CN114921417A

CN114921417A - Preparation method and application of double-gene site-directed integration universal CAR-T cell

Info

Publication number: CN114921417A
Application number: CN202210657743.0A
Authority: CN
Inventors: 彭作翰; 刘佳玫; 豆亚丽; 徐之艳; 李玏
Original assignee: Xi'an Soniser Biomedical Co ltd
Current assignee: Xi'an Soniser Biomedical Co ltd
Priority date: 2022-06-10
Filing date: 2022-06-10
Publication date: 2022-08-19

Abstract

The present invention relates to methods of making double-knock-in universal CAR-T cells. The method comprises delivering a gene-editing substance to a T cell to knock out the B2M gene and the TRAC gene; and delivering the repair template vector to the T cell to knock the CAR gene and the B2M-HLA-E gene into the TRAC or B2M site. The method is simple, convenient and efficient, and can realize multi-gene knock-in and knock-out in one step.

Description

Preparation method and application of double-gene site-directed integration universal CAR-T cell

Technical Field

The invention relates to the field of cell therapy, in particular to a preparation method and application of a double-gene site-directed integration universal CAR-T cell.

Background

CAR-T therapy

Traditional tumor treatment drugs include chemotherapeutic drugs and targeted drugs, which improve the survival time of cancer patients to a certain extent, but also bring serious side effects, thereby greatly reducing the life quality of the patients. Even more unfortunately, most patients still relapse after receiving these traditional treatments, and once they do, drug-free rescue is an approximate event.

In recent years, with the development of immunotherapy, the emergence of drugs as immunodetection point inhibitors (such as CTLA-4 and PD-1/PD-L1 antibodies) has drastically changed the way of tumor therapy. However, the effective rate of the medicine in different cancer patients is only 20% -40%, and most cancer patients wait for the emergence of new effective treatment modes.

The chimeric antigen receptor T cell (CAR-T cell) therapy technology is characterized in that an artificial gene for recognizing cancer cell surface antigens is transduced on T cells in vitro, so that the T cells have the capacity of specifically killing tumor cells. CAR-T cell therapy belongs to Adoptive Cell Transfer (ACT), which utilizes human immune cells to fight tumors, and is called a "live drug". The ACT therapy has been recently applied in clinical trials, especially in the effective exploration of various leukemias, and opens up a new way for researchers and doctors to treat tumors. Compared with the traditional medicine, the CAR-T medicine has the following innovation points:

first, tumors are precisely targeted and side effects are reversible. CAR-T cell therapy has more specific tumor cell killing ability than chemotherapeutic drugs and targeted drugs. Although cytokine effects may occur for a short period of time after infusion into a patient, the side effects are controlled and the patient can live substantially as well as healthy people with complete remission.

Second, sustained remission is long. The CAR-T cell belongs to a memory T cell part, can exist in a patient body for a long time after being infused into the patient body, monitors whether tumor cells appear in the body or not at any time, and kills new tumor cells once the new tumor cells appear.

Universal CAR-T therapy

Universal CAR-T (UCAR-T) is obtained from blood of healthy people, and is transfused to different patients after being modified by gene editing technology. It knocks out some genes on the existing T cells, so that the foreign healthy human T cells can not attack the cells in the body of the patient to cause host rejection reaction (GvHD effect) and can not be eliminated by the immune system of the patient, thereby surviving and playing the role of killing tumors in the body of the patient. The universal CAR-T is a shelf-stable drug because it is derived from existing healthy human T cells and can be mass-produced according to strict standards for drug production. Compared with autologous CAR-T, the universal CAR-T has the characteristics of 'putting on the shelf (off-the-shelf)':

first, it is ready to use, and can be prepared in advance without the use of patient T cells, thus being a "drug put on a shelf" that can be taken at any time without the need for the patient to wait.

Secondly, the mass production can be realized in large scale, and the cost is greatly reduced. Is not customized and can be produced in large scale. 400ml of blood is collected by a healthy person, and UCAR-T cell products meeting the requirements of hundreds of patients can be prepared. A single dose of UCAR-T was preliminarily predicted, and the cost would be 1/10 the cost of autologous CAR-T.

Third, there is no usage limitation. Because the preparation method adopts the blood of healthy people to extract the T cells and does not need the patient to provide the T cells, the T cells are not limited by the physical condition (T cell state) of the patient and are not limited by use.

However, universal CAR-T therapy still needs to overcome the following problems:

1) allogeneic T cell transplantation compatibility problem

Despite the numerous advantages of universal CAR-T therapy, the manufacturing and development difficulties are much greater than with autologous CAR-T therapy. Among them, the most influential to its therapeutic effect is the problem of allogeneic rejection: histocompatibility antigens vary from individual to individual, leading to attack and rejection of the graft by recipient T cells. To solve this problem, the B2M gene in CAR-T cells is usually knocked out by gene editing methods (such as ZFN, TALEN or CRISPR-Cas9), so that HLA-ABC protein cannot be displayed on the cell surface, and thus attack by recipient T cells can be avoided. There are also some researchers who knock out the CIITA gene together to reduce the expression of two types of histocompatibility antigens.

2) Graft versus host reaction (GvHD)

Graft Versus Host Disease (GVHD) is a response that occurs when specific lymphocytes in the graft recognize host antigens. The conditions for this are the inclusion of T lymphocytes in the graft and the disagreement of the graft with the host's major histocompatibility antigens. In bone marrow transplantation, GvHD is a major obstacle, causing multiple organ failure by killing cells in the host, which leads to other complications. Among the universal CAR-T cell therapies, GvHD is one of the most desirable problems to avoid, otherwise the host has serious side effects. TCR is a main gene of T lymphocyte recognition target cells, and TCR gene knockout can avoid the attack of allogeneic T cells on host cells, so that the TCR gene knockout of the allogeneic transplanted universal CAR-T cells can avoid GvHD.

CAR gene transduction

The preparation of CAR-T cells can be divided into the following steps: t cell isolation, T cell activation, CAR gene transduction, CAR-T cell expansion, CAR-T cell harvest. Wherein CAR gene transduction is central to the overall manufacturing process. In recent years, a number of CAR transduction approaches have been developed:

1) lentivirus or retrovirus

Lentiviruses or retroviruses can be used to transfect DNA of interest of 3000 bases or less, with the advantages of: a. the infection efficiency is high, and the positive rate after transfection can reach about 50 percent at most; b. the virus is secreted into the culture medium more, and small-scale concentration and purification are relatively easy; c.T the lymphocyte can maintain a good cell state after being infected by virus, and the survival and the expansion are not easy to be influenced, which is beneficial to the subsequent transfusion to patients. The disadvantages are that: a. random insertion into the cell genome is liable to result in exhaustion of the generated CAR-T cells and potential risk of canceration; b. after T cell infection, the residual virus is strongly immunogenic; c. the large-scale preparation of the virus is complicated and the cost is high.

2) Transposon

The transposon transduction mode has the advantages of simple production process flow and no risk of virus residue. However, since the vector encoding the transposon is plasmid DNA, it has a cytotoxic effect after electroporation into T cells, which is not conducive to the expansion of the resulting CAR-T cells. Likewise, transposon-mediated random insertion of CAR genes into the T cell genome is also prone to the resulting CAR-T cell depletion and potential risk of cancer.

3)mRNA

Transduction of T cells with mRNA encoded CAR genes relies on electroporation, which has the advantage of only transiently expressing the protein of interest in T cells (approximately 7 days of expression), and this approach allows relatively safe human experimentation for CAR-T cells that were previously uncertain for the presence of serious side effects. However, the disadvantage is also apparent, namely the inability to express persistently, with a relatively limited duration of action.

CRISPR-Cas9 technology

CRISPR (Clusters of Regularly interleaved Short Palindromic repeats) technology, a double-stranded DNA endonuclease tool mediated by RNA sequences, was commonly discovered in 2012 by scientists at the institute of technology, Massachusetts, and Burkholderia, Calif. Consists of two parts, one of which is sgRNA of about 100 bases for targeted recognition of a target double-stranded DNA, and the other part is Cas9 protein of 1369 amino acids, which can bind to sgRNA and has dnase activity. After the artificially designed sgRNA and the Cas9 protein form a complex, the target DNA can be specifically cut, and when the cutting causes mismatch repair, the gene is shifted to achieve the knockout purpose. When a repair DNA sequence is added, the targeted editing is performed. Since the CRISPR-Cas9 technology is available, the application of the CRISPR-Cas9 technology is available in a plurality of fields.

Large fragment gene knock-in technology

Although the gene knockout technology has been developed, the efficiency of gene knockout for large fragments has been low. The difference between knock-in and knock-out is whether a repair template is added. The process is as follows: after a nuclease (such as ZFN, TALEN, CRISPR-Cas9 and the like) cuts a specific DNA, a repair template repairs the damaged DNA according to the homologous recombination principle, and a specific DNA fragment is introduced into a specific site after the repair. The repair templates used at present mainly comprise plasmid DNA, double-stranded DNA, single-stranded DNA and adeno-associated virus vectors. For knocking in single or several bases, the several repair templates can achieve high efficiency, and for knocking in genes with more than 500 bases, only adeno-associated virus vectors have relatively highest efficiency at present, which can achieve about 40% of knocking-in efficiency, and the efficiency of knocking in genes with plasmid DNA, double-stranded DNA and single-stranded DNA as repair templates does not exceed 5%. And the preparation cost of the adeno-associated virus vector is high, the time spent is long, and the application of the adeno-associated virus vector in the preparation of CAR-T cells is not facilitated.

Gene knock-in technique using double-stranded DNA as template

The advantage of using double-stranded DNA as a repair template is that it can be obtained by a large number of PCRs, and is cheaper and more readily available than other repair templates. However, previous studies have demonstrated that the efficiency of long fragment knock-in using double-stranded DNA as a repair template is relatively low, reaching a maximum efficiency of about 5%.

Disclosure of Invention

Definition of

CAR-T (polymeric antigen receptor T cell): chimeric antigen receptor T cells.

CTLA-4(cytotoxic T-lymphocyte associated protein 4): the earliest approved immunodetection site inhibitor targets.

PD-1/PD-L1(programmed cell death 1/ligand of PD-1 protein): the two best known immunodetection point inhibitor targets.

Act (additive cell transfer): adoptive immunotherapy, which transfers lymphocytes of a donor to a recipient, enhancing its cellular immune function. Adoptive cellular immunity can be classified into two types, specific and non-specific, in which the former is to inject lymphocytes sensitized with known antigens into a receptor to obtain cellular immunity against the antigens, and the latter is to inject normal human lymphocytes not sensitized with specific antigens into a receptor to obtain cellular immunity against various antigens.

Crispr (clustered regulated short palindromic repeats): a bacterial immune system that has been modified by scientists in the year as the hottest gene editing tool.

ZFN: a gene editing technology is an artificially synthesized restriction endonuclease, which is formed by fusing a zinc finger DNA binding domain and a DNA cutting domain of the restriction endonuclease, and researchers can modify the zinc finger DNA binding domain of a ZFN through processing and target to different DNA sequences, so that the ZFN can be combined with a target sequence in a complex genome and is subjected to specific cutting by the DNA cutting domain.

TALEN: a typical TALEN consists of an N-terminal structural domain containing a nuclear localization signal, a central structural domain containing a typical tandem TALE repetitive sequence capable of recognizing a specific DNA sequence and a C-terminal structural domain with the function of a FokI endonuclease, can be combined with a target sequence in a complex genome and is specifically cut by a DNA cutting domain.

ARCUS: a gene editing technology has the advantages that the nuclease used has a small structure and is easy to deliver in vivo.

megaTAL: a gene editing technology, which combines the DNA binding domains of homing endonuclease and transcription activator-like effector, can combine the target sequence in complex genome and perform specific cutting by DNA cutting domain.

dsDNA: double-stranded DNA.

RNP: abbreviation of complex formed by Cas9 protein and sgRNA.

mRNA: messenger RNA, a single-stranded ribonucleic acid that is transcribed from a DNA strand as a template and carries genetic information that directs protein synthesis. After mRNA is produced through transcription with cell gene as template and based on the base complementary pairing principle, the mRNA has base sequence corresponding to some functional segment in DNA molecule as the direct template for protein biosynthesis.

AAV: adeno-associated virus vector, a highly efficient and safe gene delivery tool, has been used in gene therapy in recent years, and can also be used as a repair template for large-fragment gene knock-in.

TCR-T: an adoptive cell therapy technique for treating multiple refractory tumors by transducing natural or optimized TCR genes from laboratory screens into T cells, and expanding the cells in vitro for culture and subsequent reinfusion into patients.

sgRNA: an RNA artificially invented in CRISPR application, which fuses crRNA and tracrRNA, can bind Cas9 protein and target DNA.

