WO2021197391A1

WO2021197391A1 - Method for preparing modified immune cell

Info

Publication number: WO2021197391A1
Application number: PCT/CN2021/084655
Authority: WO
Inventors: 王文博; 冯爱华; 郭佩佩; 林彦妮
Original assignee: 苏州克睿基因生物科技有限公司
Priority date: 2020-04-01
Filing date: 2021-03-31
Publication date: 2021-10-07
Also published as: CN111909966A; CN111909966B

Abstract

Provided is a method for preparing a modified immune cell, comprising applying to an immune cell a guide RNA targeting a nucleic acid molecule encoding CD70. Also provided are a CD70 knock-out immune cell obtained by the method and a cell group and a pharmaceutical composition comprising the immune cell. Also provided is a CRISPR/Cas system comprising the guide RNA and a Cas protein.

Description

A method for preparing modified immune cells

Technical field

This application relates to the field of biomedicine, in particular to a chimeric antigen receptor T cell, especially a chimeric antigen receptor T cell with CD70 knocked out, and its use.

Background technique

In recent years, with the development of tumor immunotherapy and clinical research progress, Chimeric Antigen Receptor-T cells (CAR-T) immunotherapy is currently one of the most promising tumor immunotherapies.

Although CAR-T has a good curative effect on blood system cancers, it has made slow progress in the field of solid tumors. The lack of effective targets for the treatment of solid tumors is one of the bottlenecks that limit CAR-T. CD70 is a member of the tumor necrosis factor (TNF) family, also known as the tumor necrosis factor receptor super-family (TNFSF) factor. CD70 is composed of a 193 amino acid polypeptide, with a 20 amino acid hydrophilic N-terminal domain and a C-terminal domain containing 2 potential N-linked glycosylation sites. Based on the above characteristics, CD70 is determined to be cellular Type II transmembrane protein of the outer C-terminal part. Under physiological conditions, CD70 is only transiently expressed in activated but not resting T cells, B cells, and mature dendritic cells (DCs). It has the ability to regulate the activation, proliferation and differentiation of T cells and B cells. Ability plays an important role in maintaining the body's immune response. In addition to normal cell expression, CD70 is also expressed at high levels in kidney cancer, glioblastoma, breast cancer and other tumor tissues, especially in kidney cancer. CD70 has also been reported to be highly expressed in acute myeloid leukemia stem cells. The high-level expression of CD70 in tumor tissues can not only induce immune escape, but also activate some immune cells to kill tumor cells. It may be used as a potential tumor treatment target, bringing a new direction to tumor immunotherapy.

However, because CD70 is also expressed when normal T cells are activated, after using T cells to prepare CAR-T, CAR-T cells targeting CD70 will seriously kill themselves when activating and killing tumor cells, leading to cell expansion. Limited, the ability to kill tumor cells is limited. Therefore, a new technology of immune cells is urgently needed.

Summary of the invention

This application provides a modified immune cell and a preparation method thereof. The CD70 gene of the immune cell is knocked out, and the immune cell can also express a chimeric antigen receptor. The preparation method described in this application can prevent CAR-T cells targeting tumor-specific antigens from killing themselves, can improve the expression efficiency of CAR molecules on the surface of T cells, and improve CAR dependence and cytokine (for example, IL-2 And IFN-γ) expression level. The method of the present application and the immune cells obtained by using the method, as well as cell populations and pharmaceutical compositions containing the immune cells have good killing and control effects on tumor cells.

In one aspect, the present application provides a method for preparing modified immune cells, which includes the following steps: administering to the immune cells a guide RNA targeting a nucleic acid molecule encoding CD70, wherein the guide RNA comprises SEQ ID NO: 29 The nucleotide sequence shown.

In some embodiments, the guide RNA sequence is 5'-(X)n-SEQ ID NO: 29-framework sequence-3', wherein X is selected from any base of A, U, C and G , N is any integer of 0-15.

In some embodiments, the n is 2.

In some embodiments, the guide RNA comprises the nucleotide sequence shown in SEQ ID NO:30.

In some embodiments, the guide RNA is a single-stranded guide RNA.

In some embodiments, the single-stranded guide RNA comprises the nucleotide sequence shown in any one of SEQ ID NO: 7-15.

