are added into the system for continuous culture after overnight culture.

5. Detecting expression of a target gene and function of a CAR-T cell

1. After 7 days of cell culture following electrotransformation, the efficiency of CD7 gene knockout (knockout, KO) and CAR gene integration (knockin, KI) was flow tested. The specific experiment: KO of CD7 in T cells was detected by streaming antibody of CD7, while site-directed KI efficiency of the CAR gene was detected using Alexa Fluor 647 anti-HA.11. As shown in FIG. 16, the abscissa represents the expression of CD7 on T cells, and the result shows that the KO efficiency of CD7 is more than 90%. The results of CAR gene integration are shown in fig. 17, indicating that there is about 60% positive rate for CD7 CAR.

As can be seen from the results of fig. 16 and 17, the inventors have broken through the conventional thinking and the innovative concept of site-directed integration of the CD 7-binding CAR gene into the site of the CD7 gene of T cells for the antigen CD7 that may lead to self-phase disablement is technically achievable (two steps of knockout and site-directed integration can be achieved).

Compared to CD7KOTRACKI CD7 CAR-T cells obtained by prior art methods (CD 7 gene knocked out before CD7 binding CAR gene is integrated into the conventional TRAC site), the CD7KO/KIEF1 a CD7 CAR-T cells obtained in this example had a greater number of cells obtained at end product integration efficiency (to obtain integration efficiency comparable to CD7KO/KIEF1 a CAR-T, CD7KOTRACKI CD7 CAR-T requires addition of 2.5-fold total amount of Cas9 and gRNA during preparation) with less cell damage (third day after preparation, cell viability CD7KO/KIEF1 a CAR-T84% vs. CD7KOTRACKI CD7 CAR-T68%), the number of cells obtained at end was greater (7 day after preparation, CD7KO/KIEF1 a CAR-T was amplified 27-vs. CD7 tracki CD7 CAR-T was amplified 10-fold); this illustrates: only one gRNA (only targeting CD7 gene) is needed in the whole preparation process of the embodiment, and only one target gene locus is broken, so that the CAR-T cell obtained by the embodiment has higher preparation efficiency, lower cost, lower off-target effect, higher cell activity and stronger in-vitro amplification capability.

2. Detection of killing Capacity of CAR-T cells obtained by two-in-one method

The killing capacity of CAR-T cells was calculated from the fluorescence values. As shown in fig. 18, CD7 CARs significantly improved the killing capacity of T cells against target cells Jurkat at each gradient-effect target ratio condition compared to the blank T control. Wherein, the killing capacity of CD7 CAR-T (CD 7KO/KIEF1 alpha CD7 CAR-T obtained by the two-in-one method, CD7KOTRACKI CD7 CAR-T obtained by the conventional knock-in site and CD7KORV CD7 CAR-T obtained by retrovirus transduction) obtained by three different preparation methods on Jurkat is not significantly different.

3. Detecting proliferation capacity of CAR-T cells obtained by two-in-one method

The target cells stimulate the CAR-T cells stained with cytotelelltm cell dye or CFSE cell dye, and upon cell division, the dye within the cells is separated into two sub-cells, the dye content of individual cells is reduced, and the fluorescence intensity is reduced. Proliferation of CAR-T cells was detected by flow cytometry based on dilution of the dye, i.e. change in fluorescence intensity of the cells.

As shown in fig. 19, CD7 CAR-T cells had decreased fluorescence intensity in the cell population after target cell stimulation, with the peak shifted to the left, indicating that target cells could stimulate CAR-T cell proliferation.

4. Detection of cytokine secretion Capacity of CAR-T cells obtained by two-in-one method

CAR-T cells typically secrete a range of cytokines, including IFN- γ, IL-2 and TNF- α, upon activation by target cell stimulation. Three CD7 CAR-T cells and target cells were each expressed as 4:1 after incubation with an effective target ratio of 24 h, cell culture supernatants were collected and the concentration of IFN- γ, IL-2 and TNF- α cytokines in the supernatants was measured to characterize CAR-T cell activation.

As shown in fig. 20, all three CD7 CAR-T cells were able to effectively activate and secrete cytokines upon stimulation by the target cells.

5. Detection of in vivo anti-tumor Capacity of CAR-T cells obtained by two-in-one method

Tumor burden was monitored by selecting 6-12 week old NPSG mice and vaccinating Jurkat-luciferase cells by tail vein injection, and 4 days later reinjecting 1106 different groups (4 replicates in the blank group and 5 replicates in the other group) of CD7 CAR-T cells, periodically obtaining average emittance of the mice by Biospace Optima small animal imaging system.