PolyA: the poly (A) structure, which is a post-transcriptional modification of mRNA, helps to stabilize mRNA and improve translation efficiency.

The present invention relates to a method of making a double-knock-in universal CAR-T cell, the method comprising:

delivering a gene-editing substance to a T cell to knock out the B2M gene and the TRAC gene; and

the repair template vector was delivered to T cells to knock the CAR gene and B2M-HLA-E gene into the TRAC site.

The gene editing method used to deliver the gene-editing substance to the T cell can be ZFN, TALEN, CRISPR-Cas9, megaTAL, etc., preferably CRISPR-Cas 9. The gene-editing material may be a plasmid, lentivirus, retrovirus, adeno-associated virus, mRNA or RNA protein complex, preferably mRNA. The delivery of the gene-editing substance may use a transfection method such as liposome, calcium phosphate, DEAE-dextran, electroporation, microinjection, gene gun, etc., and electroporation transfection is preferable.

In some embodiments, the CRISPR-Cas9 gene editing material comprises Cas9 mRNA or Cas9 protein and sgrnas.

First, a knock-in genomic site is identified, and a sgRNA is designed using a DNA sequence around the site. The principle of design is that the PAM region sequence is NGG, wherein N is any one of A, T, C and G. The sgRNA includes a targeted crRNA sequence and a tracrRNA sequence, where the crRNA can be 17, 18, 19, 20, 21, or 22 bases.

In some embodiments, the sgRNA is unmodified or chemically modified. Chemical modifications include 2-O-methylation, 3-thio, 2-O-methylation combined with 3-thio, and the like. In some embodiments, the 3 bases from the 5 'and 3' ends are simultaneously 2-O-methylated and 3-thio modified. Chemical modifications can occur at 1 to 10 bases at the 5 'and 3' ends of the sgrnas. The designed sgRNA can be obtained by T7 in vitro transcription, and can also be directly synthesized in vitro.

In some embodiments, the sgRNA sequences targeting the TRAC and B2M genes are shown in SEQ ID NOs 55 and 56, respectively.

Cas9 can be SpCas9, SaCas9, SpCas9-HF, eSpCas9, xCas9, cpf1 or Cas9 of other different genera, preferably SpCas 9. In some embodiments, the amino acid sequence of SpCas9 is shown as SEQ ID No. 57. The Cas9 protein may be coupled at the N-terminus or C-terminus with one or more NLS nuclear signal peptides. Cas9 mRNA can be obtained by in vitro transcription.

In some embodiments, transfection (electrotransformation) is performed using a mixture of mRNA encoding Cas9 protein and sgRNA. Cas9 protein can also be used instead of Cas9 mRNA. The Cas9 protein can be obtained by expression and purification of bacteria or eukaryotic expression cells. In some embodiments, electrotransfer is performed using an RNP complex formed by the Cas9 protein and the sgRNA. RNP complexes can be obtained by incubating the Cas9 protein and sgRNA directly in mixture, or by mixing both in a specific buffer (such as an electrotransfer buffer).

In the present invention, adeno-associated virus and non-viral vectors are used as targeting vectors for delivery of site-directed knock-in template DNA. The template DNA comprises a left homologous arm DNA, a knocked-in exogenous DNA and a right homologous arm DNA.

The left homology arm of the template DNA is homologous with the 5 'end sequence of the DNA cut, and the right homology arm is homologous with the 3' end sequence of the DNA cut. In some embodiments, the left homology arm 3 'end DNA sequence is identical to the 5' end sequence 0 to 300 bases from the nicked DNA, and the fragment length is 10 to 2000 bp; the DNA sequence at the 5 'end of the right homologous arm is consistent with the 3' end sequence which is 0 to 300 bases away from the nicked DNA, and the length of the fragment is 10 to 2000 bp. In some embodiments, the left and right homology arm fragments may be alternatively 300, 600 or 1000 bases in length, preferably 300 bases. In some embodiments, the DNA of the left and right homology arms are shown in SEQ ID NO 1 and SEQ ID NO 2, respectively, when the genomic site of the TRAC is knocked in. In some embodiments, when knock-in is performed at the genomic site of B2M, the left and right homology arm DNAs are as set forth in SEQ ID NOs: 7 and SEQ ID NO: 8.

In some embodiments, the CAR and B2M-HLA-E genes are separated by a cleavage peptide.

When the foreign gene is knocked into the TRAC genomic locus, the transcription of the endogenous TCR-alpha gene promoter can be relied on, and the transcription of the foreign promoter can also be relied on. When the TRAC site is knocked in and the TCR-alpha promoter is relied upon, the knock-in gene comprises: cleavage peptide, CAR gene, cleavage peptide, B ² M-HLA-E gene and Poly A. When the TRAC site is knocked in and is dependent on an exogenous promoter, the knock-in gene comprises: exogenous promoter, CAR gene, splicing peptide, B2M-HLA-E gene, and Poly A. In some embodiments, the exogenous promoter is EF1, preferably the DNA sequence of which is shown in SEQ ID NO 26.

When the B2M site is knocked in and the B2M gene promoter is relied upon, the knock-in gene comprises: B2M-HLA-E gene, splicing peptide, CAR gene, and Poly a;

the cleavage peptide may be P2A, T2A, or the like. In some embodiments, the cleavage peptide is P2A having an amino acid sequence set forth in SEQ ID NO 25.

The polyA of the knocked-in foreign DNA may be any polyA gene, preferably minipoly A or bGHpA polyA. In some embodiments, the DNA sequences of miniPolyA and bGHpA polyA are shown in SEQ ID NO 27 and SEQ ID NO 28, respectively.

The antigen target against which the CAR gene is directed may be: CD19, CD22, CD20, CD7, CD5, CD4, CD123, CD30, CD33, CD70, CD38, CD138, BCMA, SLAMF7, PSMA, HER2, HER3, B7-H3, Mesothelin, CS1, MUC16, GD2, GUCY2C, ROR1, GPC3, FAP, FOLR1, CEA, CD138, CD56, CD147, EpCAM, CAIX, EGFR, Claudin 18.2, Claudin 6, CLL-1, GPRC5D, Nectin-4, EGFRVIRII, LewisY, DLL3, uPAR, MG7, and IL13R alpha 2. The antigen target can also be MHC presented polypeptide complex, such as NY-ESO-1 presented by HLA-A2, and the antigen target recognizing the class is TCR similar antibody scFv.

The CAR gene can be of a second generation or third generation structure, containing one costimulatory factor if the second generation CAR structure, and two costimulatory factors if the third generation CAR structure. In some embodiments, the CAR gene comprises a signal peptide, an antigen binding region, a hinge region, a transmembrane region, one or two co-stimulatory factors, and an activation region.

The signal peptide in the CAR gene is selected from signal peptide domains such as CD8, IL-2, GM-CSF, etc., preferably CD8 signal peptide domain. In some embodiments, the amino acid sequence of the CD8 signal peptide domain is set forth in SEQ ID NO 31

The antigen binding region in the CAR gene may be an antibody scFv, or may be a corresponding ligand. In some embodiments, the antigen binding region is the scFv of the CD19 antibody, the amino acid sequence of which is set forth in SEQ ID NO. 29.

The hinge region in the CAR gene may be a hinge domain of IgG1, IgG4, IgD, CD8, etc., preferably a CD8 hinge domain. In some embodiments, the amino acid sequence of the hinge domain of CD8 is set forth in SEQ ID NO 32

The transmembrane region in the CAR gene may be a transmembrane domain of CD3, CD4, CD5, CD8, CD9, CD16, CD22, CD27, CD28, CD33, CD37, CD45, CD64, CD80, CD86, CD134, CD137, CD152, CD154, PD1, preferably a CD8 transmembrane domain. In some embodiments, the amino acid sequence of the transmembrane domain of CD8 is set forth in SEQ ID NO:33,

the costimulatory structure in the CAR gene can be a costimulatory domain such as CD2, CD7, CD27, CD28, CD30, CD40, CD54, CD83, CD134, CD137, CD150, CD152, CD223, CD270, CD273, CD274, CD278, CARD11, NKD2C, DAP10, LAT, SLP76, ZAP70, 4-1BB, preferably a 4-1BB costimulatory domain. In some embodiments, the amino acid sequence of the 4-1BB co-stimulatory domain is shown as SEQ ID NO 34.

The activation structure may be a CD3 ζ activation domain. In some embodiments, the amino acid sequence of the CD3 zeta activation domain is set forth in SEQ ID NO 35.

The B2M-HLA-E fusion gene of the present invention has two forms, the first form (B2M-HLA-E structure 1) comprises from 5 'end to 3' end: B2M signal region DNA, presentation polypeptide DNA, connector DNA, B2M non-signal region DNA, connector DNA and HLA-E gene; the second form (B2M-HLA-E Structure 2) comprises, from the 5 'end to the 3' end: B2M signal region DNA, B2M non-signal region DNA, connector DNA and HLA-E gene.

In some embodiments, the amino acid sequence of the B2M signal region DNA is set forth in SEQ ID NO. 58. In some embodiments, the amino acid sequence of the B2M non-signal region DNA is set forth in SEQ ID NO. 59.

In some embodiments, the polypeptide presented comprises VN2APRTN7N8L, N2 is an amino acid other than threonine, N7 is valine or leucine, N8 is valine, leucine or isoleucine. In some embodiments, the amino acid sequence of the presented polypeptide is shown in SEQ ID NO 60.

In some embodiments, the amino acid sequence of the linker DNA is as set forth in SEQ ID NO 61 or 62.

In some embodiments, the HLA-E gene comprises the form: HLA-E0101, HLA-E0102, HLA-E0103, and HLA-E0104, preferably HLA-E0103. In some embodiments, the amino acid sequence of the HLA-E gene is shown as SEQ ID NO 63.

In some embodiments, the amino acid sequence of B2M-HLA-E structure 1 is shown in SEQ ID NO. 30 and the amino acid sequence of B2M-HLA-E structure 2 is shown in SEQ ID NO. 64.

In some embodiments, when the TRAC site is knocked in and the TCR-alpha promoter is relied upon, the repair template DNA is as set forth in SEQ ID NO: 39;

in some embodiments, when the TRAC site is knocked in and is dependent on the exogenous promoter EF1, the repair template DNA is as set forth in SEQ ID NO. 45;

in some embodiments, when the B2M site is knocked in and the B2M gene promoter is relied upon, the repair template DNA is shown in SEQ ID No. 52.

In the present invention, an adeno-associated virus vector can be used as a repair template vector. And cloning the targeted template DNA into an adeno-associated virus vector, and packaging into a recombinant adeno-associated virus (rAAV) virus. The virus may be packaged by 293T cells or SF9 expression systems. The rAAV serotype may be any such as AAV1-AAV9, AAV-DJ, AAV-Retro, etc., preferably AAV 6. The rAAV can be purified by ultracentrifugation, affinity chromatography, or the like. In some embodiments, the amount of adeno-associated virus added within zero to twelve hours after delivery of the gene-editing substance (e.g., electroporation) can be a thousand to one million times the titer of the corresponding cell.

In some embodiments, when the repair template vector is an adeno-associated viral vector, the method comprises the steps of: in vitro mixing Cas9 protein-encoding mRNA with targeted sgrnas to form a mixture and transfecting (preferably electrically transducing) into a T cell; cloning the repair template DNA into plasmid and packing into adeno-associated virus vector; adeno-associated viral vectors are added within 0 to 12 hours after RNA transfection (preferably electroporation).

In the present invention, a non-viral vector can be used as a repair template vector. Compared with the method using adeno-associated virus, the process is simpler, and all gene editing steps can be completed by only one electric conversion in the whole preparation process. Non-viral vectors were designed and prepared as follows:

ligation of template DNA to plasmid vector: the template DNA comprises left homology arm DNA, knock-in DNA and right homology arm DNA, wherein the left homology arm is homologous with a DNA nicking 5 'end sequence, and the right homology arm is homologous with a DNA nicking 3' end sequence. The 3 'end DNA sequence of the left homologous arm is consistent with the 5' end sequence which is 0 to 300 bases away from the nicked DNA, and the length of the fragment is 10 to 5000 bp. The DNA sequence at the 5 'end of the right homologous arm is consistent with the 3' end sequence which is 0 to 300 bases away from the nicked DNA, and the length of the fragment is 100 to 5000 bp. The template DNA is cloned and ligated into a plasmid vector, which may be any one, such as pUC57, pCDNA3.1, pCMV, etc., and the ligation position may be flexible. Or can be directly subjected to the subsequent step without being ligated to a plasmid vector.