In some embodiments, the guide RNA is a double-stranded guide RNA comprising crRNA and tracrRNA.

In some embodiments, the crRNA comprises the nucleotide sequence shown in any one of SEQ ID NO: 7-15.

In some embodiments, the guide RNA contains chemical modifications.

In certain embodiments, the method includes administering a Cas protein to immune cells.

In certain embodiments, the immune cells include T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, monocytes, dendritic cells, granulocytes, lymphocytes, white blood cells, and / Or peripheral blood mononuclear cells.

In some embodiments, the method further includes the step of down-regulating the expression and/or activity of T cell receptor alpha constant region protein and/or T cell receptor beta constant region protein in immune cells.

In some embodiments, the method further includes the step of down-regulating the expression and/or activity of MHC complexes in immune cells.

In certain embodiments, the MHC complex includes B2M.

In certain embodiments, the down-regulation includes down-regulation of the expression and/or activity of nucleic acid molecules encoding the T cell receptor alpha constant region protein, T cell receptor beta constant region protein and/or MHC complex; and/ Or, it includes down-regulating the expression and/or activity of the cell receptor α constant region protein, T cell receptor β constant region protein and/or MHC complex.

In some embodiments, the down-regulation includes administering to the immune cells one or more substances selected from the group consisting of antisense RNA, siRNA, shRNA, CRISPR/Cas system, RNA editing system such as ADAR, RNA guidance The endonucleases, zinc finger proteases, Mega-TAL nucleases, TALENs and Meganucleases.

In certain embodiments, the down-regulation includes administering to the immune cells a guide RNA that targets an exon portion of the nucleic acid molecule.

In some embodiments, the guide RNA targeting the nucleic acid molecule encoding the cell receptor alpha constant region protein comprises the nucleotide sequence shown in SEQ ID NO: 28.

In some embodiments, the guide RNA targeting the nucleic acid molecule encoding the B2M comprises the nucleotide sequence shown in any one of SEQ ID NOs. 33-36.

In some embodiments, the method further includes the step of causing the modified immune cell to include a chimeric antigen receptor (CAR) and/or a T cell receptor (TCR).

In some embodiments, the method includes the following steps: a-1) administering to immune cells the guide RNA described in this application targeting a nucleic acid molecule encoding CD70; 1) Modified immune cells include chimeric antigen receptor (CAR) and/or T cell receptor (TCR).

In some embodiments, the method includes the following steps: b-1) allowing immune cells to include chimeric antigen receptors (CAR) and/or T cell receptors (TCR); and b-2) The modified immune cells in step b-1) administer the guide RNA described in the present application targeting the nucleic acid molecule encoding CD70.

On the other hand, this application also provides modified immune cells prepared according to the method.

In certain embodiments, the immune cells include chimeric antigen receptors (CAR) and/or T cell receptors (TCR).

In certain embodiments, the immune cell includes a chimeric antigen receptor targeting a tumor-specific antigen, wherein the tumor-specific antigen is selected from the group consisting of CD70, CD19, CD20, CD123, EpCAM, and BCMA.

In certain embodiments, the chimeric antigen receptor comprises an antigen binding domain that specifically binds to the tumor-specific antigen.

In certain embodiments, the antigen binding domain comprises a single chain antibody.

In certain embodiments, the immune cells include single chain antibodies that target CD70.

In some embodiments, the single-chain antibody comprises the amino acid sequence shown in any one of SEQ ID NOs: 26-27.

In certain embodiments, the chimeric antigen receptor comprises a transmembrane domain, wherein the transmembrane domain comprises a transmembrane domain derived from a protein selected from: CD8, CD28, 4-1BB, CD4 , CD27, CD7, PD-1, CTLA-4, LAG-3, TCRα, TCRβ, TCRγ, TCRδ, CD3ε, CD3δ, CD3γ, CD3ζ, cytokine receptor, CD5, ICOS, OX40, NKG2D, 2B4, CD244, FcεR, FcεRIγ, BTLA, CD30, GITR, HVEM, DAP10, CD2, NKG2C, LIGHT, DAP12, CD40L, TIM1, CD226, DR3, CD45, CD80, CD86, CD9, CD16, CD22, CD33, CD37, CD64, CD134, CD137, CD154 and SLAM.