As shown in fig. 21, compared with the blank T control group, all three CD7 CAR-T cells have a certain anti-tumor effect, and can control the growth of tumor and prolong the survival period of mice. Wherein CD7KO/KIEF 1. Alpha. CD7 CAR-T is the best, CD7 KOTACKI CD7 CAR-T is inferior, and CD7KORV is still significantly better than the blank T control.

Example 4: preparation of CD7 CAR-NK cells

1. Synthesis of CAR Gene and homologous arm sequences (same as in example 3)

2. CAR gene and homologous arm sequences were constructed on adeno-associated viral vectors and produced (same as in example 3)

3. Synthesis of guide RNA recognizing the CD7 site of an Integrated NK cell (same as in example 3)

4. The complex of guide RNA and Cas9 protein is mixed with human primary NK cells, and adeno-associated virus with CD7 CAR gene is added to NK cell culture system after electrotransformation so that CAR gene is site-directed integrated into NK cells.

1. Acquisition of human primary NK cells

The volunteer venous blood (10 mL) was withdrawn, diluted with an equal volume of PBS, and 20mL of ficoll lymphocyte isolate was slowly added to the system to isolate peripheral blood mononuclear cells. NK cells were isolated from peripheral blood mononuclear cells using CD56 microblades (Meitian-Geneva), and the isolated NK cells were cultured using 1640 medium containing 10% fetal bovine serum, 1% green streptomycin mixture (P/S), 2mM L-glutamine and IL-15 and IL-2 at final concentrations of 5 ng/mL and 20 ng/mL, while activating NK cells with irradiated K562-41BBL-IL21 cells.

2. Electrotransport guide RNA and Cas9 protein Complex (RNP) to NK cells

Human primary NK cells after 4 days of activation in step 1 were collected, centrifuged, and the cells were washed 1-2 times with serum-free RPMI1640 medium and resuspended. Preparing an RNP complex: 60 pmol of guide RNA was mixed with 6. Mu.g of Cas9 protein at room temperature or 37℃for 10 min to form a CD7 gene-targeted RNP complex. RNP complex and human primary NK cells were mixed to a final volume of 20. Mu.L (corresponding to 0.5-1million of human primary NK cells) and electrotransformed using CeletixTM electrotransformation apparatus. Electric conversion conditions: voltage 520V, pulse time 20 ms. Immediately after electrotransformation, T cells are resuspended in 1640 medium (containing 10% fetal calf serum, 1% P/S and 2 mM L-glutamine), a certain amount of CAR adeno-associated virus particles containing CD7 gene homology arms are added into a culture system after electrotransformation for 20 min, IL-15 with a final concentration of 5 ng/mL and IL-2 with a final concentration of 20 ng/mL are added into the system after overnight culture for continuous culture, and CD7 CAR-NK cells are obtained.

5. Detecting the expression of a target gene and the function of a CAR-NK cell

1. After 7 days of cell culture following electrotransformation, the efficiency of CD7 gene knockout (knockout, KO) and CAR gene integration (knockin, KI) was flow tested. The specific experiment: KO of CD7 in NK cells was detected by streaming antibody of CD7 while site-directed KI efficiency of CAR gene was detected using Alexa Fluor 647 anti-HA.11. As shown in FIG. 22, the abscissa represents the expression of CD7 on NK cells, and the result shows that the NK ratio of CD7 after CD7 KO exceeds 80%. The results of CAR gene integration are shown in fig. 23, indicating a positive rate of about 70% for CD7 CAR.

As can be seen from the results of fig. 22 and 23, the inventors have broken through the conventional thinking and the innovative concept of site-directed integration of the CD 7-binding CAR gene into the site of the CD7 gene of NK cells, for the antigen CD7 that may lead to self-phase disablement, is technically achievable (two steps of knockout and site-directed integration can be achieved).

2. Detection of killing ability of CAR-NK cells obtained by two-in-one method

The killing capacity of CAR-T cells was calculated from the fluorescence values. As shown in fig. 24, CD7 CAR increased NK cell killing capacity of target cell Jurkat under certain gradient-effective targeting conditions compared to the blank NK control group.

3. Detection of in vivo anti-tumor Capacity of CAR-T cells obtained by two-in-one method

Tumor burden was monitored by selecting 6-12 week old NPSG mice and vaccinating Jurkat-luciferase cells by tail vein injection, reinfusion 5106 different groups (4 replicates per group) of CD7 CAR-NK cells once a week (4 days, 11 days, 18 days and 25 days after tumor cell inoculation), and periodic acquisition of the average emittance of the mice by Biospace Optima small animal imaging system.