PCR amplification with modified primers: PCR amplification is carried out by using two modified primers of 5' -phosphorothioate combined 5' -Biotin-TEG or 5' -locked nucleic acid, and 5' -phosphorothioate combined 5' -Biotin-TEG or 5' -locked nucleic acid modification can be carried out by 1 to 15 basic groups at the 5' ends of the upstream and downstream primers. Preferably, the specific primer modifications for 5 '-phosphorothioate-conjugated 5' -Biotin-TEG are: the first base at the 5' end of the upstream and downstream primers is subjected to Biotin-TEG modification, and phosphorothioate modification is performed among

bases

2, 3,4, 5 and 6. The specific primer modification of the preferred 5 '-locked nucleic acid is to perform the nucleic acid locking modification on the 1 st, 2 nd and 3 rd bases at the 5' end of the upstream and downstream primers. The modified primer may be 15 to 100 bases in length. The reagent used for PCR amplification may be a kit product of any one of the companies. The PCR amplification instrument or related equipment used for PCR amplification can also be any manufacturer.

Purification of modified template DNA: after PCR amplification, the modified template DNA can be purified and concentrated by adopting the following methods respectively or jointly: DNA purification kit purification of each reagent company, purification of various DNA binding magnetic beads, gel chromatography, ion chromatography, affinity chromatography, ultrafiltration tube ultrafiltration, dialysis membrane dialysis, and the like.

The non-viral vector prepared as described above is mixed with a gene editing substance (e.g., RNP complex) for a time period of zero to 20 minutes. The amount of non-viral vector is determined by the number of cells. Transfection methods such as liposome, calcium phosphate, DEAE-dextran, electroporation, microinjection, gene gun, etc., can be used, and the electroporation method is preferred. After transfection, the gene editing material cleaves the genomic DNA to nick it into a broken double-stranded DNA, at which time the modified template DNA undergoes homologous recombination with the broken nicked DNA as donor DNA, and the knocked-in DNA is successfully integrated into the desired genomic site.

In some embodiments, when the repair template vector is a non-viral vector, the method comprises the steps of: mixing a Cas9 protein with a targeted sgRNA in vitro to form an RNP complex, or a Cas9 protein-encoding mRNA with a targeted sgRNA in vitro to form a mixture; performing PCR amplification of the repair template DNA using a modified primer to obtain a modified double-stranded DNA, wherein the modified primer comprises: i)5 '-Phosphorothioate (PS) modification together with 5' -Biotin-triethylene glycol (Biotin-TEG) modification; or ii) a 5' -Locked Nucleic Acid (LNA) modification; (iii) transfecting (preferably electrically transferring) the RNP complex or the mixture with the modified double stranded DNA into a T cell.

The method of the invention also comprises the steps of cell activation, amplification, purification, cryopreservation and the like.

In particular, human blood collection may be a venous blood draw or a mononuclear cell apheresis. The PBMC can be separated from human blood by using lymphocyte separating liquid matched with a common centrifuge tube, a sepmate tube or other hardware equipment. Alternatively, the T lymphocytes may be isolated and purified or not isolated. If T lymphocytes need to be separated and purified, kits of various manufacturers can be adopted, and various negative selection and positive selection methods can be adopted. T cell activation can be achieved by the following methods: activation by anti-CD3 antibody coating alone, anti-CD3 antibody/anti-CD 28 antibody coating, direct addition of anti-CD3 antibody alone, direct addition of anti-CD3 antibody/anti-CD 28 antibody, anti-CD3 antibody/anti-CD 28 antibody magnetic beads, and the like. The activation time may be 1 to 8 days, preferably 2 to 3 days, and if the activation is performed by using antibody magnetic beads, magnetic poles are used to remove the magnetic beads before the electrotransfer.

The culture of T cells adopts 1640 culture medium + 10% serum or other serum-free culture medium specially used for T cell culture, the serum-free culture medium contains human serum albumin, transferrin, insulin and other important additive components, and some validated serum-free culture media such as X-VIVO-15 and ImmunoCult can be selected ^TM XF, OpTsizer medium, etc. Can be placed in a bioreactor (such as a culture flask, a culture dish, a G-rex or a culture bag for culture. In the culture process, certain concentration of cytokine such as IL-2, IL-7, IL-15, etc. is added. Can be added in the T cell culture processAdding magnetic beads or irradiated feeder cells (such as K562-CD19) to activate and amplify the cells for greater amplification. The total time for the T cell culture may be ten to twenty days, preferably ten to fifteen days.

Enrichment and purification of TCR negative cells: TCR positive cells can cause severe GvHD effects during allogeneic reinfusion, and to eliminate this effect, the TCR positive cells must be completely removed prior to reinfusion of the cells. The method used may be magnetic bead sorting for TCR negative selection or CD3 negative selection.

Cryopreserving universal CAR-T cells; and (3) freezing and storing the cultured CAR-T cells according to a certain cell concentration, wherein the used freezing and storing liquid can be GMP or non-GMP grade products provided in the market, and can be placed in a special freezing and storing bag or a freezing and storing tube for freezing and storing. After being subjected to gradient cooling by special equipment, the mixture is placed in a refrigerator with eighty degrees or a liquid nitrogen tank for storage. The following assay can be performed prior to CAR-T cell cryopreservation: sterility test, mycoplasma test, endotoxin test, CAR positive proportion, CD4/CD8 proportion, memory T cell proportion, effector T cell proportion, killing effect on target cells, cytokine amount released after killing, anti-tumor effect in mice, off-target effect generated by CAR gene knock-in, etc.

The invention also relates to universal CAR-T cells prepared by the method, which are useful for treating diseases.

The invention also relates to the use of the universal CAR-T cells prepared by said method for the preparation of a medicament for the treatment of a disease.

Specifically, the diseases include various leukemias (acute B lymphocytic leukemia, acute T lymphocytic leukemia, NK lymphocytic leukemia, various non-hodgkin lymphomas, chronic lymphocytic leukemia, acute myeloid leukemia, multiple myeloma, etc.), various solid tumors (lung cancer, liver cancer, stomach cancer, breast cancer, colorectal cancer, prostate cancer, pancreatic cancer, brain glioma, esophageal cancer, bile duct cancer, endometrial cancer, ovarian cancer, mesothelioma, thymus cancer, etc.), aids, autoimmune diseases, and various diseases accessible to CAR-T cell therapy.

In the methods of the invention, the TRAC gene knockout may avoid GvHD responses, requiring removal of T cell surface TCR-CD3 complex proteins. This may be achieved by targeting the TRAC, TRBC or CD3z, CD3e etc genes, preferably the TRAC gene. The B2M gene knockout can completely inhibit the expression of HLA-I molecules on cell membranes, is beneficial to suppressing T cell rejection reaction, but simultaneously, NK rejection reaction can be obviously enhanced. In the case of knocking-in the B2M-HLA-E gene, the activity of NKG2A positive NK cells can be inhibited by forming a dimer between HLA-E and B2M protein on the cell membrane surface under physiological conditions, but the endogenous B2M gene is knocked out, and the expression on the cell membrane surface cannot be realized because only the HLA-E gene is transduced and the dimer between B2M cannot be formed. The transduced B2M-HLA-E fusion gene can express the HLA-E gene when endogenous B2M gene is knocked out, so that the rejection of NKG2A positive NK cells is inhibited, and NKG2A positive NK cells account for about 70% of total NK cells, so that the rejection reaction of NK cells can be inhibited by about 70% by knocking in the B2M-HLA-E gene.

In the present invention, the CAR and the B2M-HLA-E gene are knocked into the TRAC site simultaneously. The CAR and the B2M-HLA-E gene are integrated to a TRAC genomic locus at fixed points, so that the random insertion probability of the CAR gene is greatly reduced, the canceration of CAR-T cells is avoided, and CAR gene transduction and TRAC gene knockout are completed in one step. In previous studies CAR and B2M-HLA-E genes were transduced to TRAC and B2M genomic sites, respectively (two site-directed integrations were required). Compared with the prior art, the method is simpler and more efficient, and two genes can be simultaneously introduced only by one-time fixed-point integration.

The antigen target against which the CAR gene is directed may be: CD19, CD22, CD20, CD7, CD5, CD4, CD123, CD30, CD33, CD70, CD38, CD138, BCMA, SLAMF7, PSMA, HER2, HER3, B7-H3, Mesothelin, CS1, MUC16, GD2, GUCY2C, ROR1, GPC3, FAP, FOLR1, CEA, CD138, CD56, CD147, EpCAM, CAIX, EGFR, Claudin 18.2, Claudin 6, CLL-1, GPRC5D, Nectin-4, EGFRVIIII, Lewis Y, DLL3, uPAR, MG7, IL13R alpha 2 and the like single target, double target or multiple target. The antigen target can also be MHC presented polypeptide complex, such as NY-ESO-1 presented by HLA-A2, and the antigen target recognizing the class is TCR similar antibody scFv.

The CAR gene mentioned above may also be a transgene of other T cell therapies, such as artificially screened TCR genes or transduction genes of other novel T cell therapies, and the corresponding obtained cells are universal TCR-T cells or other universal T cells. The invention only uses CAR-T cell technology as an introduction to illustrate the advantages of the universal T cell platform, and does not mean that the platform technology is only suitable for preparing universal CAR-T cells.

The CAR and B2M-HLA-E genes are integrated to a TRAC genomic locus in a fixed point manner by adopting a gene editing technology, and the TRAC and B2M genes are knocked out simultaneously, wherein the targeting vector can be an adeno-associated virus or a non-viral vector. The prepared universal CAR-T cell can completely avoid GvHD effect, simultaneously inhibit rejection reaction of T and NK cells, improve survival time of cells in a host body after foreign body reinfusion to play a role, and simultaneously the method for preparing the universal CAR-T cell is simple, convenient and efficient, and can realize multi-gene knock-in and knock-out in one step.

Drawings

FIG. 1 is a schematic diagram showing the effect of a double-knock-in universal CAR-T cell. .

Figure 2 is a schematic diagram of universal CAR-T cell gene engineering.

FIG. 3 is a schematic diagram showing the structure of B2M-HLA-E, which is one of the knock-in double genes.

Figure 4 is a schematic of the structure of a CAR that is one of the knock-in double genes.

FIG. 5 is a flow chart for preparing site-directed integration universal CAR-T cells using adeno-associated viral vectors.

FIG. 6 is a flow chart for preparing the site-directed integration universal CAR-T cells using non-viral vectors.

Fig. 7 is a schematic of 2-O-methylation-binding 3-thio modification of sgrnas.

FIGS. 8a-c are respectively plasmid vectors pAAV-MCS _、 Maps of pHelper and pAAV-RC 6.

Fig. 9 shows the streaming detection result of example 3.

Fig. 10 shows the streaming detection result of example 4.

FIGS. 11a-b show the cell identification results and the killing effect test results of example 5, respectively.

Figure 12 shows the mouse survival curve of example 6.

FIG. 13 shows the alignment results of example 7.

Fig. 14 shows the streaming detection result of example 8.

FIGS. 15a-c show the results of the flow assay of example 9.

FIGS. 16a-b show schematic diagrams of the protocol and the streaming results of example 10, respectively.

FIGS. 17a-b show schematic diagrams of the protocol and streaming results of example 11.

Fig. 18 shows the flow detection results of example 12.

Fig. 19 shows the streaming detection result of example 13.

FIG. 20 shows the cell count results of example 14.

Detailed Description

Example 1: sgRNA design and Synthesis

The sgrnas used were synthesized in vitro (sgRNA synthesis service provided by jinsler of Nanjing), and were chemically modified sgrnas, 3 '-thio-and 2' -O-methylated at each of 3 bases at the 5 'and 3' ends, as shown in FIG. 7, so that the sgrnas were more stable and were not easily degraded by nucleases after transduction into cells. After chemically synthesizing the corresponding sgrnas, HLPC is used for purification, and the chemically synthesized sgrnas used in the present invention have the following sequences:

example 2: molecular design of repair template DNA

The genetic modification scheme for preparing the universal CAR-T cell comprises the steps of firstly generating DNA cuts on TRAC and B2M genomic sites by utilizing an engineered CRISPR-Cas9, further performing homologous recombination repair on the DNA cuts by utilizing a repair template (adeno-associated virus or modified double-stranded DNA is adopted in the invention), finally knocking the CAR and B2M-HLA-E genes into the TRAC genomic sites, knocking out the TRAC and B2M genes (corresponding to TCR-alpha/beta and HLA class I gene expression loss), simultaneously introducing the CAR and B2M-HLA-E genes in a fixed point manner, and performing transcription expression by utilizing a TCR-alpha gene promoter. In addition, to demonstrate the superiority of this protocol, we will compare in the examples other universal CAR-T cell gene engineering protocols, including: (1) CAR and B2M-HLA-E gene knock-ins into different TRAC genomic sites; (2) CAR gene knock-in TRAC genomic site only, (3) CAR and B2M-HLA-E genes knock-in TRAC and B2M genomic sites, respectively; (4) CAR and B2M-HLA-E gene knock-in at the B2M genomic site; (5) achieving knock-in of CAR and B2M-HLA-E genes into the TRAC genomic site without gene editing but with adeno-associated viral vectors only; (6) CAR and HLA-E gene knock-in to TRAC genomic site; (7) CAR and B2M-HLA-E genes are transcribed upon knock-in to the TRAC genomic locus in dependence on a foreign promoter; (8) TRAC and B2M genes were knocked out after lentiviral transduction of CAR and B2M-HLA-E genes. To better assess cell function and compare the above protocols, the CAR gene is currently the more mature targeted CD19CAR gene. The site-directed integration repair template DNA used for the universal CAR-T cell gene modification comprises two parts:

a. left and right homology arms. The left and right homology arms are used to identify the DNA of interest and to perform a recombination crossover, the knock-in gene is "landed" in the 5' end region of exon 1 of the TRAC gene in order to allow correct expression of the knock-in gene. According to the length of a base sequence, homologous arms of 300 bases, 600 bases and 1000 bases are respectively designed, the sequences are shown as SEQ ID NO 1-6, and the specific table is as follows:

in addition, homology arms were designed that knock-in the B2M genomic locus, as shown in the table below:

sequence name	Sequence numbering
		300 bases left homology arm	SEQ ID NO:7
300 base right homology arm	SEQ ID NO:8
		600 base left homology arm	SEQ ID NO:9
600 base right homologous arm	SEQ ID NO:10
		1000 base left homology arm	SEQ ID NO:11
1000 base right homology arm	SEQ ID NO:12

Design homology arms for the comparative Targeting a CAR to the TRAC locus with CRISPR/Cas9enhance project knocking into the TRAC genomic site are shown in the following table:

sequence name	Sequence numbering
		300 base left homology arm	SEQ ID NO:13
300 bases right homology arm	SEQ ID NO:14
		600 base left homology arm	SEQ ID NO:15
600 bases right homology arm	SEQ ID NO:16
		1000 base left homology arm	SEQ ID NO:17
1000 base right homology arm	SEQ ID NO:18

sequence name	Sequence numbering
		300 base left homology arm	SEQ ID NO:19
300 bases right homology arm	SEQ ID NO:20
		600 base left homology arm	SEQ ID NO:21
600 bases right homology arm	SEQ ID NO:22
		1000 base left homology arm	SEQ ID NO:23
1000 bases right homology arm	SEQ ID NO:24

b. A knock-in gene. When the gene of interest knocks into the TRAC genomic DNA, when the TCR-alpha promoter is relied upon, the knocked-in gene comprises a splicing peptide, an expression gene and a polyA gene; depending on the exogenous promoter group, the knocked-in genes include an exogenous promoter, an expression gene, and a polyA gene. When the target gene is knocked in the genomic DNA of B2M, the knocked-in target gene comprises an expressed gene and a polyA gene depending on the transcription of the promoter of the B2M gene. The cleavage peptide adopted in the embodiment of the invention is P2A, and the exogenous promoter adopted in the embodiment of the invention is EF 1. The expression genes of the present protocol are targeted to CD19CAR and B2M-HLA-E genes, and the expression genes of other comparative protocols include: the CD 19-targeted CAR monogene and the CD 19-targeted CAR combined with HLA-E double gene, the CD 19-targeted CAR gene adopts a secondary structure, and the detailed structure comprises a CD 19-targeted scFv, a CD8 hinge region, a CD8 transmembrane region, a 4-1BB costimulatory region and a CD3 zeta activation region. PolyA adopts bGHpA polyA or mini polyA, and the structural sequences of the genes are as follows:

example 3: preparation of CD 19-targeted universal CAR-T cells using adeno-associated viral vectors

1) Molecular cloning

The repair template DNA of SEQ ID NO:39 is cloned into a pAAV-MCS plasmid vector (the map is shown in figure 8 a) after enzyme digestion. The process comprises the following steps:

a. preparing a target fragment by PCR, namely preparing a PCR reaction system:

b. and (3) placing the PCR reaction system in a PCR amplification instrument, and amplifying according to the following conditions:

c. the vector was digested in a 37 ℃ water bath for two hours in the following reaction system:

reagent	Amount of use (mul)
		10×Cusmart Buffer	5
pAAV-MCS plasmid and PCR fragment	2μg
		Not1-HF enzyme (from NEB Corp.)	0.5
Sterilized water	Make up to 50 μ l
		Total volume	50

d. The target gene and the linearized vector are subjected to a ligation reaction according to a certain molar ratio, and the reaction system is as follows after the reaction is carried out for one hour at room temperature:

reagent	Amount of use (mul)
		The pAAV-MCS plasmid has been digested	2
Digested PCR fragment	3
		2 × Ligation Mix (from Takara Co., Ltd.)	5
Total volume	10

e. And (3) conversion coating of reaction products: thawing a tube of 100. mu.l Stbl3 competent cells on ice, flicking the tube wall to resuspend the cells, adding 10. mu.l ligation reaction solution to the competent cells, and ice-cooling for 30 min under flicking; quickly putting the mixture on ice for 5 minutes after heat shock is carried out for 90 seconds in a water bath kettle at 42 ℃; adding 500 mul LB liquid culture medium, and incubating for 45-60 minutes at 37 ℃ in a shaking table; the cells were collected by centrifugation at 5000rpm for 3 minutes, 300. mu.l of the supernatant was discarded, and the remaining cell amount was applied to a plate containing ampicillin and incubated overnight in an incubator at 37 ℃.

f. The single clone was picked and plasmid extraction was performed. Column equilibration step: adding 500 μ l of equilibrium liquid BL into adsorption column CP3, centrifuging at 12,000rpm (13,400 Xg) for 1 min, discarding the waste liquid in the collection tube, and replacing the adsorption column in the collection tube; 5ml of overnight-cultured bacterial liquid is taken and added into a centrifuge tube, a conventional desktop centrifuge is used for centrifuging for 1 minute at 12,000rpm (13,400 Xg), and the supernatant is removed as much as possible by suction; adding 250 mu l of the solution P1 into the centrifuge tube with the bacterial sediment, and completely suspending the bacterial sediment by using a pipette or a vortex oscillator; adding 250 mu l of solution P2 into a centrifuge tube, and gently turning the centrifuge tube up and down for 6-8 times to fully crack the thalli; adding 350 mu l of solution P3 into a centrifuge tube, immediately and gently turning up and down for 6-8 times, and fully mixing uniformly, wherein white flocculent precipitates appear; centrifugation at 12,000rpm (13,400 Xg) for 10 minutes; transferring the supernatant collected in the previous step into an adsorption column CP3 (the adsorption column is placed into a collection tube) by using a pipette; centrifuging at 12,000rpm (13,400 Xg) for 30-60 s, removing waste liquid from the collecting tube, and placing adsorption column CP3 into the collecting tube; adding 500 μ l deproteinized solution PD into adsorption column CP3, centrifuging at 12,000rpm (13,400 × g) for 30-60 s, discarding the waste liquid in the collection tube, and replacing adsorption column CP3 in the collection tube; adding 600 μ l of rinsing liquid PW into adsorption column CP3, centrifuging at 12,000rpm (13,400 × g) for 30-60 s, pouring off waste liquid in the collection tube, and placing adsorption column CP3 into the collection tube; repeating the previous step; the adsorption column CP3 was placed in a collection tube and centrifuged at 12,000rpm (13,400 Xg) for 2 minutes in order to remove the residual rinse from the adsorption column; the adsorption column CP3 was placed in a clean centrifuge tube, 50-100. mu.l of elution buffer EB was dropped onto the middle portion of the adsorption membrane, and the solution was left at room temperature for 2 minutes and centrifuged at 12,000rpm (13,400 Xg) for 2 minutes to collect the plasmid solution in the centrifuge tube. The resulting solution was re-loaded into the adsorption column, left at room temperature for 2 minutes, centrifuged at 12,000rpm (13,400 Xg) for 2 minutes, and the plasmid solution was collected in a centrifuge tube.

g. After confirmation of sequencing, the vector was named pAAV-0039.

2) Preparation and purification of adeno-associated virus vector

a. Packaging: 293T cells (purchased from ATCC) at 225cm one day before transfection ² Culturing in culture dish to 95% density, subculturing at a ratio of 1:3, culturing in single culture dish with culture medium of 20ml, and packaging single adeno-associated virus into five 225cm packages ² A culture dish. First, a transfection system (for one 225 cm) ² Petri dish) as follows:

after the transfection system was mixed well, it was left to stand for 10 minutes and carefully added to 293T cells. The fresh medium was changed after 6 hours. The medium and cells were harvested after 72 hours, respectively.

b. And (3) purification: centrifuging the culture medium by using a high-speed centrifuge for 2 hours at 50000g, removing the supernatant of the culture medium, adding 1ml of PBS buffer solution to resuspend the virus precipitate, and placing the virus precipitate in a 4-degree refrigerator for later use; resuspending the harvested 293T cells with 10ml PBS buffer solution, repeatedly freezing and thawing in liquid nitrogen and 37 ℃ water bath for 4 times, adding the standby supernatant virus, adding totipotent nuclease (purchased from Millipore company) for treating for 30 minutes at 37 ℃, centrifuging at 2000rpm for 30 minutes at 4 ℃ to remove cell debris, and taking the supernatant; iodixanol was formulated in different concentrations according to the following table, respectively: 60%, 40%, 25% and 15%; taking a 32ml PP ultracentrifuge tube (Beckman company), adding 5ml of 60% layer, 5ml of 40% layer, 5ml of 25% layer and 5ml of 15% layer by layer, and finally carefully adding the sample until the tube orifice is filled; ultracentrifugation at 70000rpm for 3 hours; after the centrifugation is finished, sucking about 5ml in a 40% and 60% interface layer by using an injector, adding 18ml of PBS buffer solution for dilution, centrifugally concentrating the virus by using a 100KDa ultrafiltration tube, discarding the centrifuged liquid, adding the PBS buffer solution again for centrifugation, repeatedly finishing the liquid change for several times, and finally obtaining the virus amount of about 5 ml; after the ultrafiltration, the filtrate was filtered using a 0.2 μm PVDF filter.

c. And (3) titer determination: mu.l of rAAV virus solution was used for titer detection, and in the first step, DNA digestion was used as follows (20-fold dilution of virus solution):

composition (I)	Content (c) of
		Virus liquid	1μl
Deionized water	17μl
		10×DNase buffer	2μl
DNase I (from NEB Corp.)	1μl

After being uniformly mixed, the mixture is placed in a 37 ℃ water bath kettle to react for 10 minutes, and then is placed in a 75 ℃ water bath kettle to react for 10 minutes to stop the reaction; in a second step, the adeno-associated virus envelope was digested with proteinase K (available from ThermoFisher) and the reaction was prepared as follows (further diluted 5-fold):

composition (A)	Content (wt.)
		First step reaction	20μl
Deionized water	79μl
		Proteinase K (20mg/ml)	1μl

After being uniformly mixed, the mixture is placed in a water bath kettle with the temperature of 55 ℃ for reaction for 30 minutes and then placed in a water bath kettle with the temperature of 95 ℃ for 10 minutes to terminate the reaction; thirdly, preparing a fluorescent quantitative PCR reaction system as follows:

wherein the primer sequences are respectively:

1F(10μM)	GGAACCCCTAGTGATGGAGTT
		1R(10μM)	CGGCCTCAGTGAGCGA

after mixing, the mixture was placed on a fluorescent quantitative PCR instrument (IT-TS) to carry out the following reaction:

after the reaction, the Ct value was obtained as follows:

sample name	Ct value
		Standard article
10 ⁸	10.809
		Standard article 10 ⁷	14.696
Standard article 10 ⁶	18.932
		Standard substance 10 ⁵	23.431
pAAV-0039	14.440