As shown in fig. 25, the tumor burden of CD7 CAR-NK group mice was less than that of the blank NK control group.

It should be understood that although the present disclosure describes embodiments, not every embodiment is provided with a separate embodiment, and that this description is for clarity only, and that the skilled artisan should recognize that the embodiments may be combined as appropriate to form other embodiments that will be understood by those skilled in the art.

The above list of detailed descriptions is only specific to practical embodiments of the present invention, and they are not intended to limit the scope of the present invention, and all equivalent embodiments or modifications that do not depart from the spirit of the present invention should be included in the scope of the present invention.

Claims (17)

1. A method of preparing a therapeutic cell or precursor cell thereof, comprising:

the preparation method comprises the following steps:

step 1), obtaining immune cells or precursor cells thereof; the immune cells or the precursor cells thereof have target genes which express target antigens;

step 2) delivering a gene editing system to the immune cell or precursor cell thereof to disrupt the site of the target gene, and

Delivering a homologous recombination repair template vector comprising a receptor gene that binds to the target antigen to the immune cell or precursor cell thereof, thereby site-directed integrating the receptor gene into the cleavage site of the target gene and disrupting or knocking out the target gene;

the therapeutic cell or its precursor cell prepared by the above steps 1) and 2) expresses a receptor binding to the target antigen, and lacks the target antigen, thereby having an ability to resist self-killing.

2. The method of manufacturing according to claim 1, wherein:

the immune cells are T cells, NK cells, B cells, macrophages, dendritic cells and monocytes; t cells, NK cells are preferred;

the precursor cells are iPSC and HSC stem cells.

3. The method of manufacturing as claimed in claim 2, wherein:

the target antigen is CD38, CD7, CD5, CD3, CD4 or CD1a.

4. A method of preparation as claimed in claim 3, wherein:

the receptor gene is a CAR gene, TCR gene, STAR gene or HIT receptor gene.

5. The method of manufacturing according to claim 4, wherein:

the homologous recombination repair template vector is an adeno-associated virus vector, a plasmid, single-stranded DNA, double-stranded linear DNA or micro-circular DNA.

6. The method of manufacturing according to claim 5, wherein:

the homologous recombination repair template comprises, in order from 5 'to 3': right homology arm, exogenous promoter, receptor gene, polyA sequence, left homology arm.

7. The method of manufacturing according to claim 6, wherein:

the immune cells are T cells or NK cells; the target antigen is CD7, and the receptor gene is a CAR gene combined with CD 7; or,

the immune cells are T cells, the target antigen is CD38, and the receptor gene is a CAR gene that binds CD 38.

8. The method of manufacturing according to claim 5, wherein:

the homologous recombination repair template comprises, in order from 5 'to 3': left homology arm, 2A sequence, receptor gene, right homology arm.

9. The method of preparing as claimed in claim 8, wherein:

the immune cells are NK cells, the target antigen is CD38, and the receptor gene is a CAR gene combined with CD 38.

10. The production method according to any one of claims 1 to 9, characterized in that:

the gene editing system is selected from ZFN, TALEN, CRISPR; CRISPR is preferred.

11. The method of manufacturing as claimed in claim 10, wherein:

The nuclease of the CRISPR system is selected from SpCas9, saCas9, eSpcas9, cas12a, cas13 or cpf1; preferably, the nuclease of the CRISPR system is SpCas9.

12. The method of manufacturing as claimed in claim 10, wherein:

the gRNA of the CRISPR system further comprises chemical modification of the base; preferably, the chemical modification is a methylation modification or a thio modification or a combination of both; more preferably, 1-5 bases at the 5 'and/or 3' end of the gRNA are 2 '-0-methylation modified and/or 3' thiosulfate modified.

13. The production method according to any one of claims 1 to 9, characterized in that: in said step 2), the means of delivering the gene editing system to said immune cells or precursor cells thereof are selected from the group consisting of: electroporation, vector transformation, transfection, heat shock, transduction, microinjection; preferably, electroporation.

14. Therapeutic cells or precursor cells thereof obtainable by the method of any one of claims 1 to 13.

15. Use of a therapeutic cell or precursor cell thereof according to claim 14 for the preparation of a gene therapy drug.

16. The use according to claim 15, wherein the disease for which the gene therapy drug is used is selected from: malignant tumor, autoimmune disease, immune rejection;

The malignancy is selected from: lymphoma, chronic lymphocytic leukemia, acute myelogenous leukemia, non-hodgkin lymphoma, diffuse large cell lymphoma, multiple myeloma, T-line malignancy, NK-related malignancy.

17. Preferably, the autoimmune disease is aids.