Finally, calculating the titer of the adeno-associated virus according to the Ct value result as follows:

pAAV-0039

1.25×10 ¹² vg/ml

3) CAR-T cell preparation

a. Mononuclear Cell (PBMC) extraction: healthy volunteers were recruited, who were free from symptoms of cold fever and infectious diseases (including hepatitis b, aids, etc.); 200ml of blood is collected from the median vein of the elbow of a person by professional medical staff and is connected to a BD anticoagulation tube; after the blood collection was completed, the blood was mixed with an equal amount of PBS buffer (containing 2% fetal bovine serum); taking separator Sepmate-50 (purchased from STEMCELL technologies), carefully adding 15ml of Ficoll buffer solution, carefully adding the mixture of blood and PBS along the tube wall, and carefully adding about 30ml of the mixture into each tube; centrifuging 1200g for 10 minutes, quickly pouring the supernatant into a new 50ml tube, centrifuging 200g for 8 minutes, discarding the supernatant, adding 10ml of PBS buffer solution for resuspension and precipitation, centrifuging 200g for 8 minutes, discarding the supernatant, adding 10ml of PBS buffer solution for resuspension, centrifuging, discarding the supernatant, and then resuspending the cell precipitate by 10ml of PBS buffer solution; the resuspended cells were counted, 10. mu.l of the suspension was added to 10. mu.l of 0.1% trypan blue and mixed well, and the number of cells and the viability were counted on a machine.

b.T cell purification, namely taking a small amount of PBMC cells obtained, and calculating the proportion of CD3 positive T by a flow cytometer; according to the proportion of the required cells to the CD3 positive cells, the required PBMC cells are taken out, and the required cells are 70% of the taken cells; resuspending total PBMC cells (kit purchased from STEMCELL technologies) with positive selection buffer to a total cell concentration of 1X 10 ⁸ Per ml; each 1 × 10 ⁸ Cells were added with 100. mu.l of CD3 antibody (Release Human CD3 Positive Selection Cocktail); incubation at room temperature3 minutes; the magnetic beads (reusable Rapid Sphenes) were mixed together in advance by a vortex mixer for 30 seconds at 1X 10 intervals ⁸ Adding 100 mu l of magnetic beads into the cells, and incubating for 3 minutes at room temperature; transferring the cell suspension into a special sorting tube, metering the volume to 2.5ml by using positive sorting buffer solution, and placing the cell suspension on a magnetic frame for incubation for 5 minutes at room temperature; carefully grasping the magnetic frame, dumping the sorting tube, discarding the unbound cell suspension, re-suspending the attached magnetic beads and cells with 2.5ml of positive selection buffer solution, placing on the magnetic frame again, incubating at room temperature for 3 minutes, and discarding the unbound cell suspension again; taking down the sorting tube from the magnetic frame, adding a Release buffer into the suspension, and incubating for 3 minutes at room temperature; placing on a magnetic frame and incubating for 5 minutes at room temperature; carefully grasping the magnetic frame, pouring the sorting tube, and collecting the unbound cell suspension in a clean sterile 15ml centrifuge tube, wherein the cell is the extracted T cell.

c.T cell activation: taking the purified T cells 5X 10 ⁷ Activated with Anti-CD3/Anti-CD28 magnetic beads; 1.5X 10 magnetic Anti-CD3/Anti-CD28 beads (purchased from ThermoFisher) were used ⁸ Resuspend with PBS buffer (containing 2mM EDTA and 1% fetal calf serum), add to the magnetic pole, stand for 2 minutes, and carefully discard the supernatant; repeating the above process; taking washed magnetic beads, adding the magnetic beads into T cells, uniformly mixing, and placing at 37 ℃ for culturing for two days; taking out the magnetic beads after two days, firstly re-suspending the T cells for multiple times by using a pipette, then placing the cell suspension in a magnetic pole, standing for two minutes, and removing the magnetic beads on the tube wall; cell number and survival rate were measured on the machine.

d. Electric conversion: cells were counted 48 hours after activation; taking 6X 10 ⁷ Individual cells were electroporated to deliver spCas9 mRNA and sgRNA to cleave TRAC and B2M genomic sites using a Lonza electroporation kit (cat # V4XP-3024) and a Lonza electroporation device (4D-Nucleofector); cell subpackaging 12 tubes, each tube 5X 10 ⁶ Placing the cell suspension in a centrifuge tube for centrifugation at the rotation speed of 200g for 5 minutes, and completely removing the culture medium for later use after centrifugation; preparing Lonza electrotransfer buffer solution, and then every 5X 10 ⁶ Adding 10 ug of spCas9 mRNA (amino acid sequence shown in SEQ ID NO: 57) and 1 ug of each of sgRNA-0003 and sgRNA-0004 which are designed and synthesized into each cell, mixing the mixture with cell precipitate at room temperature, adding the mixture into an electric cuvette, and electrically programming E0-115After electric shock is finished, placing the culture box at 37 ℃ for 10 minutes, and then adding the culture box into 5ml of preheated cell culture medium; the above electrotransformation process was repeated 11 times in succession.

e. Transfection of adeno-associated virus: after 4 hours after the completion of the electrotransfer, the cells were added with the adeno-associated virus (pAAV-0039) purified in example 3, and 0.4ml of adeno-associated virus was added per 5ml of the cell suspension; after 24 hours, the medium was replaced with new one to remove adeno-associated virus from the medium.

f. Cell expansion: after the electroporation was completed, the cells were first cultured in a well plate for two days, and then transferred to a culture bag (purchased from Takara) for culture at an initial culture density of 5X 10 ⁵ Every other day, the cells were sampled to determine the cell density and supplemented with fresh medium to adjust the cell density to 5X 10 ⁵ One cell/ml, with the addition of 10ng/ml recombinant IL-2 (purchased from PeproTech).

Tcr negative cell enrichment: the cells were counted after 15 days of culture and the cell density was found to be 3.7X 10 ⁶ The total cell suspension is 1800ml, the total viable cell number is 1X 10 ¹⁰ (ii) a Taking 1X 10 of the above ⁵ Adding a TCR-PE antibody to the individual cells, dyeing for 25 minutes, washing the cells by using a PBS buffer solution, and detecting the proportion of TCR negative cells by using a flow cytometer to obtain the TCR negative cell proportion of 92 percent; collecting all universal CAR-T cells, centrifuging, and adding 100ml of culture medium for resuspension; sorting magnetic beads (purchased from ThermoFisher) from Dynabeads coupled with CD3 antibody, wherein the number of the magnetic beads is twice of the number of TCR positive cells, uniformly mixing the magnetic beads with the cell suspension, and placing the mixture on a rotator for incubation; after 30 minutes, the cells were transferred to a magnetic frame, and after standing for 5 minutes, unbound cells, i.e., TCR negative cells, were aspirated.

h. Freezing and storing cells: 1 × 10 total obtained after TCR negative cell enrichment ¹⁰ (ii) individual cells; centrifuging to collect the cells, and resuspending the cell pellet with PBS; centrifuging and discarding the supernatant; the pellet was mixed with 50ml of cell freezing medium (purchased from STEMCELL Technologies) to give a cell concentration of 2X 10 ⁸ Per ml; standing the subpackaged cells in a refrigerator at 4 ℃ for 10 minutes, and transferring the cells into a gradient cooling box; storing in a refrigerator at-80 deg.C.

4) Flow assay

Before negative enrichment of cell TCRThe later gene modification conditions are detected in two groups, and the specific method comprises the following steps: two groups of 1X 10 of each CAR-T cells were taken before and after sorting and universal CAR-T cells ⁵ After one time of washing by PBS buffer, flow antibodies CD19-FITC/PE-TCR and HLA-ABC-APC/HLA-E-PE are respectively added for dyeing for 25 minutes, then the cells are washed by PBS buffer again, and finally the cells are re-suspended by PBS buffer and analyzed by an up-flow cytometer. The results in FIG. 9 show that both TCR and HLA-ABC negative cells before the universal CAR-T cell sorting are more than 90%, and in addition, the positive expression of the CD19 targeting CAR and HLA-E genes is more than 60%, which proves that the gene modification scheme can efficiently edit a plurality of genes simultaneously. In addition, targeting CD19CAR and HLA-E positive expression cells while TCR expression is negative, meets the gene editing setting of the invention. After cell sorting, the negative proportion of TCR exceeds 99 percent, which proves that sorting is successful and can be used for the feedback of allogeneic cells.

Example 4: preparation of CD 19-targeted universal CAR-T cells using non-viral vectors

1) Molecular cloning

39-41 repair template DNA is synthesized and then respectively cloned into a pUC57 plasmid vector, and the process comprises the following steps:

a. the target fragment PCR is prepared as follows:

c. vector PCR, firstly preparing a PCR reaction system:

reagent	Amount of use (mul)
		5×primeSTAR GXL Buffer	10
dNTP Mix	4
		Primer F	1
Primer R	1
		pUC57	0.5
Sterilized water	31.5
		PrimeSTAR GXL DNA Polymerase	2
Total volume	50

d. And (3) placing the PCR reaction system in a PCR amplification instrument, and amplifying according to the following conditions:

e. and (3) recombining the target fragment with a vector: adding the target gene and the linearized vector into a centrifuge tube according to a certain molar ratio for recombination reaction, and reacting for 10 minutes in a water bath kettle at 50 ℃, wherein the reaction system is as follows:

reagent	Amount of use (mul)
		Vector pUC57	3.5
Fragment of interest (0039-0041)	4
		5 Xreaction buffer	2
NovoRec Plus recombinase	0.5
		Total volume	10

f. The reaction product was converted into coated plates in the same manner as in example 3.

g. Single clones were picked and subjected to plasmid extraction in the same manner as in example 3.

h. And (5) sequencing and confirming. The vectors obtained were as follows:

number of	Name of vector
		1	pUC57-0039
2	pUC57-0040
		3	pUC57-0041

2) PCR amplification of repair template DNA

a. The sequences and modifications of the PCR primers for repairing the template DNA are respectively as follows:

b. 20 general PCR tubes were prepared, respectively, and a PCR reaction mixture Mix was prepared as follows:

c. and (3) placing the PCR reaction system in a PCR amplification instrument, and amplifying according to the following conditions:

after the PCR is finished, the mixture is collected into a 15ml centrifuge tube.

3) Purification of PCR products of repair template DNA

The PCR product purification of template DNA adopts a large amount of DNA product purification kit (DP205) of Tiangen Biochemical technology (Beijing) limited company for purification, 100 mul of PCR system uses a tube of column, 1000 mul of PCR product needs 10 tubes of column purification, and the specific steps are as follows: a. column equilibration step: adding 500 μ l of equilibrium liquid BL into adsorption column CB3 (the adsorption column is placed into the collection tube), centrifuging at 12,000rpm (13,400 Xg) for 1 min, pouring out waste liquid in the collection tube, and replacing the adsorption column into the collection tube; b. estimating the volume of the PCR reaction solution, adding 5 times of the volume of the binding solution PB into the PCR reaction solution, and fully and uniformly mixing; c. adding the solution obtained in the previous step into an adsorption column CB3 (the adsorption column is placed into a collecting pipe), standing for 2 minutes at room temperature, centrifuging for 30-60 seconds at 12,000rpm (13,400 Xg), pouring out waste liquid in the collecting pipe, and placing an adsorption column CB3 into the collecting pipe; d. adding 600 mul of rinsing liquid PW into an adsorption column CB3, centrifuging at 12,000rpm (13,400 Xg) for 30-60 seconds, pouring out waste liquid in a collecting pipe, and putting the adsorption column CB3 into the collecting pipe; e. repeating the above steps; f. putting the centrifugal adsorption column CB3 back into the collecting pipe, centrifuging at 12,000rpm (13,400 Xg) for 2 minutes, removing rinsing liquid as much as possible, placing the adsorption column at room temperature for a plurality of minutes, and completely drying the adsorption column to prevent the residual rinsing liquid from influencing the next experiment; g. taking out the adsorption column CB3, putting the adsorption column CB3 into a clean centrifugal tube, hanging and dripping a proper amount of elution buffer solution EB into the middle position of an adsorption film, standing the adsorption film for 2 minutes at room temperature, centrifuging the adsorption film for 2 minutes at 12,000rpm (13,400 Xg), and collecting DNA solution; h. DNA solutions were pooled and collected, and DNA concentration was determined by Nanodrop.

4) CAR-T cell preparation

a. Among them, PBMC extraction, T cell purification, T cell activation, cell expansion, TCR negative cell enrichment and cell cryopreservation methods were the same as in example 3, and were greatly different only in the step of electrotransfer.

b. Electric conversion: cells were counted 48 hours after activation; taking 6X 10 ⁷ Cells were electroporated to deliver spCas9 protein (purchased from ThermoFisher), sgRNA and modified double-stranded DNA (pUC57-0039 PCR product) to achieve splicing of TRAC and B2M genomic sites and knock-in of the gene of interest in one go, using a Lonza electroporation kit (cat # V4XP-3024) and a Lonza electroporation device (4D-Nucleofector); cell subpackaging 12 tubes, each tube 5X 10 ⁶ Placing the cell suspension in a centrifuge tube for centrifugation at the rotation speed of 200g for 5 minutes, and completely removing the culture medium for later use after centrifugation; lonza electrotransfer buffer is prepared, and then every 5X 10 ⁶ Adding 10 mu g of spCas9 protein, 1 mu g of each of designed and synthesized sgRNA-0003 and sgRNA-0004 and 10 mu g of modified double-stranded DNA into each cell, uniformly mixing the cells with cell sediment after uniform mixing at room temperature, adding the mixture into an electric transfer cup, electrically shocking the mixture by using an E0-115 program, placing the mixture into a 37-degree incubator for 10 minutes after the electric shock is finished, and then adding the mixture into 5ml of preheated cell culture medium; the above electrotransformation process was repeated 11 times in succession.

5) Flow assay

The method for detecting the gene modification condition of the cell TCR before and after negative enrichment comprises the following steps: two groups of 1X 10 of pre-sorting control and universal CAR-T cells are taken ⁵ After one time of washing by PBS buffer, flow antibodies CD19-FITC/PE-TCR and HLA-ABC-APC/HLA-E-PE are respectively added for dyeing for 25 minutes, then the cells are washed by PBS buffer again, and finally the cells are re-suspended by PBS buffer and analyzed by an up-flow cytometer. The results in figure 10 show that both TCR and HLA-ABC negative cells before sorting the universal CAR-T cells are more than 80%, and in addition, positive expression of both targeted CD19CAR and HLA-E genes is more than 40%, demonstrating that the gene engineering protocol can edit multiple genes simultaneously. In addition, targeting CD19CAR and HLA-E positive expressing cells while TCR expression is negative, consistent with the gene editing settings of the present invention. After cell sorting, TCThe negative proportion of R is over 99 percent, which proves that the sorting is successful and can be used for the feedback of the allogeneic cells.

Example 5: in vitro killing experiment

The killing effect of the universal CAR-T cells prepared in examples 3 and 4 was tested by the Lactate Dehydrogenase (LDH) cytotoxicity method (the kit used was purchased from Promega). The specific process is as follows: after the cells were cultured to day 15 and sorted, cell suspensions of effector cells (universal CAR-T cells) and target cells (K562-CD19, cell identification as in fig. 11a) were pipetted into 1.5ml EP tubes, centrifuged at 300g for 5 minutes and the cell supernatant discarded, then all cells were resuspended in 200 μ l 1640 medium containing 1% bovine serum and mixed well for cell counting; according to the counting result, preparing a system according to an effective target ratio of 5:1, and sequentially adding the system into a round-bottom 96-hole plate; after the addition is finished, putting the cell plate into a centrifuge, centrifuging the cell plate for 2 minutes at 100g, and after the centrifugation is finished, putting the cell plate into an incubator; after overnight incubation, 20 μ l of cell lysate was added to the wells with the maximum release of K562-CD19 cells, after which the 96-well plate was placed in an incubator for 45 min while the substrates in the kit were left to dissolve at room temperature; after the incubation is finished, sucking 50 mu l of liquid out of each hole, transferring the liquid into a 96-hole flat bottom plate, quickly adding 50 mu l of the substrate in the kit into each hole by using a line gun, and quickly adding 50 mu l of the termination reaction liquid in the kit into each hole after the liquid to be detected and the substrate react for about 30 minutes at room temperature; after waiting about 3 minutes, the color of each well settled, the air bubbles were punctured with a clean needle, and the values of each well were measured at 490nm using a microplate reader (Thermo Fisher Multiskan FC model), and the raw data were calculated according to the formula of the kit instructions. The results of the detection of the killing effect of the control cells and the CAR-T cells on the target cells K562-CD19 are shown in FIG. 11b, and the results show that the universal CAR-T cells prepared by the two methods can effectively kill CD19 positive target cells.

Example 6: universal CAR-T cell therapy B acute lymphoblastic leukemia mouse model

1) The mouse model and cellular information used are as follows:

options for	Information
		Variety of (IV) C	NOG mice
The week of the year	6-8 weeks old
		Sex	Female
Transplanted tumor cells	Raij-GFP-Luciferase cell
		Test cell	Universal CAR-T and control cells prepared in examples 3 and 4

2) The method comprises the following steps: mice were divided into three groups, grouped as in the table below; Raji-GFP-Luciferase cells injected 3.5X 10 per mouse ⁵ One (injection mode: tail vein); day 5 after Raji cell injection, 2X 10 was reinfused ⁶ Targeting CD19 universal CAR-T (from examples 3 and 4) and control cells (injection mode: tail vein) prepared with individual adeno-associated viral or non-viral vectors; the mice were observed for subsequent survival for a period of 70 days, and the weight data were recorded by weighing weekly.

As a result: the survival curve of the mice is shown in figure 12, and it can be seen from the figure that two groups of universal CAR-T cells can obviously prolong the survival time of the B acute lymphoblastic leukemia mice compared with the control cells, and the curative effect of the universal CAR-T cells prepared by the adeno-associated vector is a little better than that of the universal CAR-T cells prepared by the non-viral vector in the mouse model, but the difference between the two is not large. The experiment proves that the universal CAR-T cell prepared by the scheme has obvious curative effect on anti-CD 19 positive tumor in vivo.

Example 7: off-target detection

The off-target problem of the CRISPR-Cas9 gene editing technology is a hot spot of concern, and the potential off-target in the invention is derived from two factors, respectively: the specificity of sgrnas and the specificity of adeno-associated viral vector-mediated gene knock-in. This example will verify the specificity of the two major sgrnas used, i.e., the sgRNA off-target probability.

The website https:// design. synthgo. com/analysis sgRNA-0003 (for TRAC gene) off-target sites were used to select potential off-target sites encoding amino acids therein, and the following results were obtained, respectively:

primers are respectively designed according to DNA sequences of the sites, the size of PCR fragments of the primers is about 700 to 1000 bases (potential off-target sequences are positioned in the middle of the PCR fragments), and specific primer sequences are as follows:

the cells tested were TCR-negatively enriched universal CAR-T and T control cells prepared in example 3; extracting genome DNA of two groups of cells (adopting a radix asparagi biological kit); the two off-target detection primers are respectively utilized to carry out PCR amplification, and the prepared PCR system and the prepared PCR program are respectively as follows:

after the PCR is finished, carrying out DNA gel electrophoresis; cutting gel and recovering DNA (adopting a kit of a Tiangen organism); then, sequencing by using corresponding PCR upstream primers respectively; carrying out TIDE comparison on the ab1 files obtained by sequencing in pairs respectively by using a website https:// tide.nki.nl/respectively; the alignment results are shown in FIG. 13.

The alignment in fig. 13 shows that sgRNA-0003 did not off target, which may be due to two reasons: the T cells are conservative, and the accuracy of gene editing T cells is high; the delivery mode adopted in the embodiment is spCas9 protein electrotransfer, so that CRISPR shearing is transient and is more accurate compared with a virus and plasmid delivery mode.

Example 8: targeting CD19CAR and B2M-HLA-E gene knock-in into different TRAC genomic sites compare the protocol of example 3.

The inventors of the paper-Targeting a CAR to the TRAC locus with CRISPR/Cas9enhances project that, although a certain efficiency (about 40% efficiency of knock-in) was achieved by combining CAR gene with TRAC genomic site by adeno-associated virus vector type 6 and gene editing methods, they were somewhat different in efficiency compared to the preparation of CAR-T cells from lentiviral vectors, and another paper-reproducing human T cell function and specificity with non-viral genome Targeting that, respectively, knocked the NY-ESO-1TCR gene into the TRAC genomic site by combining the CRISPR-Cas9 technique with an unmodified double-stranded DNA template, although feasibility of non-viral site integration methods have been demonstrated, the efficiency is still not high (about 10% efficiency of knock-in), the Targeting and knocking-in TRAC genomic sites of the present invention are not consistent with the above-mentioned documents, the invention will demonstrate that this site will be more efficient for CAR gene knock-in. The following is the CAR gene site-directed knock-in different TRAC genomic DNA site alignment experimental procedure:

(1) cell preparation

Pbmc extraction same as example 3.

b.T cells were purified as in example 3.

c.T cell activation As in example 3, 1.5X 10 ⁷ And (4) T cells.

d. Electric conversion: after 48 hours of T cell activation, three T cells (5X 106 cells) were individually subjected to bead removal for activation, and then to electroporation and addition of adeno-associated virus vector in accordance with the method of example 3. Wherein the template DNA for knocking in the TRAC genomic site in the literature Targeting a CAR to the TRAC locus with CRISPR/Cas9enhances genome project is shown in SEQ ID NO:48 (the DNA is cloned into pAAV-MCS vector and then packaged with adeno-associated viral vector in the same way as in example 3. in addition, the sgRNA used for Targeting TRAC is 0001), and the DNA for knocking in the TRAC genomic site in the literature cloning human T cell function and specificity with non-viral genome Targeting is shown in SEQ ID NO:49 (the DNA is cloned into pAAV-MCS vector and then packaged with adeno-associated viral vector in the same way as in example 3. in addition, the sgRNA used for Targeting TRAC is 0002), and the knock in the TRAC genomic DNA site of the present invention is shown in SEQ ID NO:39 (the adeno-associated viral vector is from example 3, and the sgRNA used for Targeting TRAC is 0003).

e. Cell expansion, TCR-negative cell purification and cell cryopreservation were as in example 3.

(2) Flow assay

Cells were harvested at 1X 10 days 8 after transduction ⁵ One, PBS wash once, add flow antibody CD19-FITC/TCR-PE stain for 25 minutes, then PBS wash once more, finally resuspend cells using PBS and analyze on flow cytometry. The results are shown in FIG. 14, TRAC genomic sites targeted and knocked-in the present invention and the sameThe sgRNA combination is used for CAR gene knock-in with higher efficiency than the Targeting a CAR to the TRAC loci with CRISPR/Cas9 enhancement project and replication human T cell function and specificity with non-viral gene Targeting.

Example 9: alignment of targeting CD19CAR single knock-in TRAC genomic sites with the protocol of example 3.

1) Cell preparation

PBMC were extracted as in example 3, and the recruited volunteers were negative for peripheral blood HLA-A2 expression.

b.T cells were purified as in example 3.

c.T cell activation As in example 3, 1X 10 co-activation ⁷ And (4) a T cell.

d. Electrotransfer and adeno-associated viral vector transduction: after 48 hours of T cell activation, two 5X 10 cells were separately collected ⁶ After removing the activated magnetic beads from the individual T cells, the adeno-associated virus vector was electroporated and added as in example 3, wherein the template DNA targeting CD19CAR to TRAC genomic site was shown in SEQ ID NO:50 (this DNA was cloned into pAAV-MCS vector and then packaged into adeno-associated virus vector in accordance with example 3. in addition, sgRNA used for targeting TRAC was 0003), and the template DNA targeting CAR and B2M-HLA-E double gene knock-in TRAC genomic site was shown in SEQ ID NO:39 (this adeno-associated virus vector was obtained from example 3).

e. Cell expansion, TCR negative cell purification and cell cryopreservation were as in example 3.

2) Flow assay

Two groups of 1X 10 of pre-sorting control and universal CAR-T cells are taken ⁵ After washing once with PBS buffer, flow antibodies CD19-FITC, HLA-ABC-APC and HLA-E-PE are respectively added for staining for 25 minutes, and then the cells are washed once with PBS buffer, finally the cells are re-suspended with PBS buffer and analyzed by an up-flow cytometer. Results as in fig. 15a, it can be seen from the results that the single knock-in targeting CD19CAR gene obtained efficient cells comparable to the present invention.

3) General CAR-T cells prepared by two methods and allogeneic NK cells through co-incubation for detecting in-vitro NK allogeneic rejection reaction

Extraction of NK cells: screening for HLA-A2 expressing positiveA sexual volunteer; peripheral Blood Mononuclear Cells (PBMC) of the volunteers were collected and the number and viability of the cells were determined by trypan blue staining as in example 3; NK cells in PBMCs were purified using NK cell sorting kit (purchased from Miltenyi); detecting the extraction effect of NK cells, and taking 1 × 10 ⁵ Flow antibody staining of individual NK cells (antibodies: CD3-PC5.5 and CD56-FITC) was performed, and the results of flow cytometry analysis are shown in FIG. 15 b.

Cell incubation: trypan blue staining method detects the number and the survival rate of control T cells, universal CAR-T cells (UCART-1) only knocking in targeting CD19CAR gene and universal CAR-T cells (the scheme of the invention, the name is abbreviated as UCART-2) double knocking in targeting CD19CAR and B2M-HLA-E gene; mixed incubation of cells was performed according to the following table, the incubation Medium was RPMI Medium 1640+ 10% fetal bovine serum + cytokine leukocyte 2(10ng/ml), the incubation volume was 200 μ l, incubated in a 96-well flat bottom plate, after hardening, the 96-well plate was placed in a cell incubator at 37 ℃ with 5% CO 2; and (3) detecting incubation effects, uniformly mixing each group of mixed experimental cells on corresponding days, transferring 100 mu l of mixed experimental cells into a 1.5ml centrifuge tube for flow antibody staining (antibody: HLA-A2-PE, HLA-ABC-APC), analyzing by adopting a flow cytometry analysis method, and analyzing results as shown in figure 15c, wherein after the mixed experimental cells are incubated for one day and two days together, the proportion of the universal CAR-T cells only knocking in the targeted CD19CAR gene is obviously less than that of the universal CAR-T cells only knocking in the targeted CD19CAR and the B2M-HLA-E gene, and the scheme disclosed by the invention has NK killing inhibition activity and prompts rejection of allogeneic NK cells under the condition of B2M gene knockout.

Example 10 targeting of CD19CAR and B2M-HLA-E genes knock into the TRAC and B2M genomic sites, respectively, the protocol of comparative example 3.

The universal CAR-T cell prepared in the method for preparing universal targeting CD19 antigen chimeric receptor T cells and the application thereof (application No. CN201810636413.7) and increasing the transplantation compatibility of allogeneic T cells and the application thereof (application No. CN201810634501.3) is characterized in that a CAR gene and a B2M-HLA-E gene are knocked into TRAC and B2M genomic sites respectively (as shown in figure 16 a). To compare the two numbers of the finally obtained effective cells (namely positive expression of CAR and HLA-E genes and negative expression of TCR and HLA-ABC genes), a comparison experiment is specifically designed and implemented as follows:

1) cell preparation

Pbmc extraction same as example 3.

b.T cells were purified as in example 3.

c.T cell activation As in example 3, 1X 10 co-activation ⁷ And (4) a T cell.

d. Electrotransformation and adeno-associated viral vector transduction: 48 hours after T cell activation, two 5X 10 cells were separately taken ⁶ After removing the activated magnetic beads from the T cells, the cells were transfected and added with adeno-associated virus vectors according to the method of example 3, wherein the transduction gene targeting CD19CAR knock-in TRAC genomic site is shown in SEQ ID NO:50 (the DNA was cloned into pAAV-MCS vector and packaged adeno-associated virus vector in the same manner as in example 3), the transduction gene targeting B2M-HLA-E knock-in B2M genomic site is shown in SEQ ID NO:51 (the DNA was cloned into pAAV-MCS vector and packaged adeno-associated virus vector in the same manner as in example 3), and the transduction gene targeting CAR and B2M-HLA-E double knock-in TRAC genomic site is shown in SEQ ID NO:39 (the adeno-associated virus vector was obtained in example 3).

(2) Flow assay

Two groups of 1X 10 of pre-sorting control and universal CAR-T cells are taken ⁵ After one time of washing by PBS buffer, flow antibodies CD19-FITC/PE-TCR and HLA-ABC-APC/HLA-E-PE are respectively added for dyeing for 25 minutes, then the cells are washed by PBS buffer again, and finally the cells are re-suspended by PBS buffer and analyzed by an up-flow cytometer. The results are shown in FIG. 16B, and it can be seen from the results that knock-in efficiency obtained by knocking in TRAC and B2M genomic locus groups respectively for CD19CAR and B2M-HLA-E single genes is not much different from that of the method of example 3, but effective cells(CAR-positive cell ratio multiplied by HLA-E-positive cell ratio) but is about half of the method of example 3.

Example 11: targeting CD19CAR and B2M-HLA-E gene knock-in to B2M genomic site versus the protocol of example 3.

Corresponding to the protocol of example 3, which targets both CD19CAR and the B2M-HLA-E gene by knocking into the B2M genomic locus (as shown in FIG. 17 a), is also not reported. To compare the merits of the knock-in TRAC genomic locus and the knock-in B2M genomic locus, a control experiment was designed, and was performed as follows:

1) cell preparation

Pbmc extraction same as example 3.

b.T cells were purified as in example 3.

c.T cell activation As in example 3, 1X 10 co-activation ⁷ And (4) a T cell.

d. Electrotransformation and transduction with rAAV vector: 48 hours after T cell activation, two 5X 10 cells were separately taken ⁶ After removing the activated beads from the T cells, the cells were transfected and added with the adeno-associated virus vector according to the method of example 3, wherein the template DNA at the knock-in B2M genomic locus is shown in SEQ ID NO:52 (this DNA was cloned into pAAV-MCS vector and then packaged with adeno-associated virus vector in the same manner as in example 3), and the knock-in TRAC genomic locus transduction gene is shown in SEQ ID NO:39 (this adeno-associated virus vector was obtained from example 3).

(2) Flow assay

Two groups of 1X 10 of pre-sorting control and universal CAR-T cells are taken ⁵ After one time of washing by PBS buffer, flow antibodies CD19-FITC and HLA-ABC-APC/HLA-E-PE are respectively added for staining for 25 minutes, and then the washing by PBS buffer is carried out again, and finally the cells are re-suspended by PBS buffer and analyzed by an up-flow cytometer. The results are shown in FIG. 17B, and it can be seen that knock-in of the B2M genomic site is also feasible, but slightly less efficient than knock-in of the TRAC genomic site.

Example 12: targeting of CD19CAR and B2M-HLA-E gene knock-in TRAC genomic sites was achieved without gene editing with only adeno-associated viral vectors versus the protocol of example 3.

In the document-HlA-E-expressing transcription of cell escape pathogenic responses and lyses by NK cells, the B2M-HLA-E gene is knocked into the B2M genome site by using an adeno-associated virus vector, so that the knock-in process of the edited stem cells reduces the rejection reaction of T and NK cells, and the gene knock-in process does not use gene editing but only depends on the adeno-associated virus vector, in order to prove that the scheme of the invention using CRISPR-Cas9 gene editing and adeno-associated virus vector is superior to the document, a group of experiments are specially designed to compare the difference of the two, and the specific process is as follows:

1) cell preparation

Pbmc extraction same as example 3.

b.T cells were purified as in example 3.

c.T cell activation As in example 3, 1X 10 co-activation ⁷ And (4) T cells.

d. Transduction with adeno-associated viral vectors: after 48 hours of T cell activation, 5X 10 cells were sampled ⁶ Directly adding (namely transfecting) rAAV vector virus after removing activated magnetic beads from individual T cells, and setting MOI to be 1 × 10 ⁵ . Taking 5X 10 ⁶ After removing the activated magnetic beads from the individual T cells, the cells were electroporated and added with rAAV vector virus as described in example 3.

2) Flow assay

Two groups of 1X 10 of pre-sorting control and universal CAR-T cells are taken ⁵ After one time of washing by PBS buffer, flow antibodies CD19-FITC/PE-TCR and HLA-ABC-APC/HLA-E-PE are respectively added for dyeing for 25 minutes, then the cells are washed by PBS buffer again, and finally the cells are re-suspended by PBS buffer and analyzed by an up-flow cytometer. The results are shown in FIG. 18. As can be seen from the results, the knock-in efficiency was hardly detected only by transfecting the rAAV vector virus group, and thus it is suggested that the method of HlA-E-expressing conventional stem cells and lineage by NK cells is not suitable for the preparation of knock-in type general CAR-T cells,

example 13: targeting CD19CAR and HLA-E gene knock-in TRAC genomic sites versus the protocol of example 3.

In the patent-universal CAR-T cell and the preparation method and application thereof (application number: CN201710983276.X), B2M and TRAC genes are knocked out after the HLA-E gene is transduced, so that the HLA-E is expressed while the HLA class I gene is inhibited, however, theoretically, any HLA class I gene (including HLA-E) cannot be expressed after the endogenous B2M gene is knocked out, and the transduced B2M-HLA-E gene is not influenced by the knocked-out endogenous B2M gene (namely, the scheme of the invention). For verifying theoretical guess, the specific implementation mode is as follows:

1) cell preparation

Pbmc extraction same as example 3.

b.T cells were purified as in example 3.

c.T cell activation As in example 3, 1X 10 co-activation ⁷ And (4) a T cell.

d. Electrotransfer and adeno-associated viral vector transduction: after 48 hours of T cell activation, two 5X 10 cells were separately collected ⁶ After removing the activated magnetic beads from each T cell, the cells were transfected and added with adeno-associated virus vector according to the method of example 3, wherein the template DNA of the CAR and HLA-E double gene knock-in TRAC genomic site is shown in SEQ ID NO:53 (this DNA was cloned into pAAV-MCS vector and packaged adeno-associated virus vector in the same manner as in example 3), and the template DNA of the CAR and B2M-HLA-E double gene knock-in TRAC genomic site is shown in SEQ ID NO:39 (this adeno-associated virus vector was obtained from example 3).

e. Cell expansion, TCR negative cell purification and cell cryopreservation: the same as in example 3.

2) Flow assay

Two groups of 1X 10 of pre-sorting control and universal CAR-T cells are taken ⁵ After washing once by PBS buffer solution, adding two groups of flow antibodies CD19-FITC/PE-TCR and HLA-ABC-APC/HLA-E-PE respectively for staining for 25 minutes, then washing once by PBS buffer solution, finally resuspending cells by PBS buffer solution, and analyzing by an up-flow cytometer. As shown in FIG. 19, it was revealed that the HLA-E group transduced with HLA-E failed to express HLA-E under HLA-ABC negative conditions, whereas the present protocol transduced with B2M-HLA-E allowed expression of HLA-E protein under HLA-ABC negative conditions, which theoretically allowed reduction of rejection of both T and NK cells, and thus the present protocolThe method is more feasible.

Example 14: targeting CD19CAR and B2M-HLA-E genes for lentiviral transduction the TRAC and B2M genes were knocked out following the protocol of comparative example 3.

The preparation of CAR-T cells by lentivirus transduction is a mature technology, but has two disadvantages, namely, the limited packaging capacity and the easy canceration of cells caused by random insertion, especially, the too small packaging capacity limits lentiviruses to carry exogenous genes with no more than three kilobases, and if the upper limit is exceeded, the packaging and transfection of the viruses are greatly influenced. This example compares the final effective cell yields of lentivirus and adeno-associated virus-derived double-gene transduced universal CAR-T cells to determine the superiority of the protocol of the present invention, and the specific steps are as follows:

1) lentiviral packages

Lentiviral transduction targeting CD19CAR and B2M-HLA-E gene Kozak-CAR19-B2M-HLA-E (SEQ ID NO:54) were cloned into pLVX-EF1 vector; 293T cells (purchased from ATCC) at 75cm one day before transfection ² The culture dish is full of culture medium, the generation is carried out according to the ratio of 1:3, the culture medium of each culture dish is 15ml, the transfection is carried out according to the steps of a manufacturer of Lipo3000, and a transfection system is firstly prepared:

mixing the

systems

1 and 2 uniformly, standing for 5 minutes, mixing the systems uniformly, and standing for 10 minutes. Carefully add to 293T cells. The fresh medium was changed after 6 hours. After 48 hours, the medium was stored at 4 ℃ and 15ml of fresh medium was added again, and the supernatant was collected after 24 hours. The resulting viral supernatant was filtered through a 0.45 μm filter and placed in an ultracentrifuge tube. After centrifugation at 50000g for 2 hours and 45 minutes at 4 ℃, the supernatant was carefully and thoroughly removed, leaving a macroscopic white viral pellet that was resuspended in one percent of the supernatant volume in PBS buffer and after viral resuspension was solubilized at 4 ℃ for about 30 minutes. And after the dissolution is finished, the mixture is subpackaged into small parts and frozen and stored in a eighty-degree refrigerator.

2) Cell preparation

Pbmc extraction same as example 3.

b.T cells were purified as in example 3.

c.T cell activation As in example 3, 1X 10 co-activation ⁷ And (4) T cells.

d. Lentivirus transfection: taking 5X 10 of the mixture 24 hours after activation ⁶ T cells are put into a 15ml tube, centrifuged to remove the culture medium, added with lentivirus targeting CD19CAR and B2M-HLA-E gene (SEQ ID NO:54) according to the MOI value of 5, and centrifuged at 2000g for 90 minutes; after the centrifugation is finished, removing the lentivirus supernatant, and adding a culture medium for continuous culture.

e. Electric conversion: after 72 hours after activation, 5X 10 cells were taken ⁶ Untransfected T cells and 5X 10 ⁶ Respectively placing the T cell suspension transfected with the target CD19CAR and the B2M-HLA-E gene lentivirus into a centrifuge tube for centrifugation at the rotation speed of 200g for 5 minutes, and completely removing the culture medium for later use after centrifugation; preparing Lonza electrotransfer buffer solution, respectively adding 10 mu g of Cas9 mRNA and 1 mu g of each of the designed and synthesized sgRNA-0003 and sgRNA-0004 into the two groups, uniformly mixing the two groups, then uniformly mixing the two groups with cell sediment, adding the mixture into an electrotransfer cup, electrically shocking by using an E0115 program, placing the mixture in a 37-degree incubator for 10 minutes after the electric shock is finished, and then adding the mixture into 5ml of preheated cell culture medium.

f. Transfection of adeno-associated viral vectors: after the completion of the electrotransformation, the group of untransfected lentiviral cells was added with pAAV-0039 purified in example 3 for 4 hours (5ml of cell suspension was added to a titer of 5X 10 ¹¹ vg of an adeno-associated viral vector); the cells were replaced with fresh medium 24 hours later to remove the adeno-associated viral vectors.

g. Cell expansion, TCR-negative cell purification and cell cryopreservation were as in example 3.

2) Cell counting

And counting the cells in the fourth, seventh, tenth, thirteenth and sixteenth days after the electricity taking conversion is finished. During counting, after staining with trypan blue, the cell is read by a CountStar automatic cell counter, and the reading results are summarized as follows:

3) flow assay

Taking comparison of nodes at different times and universal CAR-T detailsCell two groups each of 1 × 10 ⁵ After washing once by PBS buffer solution, adding two groups of flow antibodies CD19-FITC/PE-TCR and HLA-ABC-APC/HLA-E-PE respectively for staining for 25 minutes, then washing once by PBS buffer solution, finally resuspending cells by PBS buffer solution, and analyzing by an up-flow cytometer. The results are summarized in the following table:

according to the cell counting result, the amplification multiples of the universal CAR-T cells prepared by the two groups of methods are not greatly different, the final survival rate is more than 90%, and in addition, the flow results show that HLA-ABC is similar to TCR knockout efficiency, but the ratio of the CAR positive cells of the lentiviral group is obviously lower than that of the universal CAR-T cells prepared by adeno-associated viruses, so that the effective cells (HLA-ABC negative, TCR negative and CAR positive) prepared by the lentiviral group are far less than that of the universal CAR-T cells prepared by the adeno-associated viruses (figure 20), and the superiority of the scheme disclosed by the invention for preparing the universal CAR-T cells under the same gene editing requirement is suggested.

Claims

1. A method of making a universal double-knock-in CAR-T cell, the method comprising:

the repair template vector is delivered to T cells to knock the CAR gene and B2M-HLA-E gene into the TRAC or B2M site.

2. The method of claim 1, wherein the gene-editing substance is delivered using a gene-editing method selected from ZFN, TALEN, CRISPR-Cas9 and megaTAL, preferably CRISPR-Cas 9;

the gene editing substance is a plasmid, a lentivirus, a retrovirus, an adeno-associated virus, mRNA or an RNA protein complex, preferably mRNA; and is

Means for delivering the gene-editing substance include transfection methods using liposomes, calcium phosphate, DEAE-dextran, electroporation, microinjection or gene gun, and electroporation transfection is preferred.

3. The method of claim 2, wherein CRISPR-Cas9 gene editing material comprises Cas9 mRNA or Cas9 protein and sgRNA,

preferably, the sgRNA is chemically modified, wherein the chemical modification comprises 2-O-methylation, 3-thio and 2-O-methylation in combination with 3-thio,

preferably, the chemical modification occurs 1 to 10 bases at the 5 'and 3' ends of the sgRNA,

preferably, the 5 'and 3' end 3 bases of the sgRNA are simultaneously 2-O-methylated and 3-thio modified,

preferably, sgRNA sequences targeting the TRAC and B2M genes are shown in SEQ ID NO:55 and SEQ ID NO:56, respectively.

4. The method of claim 3, wherein Cas9 comprises SpCas9, SaCas9, SpCas9-HF, eSPCas9, xCas9 and cpf1, preferably SpCas9, more preferably the amino acid sequence thereof is as shown in SEQ ID NO: 57.

5. The method of claim 1, wherein the repair template vectors comprise adeno-associated virus and non-viral vectors.

6. The method of claim 1, wherein the template DNA in the repair template carrier comprises a left homology arm, a knock-in gene, and a right homology arm.

7. The method according to claim 6, wherein the left homology arm and the right homology arm each have a fragment length of 10 to 2000bp, preferably 300bp, 600bp or 1000bp, more preferably 300bp,

preferably, when the TRAC genomic locus is knocked in, the DNA of the left and right homology arms are respectively shown as SEQ ID NO. 1 and SEQ ID NO. 2,

preferably, when the genomic site of B2M is knocked in, the DNA of the left and right homology arms are shown as SEQ ID NO: 7 and SEQ ID NO: 8. .

8. The method of claim 6, wherein

When the TRAC site is knocked in and the TCR-alpha promoter is relied upon, the knocked-in gene comprises: a splicing peptide, a CAR gene, a splicing peptide, a B2M-HLA-E gene, and Poly A; when the TRAC site is knocked in and is dependent on an exogenous promoter, the knock-in gene comprises: exogenous promoter, CAR gene, splicing peptide, B2M-HLA-E gene and Poly A,

preferably, the exogenous promoter is EF1, and the DNA sequence is shown as SEQ ID NO. 26;

preferably, the cleavage peptide is P2A, the amino acid sequence of which is shown in SEQ ID NO: 25;

preferably, Poly A is miniPolyA or bGHpA polyA, and the DNA sequences are shown in SEQ ID NO:27 and SEQ ID NO:28, respectively.

9. The method of claim 8, wherein the antigen target to which the CAR gene is directed is selected from one or more of CD19, CD22, CD20, CD7, CD5, CD4, CD123, CD30, CD33, CD70, CD38, CD138, BCMA, SLAMF7, PSMA, HER2, HER3, B7-H3, Mesothelin, CS1, MUC16, GD2, GUCY2C, ROR1, GPC3, FAP, FOLR1, CEA, CD138, CD56, CD147, EpCAM, CAIX, EGFR, Claudin 18.2, Claudin 6, CLL-1, GPRC5D, Nectin-4, EGFRVIII, LewisY, DLL3, uPAR, MG7, and IL13R α 2.

10. The method of claim 8, wherein the CAR gene comprises a signal peptide, an antigen binding region, a hinge region, a transmembrane region, one or two costimulatory structures, and an activation region,

preferably, the signal peptide is selected from the group consisting of CD8, IL-2, GM-CSF signal peptide domain, preferably CD8 signal peptide domain, the amino acid sequence of which is shown in SEQ ID NO:31,

preferably, the antigen binding region is an antibody scFv or a corresponding ligand, preferably a CD19 antibody scFv, having the amino acid sequence shown in SEQ ID NO:29,

preferably, the hinge region is selected from the group consisting of IgG1, IgG4, IgD and CD8 hinge domains, preferably the CD8 hinge domain, the amino acid sequence of which is shown in SEQ ID NO:32,

preferably, the transmembrane region is selected from the group consisting of CD3, CD4, CD5, CD8, CD9, CD16, CD22, CD27, CD28, CD33, CD37, CD45, CD64, CD80, CD86, CD134, CD137, CD152, CD154 and PD1 transmembrane domain, preferably CD8, the amino acid sequence of which is shown in SEQ ID NO:33,

preferably, the co-stimulatory structure is selected from the group consisting of CD2, CD7, CD27, CD28, CD30, CD40, CD54, CD83, CD134, CD137, CD150, CD152, CD223, CD270, CD273, CD274, CD278, CARD11, NKD2C, DAP10, LAT, SLP76, ZAP70 and 4-1BB co-stimulatory domains, preferably 4-1BB co-stimulatory domains, the amino acid sequence of which is shown in SEQ ID NO:34,

preferably, the activation region is a CD3 zeta activation domain, and the amino acid sequence of the activation region is shown as SEQ ID NO. 35.

11. The method of claim 8, wherein the B2M-HLA-E gene is selected from the group consisting of: B2M-HLA-E structure 1 comprising, from the 5 'end to the 3' end, B2M signal region DNA, presentation polypeptide DNA, linker DNA, B2M non-signal region DNA, linker DNA and HLA-E gene; or B2M-HLA-E structure 2, which comprises, from 5 'end to 3' end, B2M signal region DNA, B2M non-signal region DNA, connector DNA, HLA-E gene.

12. The method according to claim 11, wherein the amino acid sequence of the B2M signal region DNA is shown as SEQ ID NO. 58, and the amino acid sequence of the B2M non-signal region DNA is shown as SEQ ID NO. 59.

13. The method of claim 11, wherein the presenting polypeptide sequence comprises VN ₂ APRTN ₇ N ₈ L，N ₂ Is an amino acid other than threonine, N ₇ Is valine or leucine, N ₈ Is valine, leucine or isoleucine, preferablyThe amino acid sequence of the polypeptide is shown as SEQ ID NO: 60.

14. The method according to claim 11, wherein the amino acid sequence of the linker DNA is as shown in SEQ ID NO 61 or 62.

15. The method of claim 11, wherein the HLA-E gene comprises the form: HLA-E0101, HLA-E0102, HLA-E0103 and HLA-E0104, preferably HLA-E0103, the amino acid sequence of which is shown in SEQ ID NO: 63.

16. The composition of claim 11, wherein the amino acid sequence of B2M-HLA-E structure 1 is shown in SEQ ID No. 30, and the amino acid sequence of B2M-HLA-E structure 2 is shown in SEQ ID No. 64.

17. The method of claim 6, wherein

When the TRAC site is knocked in and the TCR-alpha promoter is relied on, the repair template DNA is shown as SEQ ID NO. 39;

when the TRAC site is knocked in and a foreign promoter EF1 is relied on, the repair template DNA is shown as SEQ ID NO. 45;

when the B2M site is knocked in and the promoter of the B2M gene is relied on, the repair template DNA is shown as SEQ ID NO. 52.

18. The method according to claim 5, wherein the repair template vector is an adeno-associated virus, preferably an adeno-associated virus type 6 vector,

preferably, the method comprises mixing Cas9 protein-encoding mRNA with targeted sgrnas in vitro to form a mixture and transfecting (preferably electroporating) into a T cell; cloning the repair template DNA into plasmid and packaging into adeno-associated virus vector; adeno-associated viral vectors are added within 0 to 12 hours after RNA transfection (preferably electroporation).

19. The method of claim 5, wherein the repair template vector is a non-viral vector,

preferably, the method comprises mixing the Cas9 protein with the targeted sgRNA in vitro to form an RNP complex, or the Cas9 protein-encoding mRNA with the targeted sgRNA in vitro to form a mixture; performing PCR amplification of the repair template DNA using a modified primer to obtain a modified double-stranded DNA, wherein the modified primer comprises: i)5 '-Phosphorothioate (PS) modification along with 5' -Biotin-triethylene glycol (Biotin-TEG) modification; or ii) a 5' -Locked Nucleic Acid (LNA) modification; (iii) transfecting (preferably electrically transferring) the RNP complex or the mixture with the modified double stranded DNA into a T cell.

20. A double knock-in universal CAR-T cell prepared according to the method of any one of claims 1-19.

21. Use of the double-knock-in universal CAR-T cell according to claim 20 for the preparation of a medicament for the treatment of a disease.

22. The use according to claim 21, wherein the diseases comprise leukemia, solid tumors and autoimmune diseases,

preferably the leukemia is selected from acute B lymphocytic leukemia, acute T lymphocytic leukemia, NK lymphocytic leukemia, non-Hodgkin's lymphoma, chronic lymphocytic leukemia, acute myeloid leukemia and multiple myeloma,

preferably, the solid tumor is selected from lung cancer, liver cancer, stomach cancer, breast cancer, colorectal cancer, prostate cancer, pancreatic cancer, brain glioma, esophageal cancer, cholangiocarcinoma, endometrial cancer, ovarian cancer, mesothelioma and thymus cancer,

preferably, the autoimmune disease is aids.