In certain embodiments, the chimeric antigen receptor comprises a costimulatory domain, wherein the costimulatory domain comprises a costimulatory domain selected from the following proteins or a combination thereof: CD28, CD137, CD27, CD2, CD7, CD8, CD80, CD86, OX40, CD226, DR3, SLAM, CDS, ICAM, NKG2D, NKG2C, B7-H3, 2B4, FcεRIγ, BTLA, GITR, HVEM, DAP10, DAP12, CD30, CD40, CD40L, TIM1 PD-1, PD-L1, PD-L2, 4-1BBL, OX40L, ICOS-L, CD30L, CD70, CD83, HLA-G, MICA, MICB, lymphotoxin β receptor, LFA-1, LIGHT, JAML, CD244, CD100, ICOS, CD83 ligand, CD40 and MyD88.

In certain embodiments, the chimeric antigen receptor comprises an intracellular signal transduction domain, wherein the intracellular signal transduction domain comprises an intracellular signal transduction domain derived from a protein selected from or Its combination: CD3zeta, CD3delta, CD3gamma, CD3ε, CD79a, CD79b, CD66d, CD5, CD22, FcRγ, FcRβ, FcRε, FceRIγ, FceRIβ, FcγRIIa, Bovine Leukemia Virus (BLV) gp30, Epstein-Barr Virus (EBV) LMP2A Simian immunodeficiency virus (SIV) PBj14Nef, Kaposi's sarcoma herpes virus (KSHV) K1, DAP10, DAP12, and a domain containing at least one immunoreceptor tyrosine activation motif (ITAM).

In some embodiments, the chimeric antigen receptor comprises a hinge region that connects the antigen binding domain and the transmembrane domain, and the hinge region comprises a protein derived from The hinge region: CD8, CD28, IgG, 4-1BB, CD4, CD27, CD7, PD-1 and CH2CH3.

In some embodiments, the chimeric antigen receptor comprises the amino acid sequence shown in any one of SEQ ID NOs: 21-22.

In certain embodiments, the immune cell includes a nucleic acid molecule encoding the chimeric antigen receptor.

In some embodiments, the nucleic acid molecule comprises the nucleotide sequence shown in any one of SEQ ID NO: 4-5.

On the other hand, the present application also provides a cell population that includes the immune cells described in the present application, and at least 80% of the immune cells in the cell population do not substantially express CD70.

On the other hand, the application also provides a pharmaceutical composition, the pharmaceutical composition comprising the immune cell described in the application and/or the cell population described in the application, and a pharmaceutically acceptable carrier.

On the other hand, this application also provides the use of the immune cells described in this application, the cell population described in this application, and/or the pharmaceutical composition described in this application in the preparation of medicines for the treatment of tumors.

In certain embodiments, the tumor includes kidney cancer, glioblastoma, breast cancer, and/or acute myeloid leukemia.

On the other hand, this application also provides a CRISPR/Cas system, which includes a guide RNA and a Cas protein, wherein the guide RNA comprises the nucleotide sequence shown in SEQ ID NO:29.

In some embodiments, the guide RNA comprises the nucleotide sequence shown in any one of SEQ ID NO: 7-15.

In some embodiments, the guide RNA contains chemical modifications.

In certain embodiments, the Cas protein includes a Cas9 protein.

Those skilled in the art can easily perceive other aspects and advantages of the present application from the detailed description below. In the following detailed description, only exemplary embodiments of the present application are shown and described. As those skilled in the art will recognize, the content of this application enables those skilled in the art to make changes to the disclosed specific embodiments without departing from the spirit and scope of the invention involved in this application. Correspondingly, the drawings and descriptions in the specification of the present application are only exemplary, and not restrictive.

Description of the drawings

The specific features of the invention involved in this application are shown in the appended claims. The characteristics and advantages of the invention involved in this application can be better understood by referring to the exemplary embodiments and the accompanying drawings described in detail below. A brief description of the drawings is as follows:

Figure 1 shows the expression efficiency of CD70 in the immune cells described in this application;

Figure 2 shows the expression efficiency of CD70 CAR in the immune cells described in this application;

Figure 3 shows the expression efficiency of CD70 in the tumor cells described in this application;

Figure 4 shows the release level of IL-2 after the immune cells described in this application are co-cultured with target cells;

Figure 5 shows the release level of IFN-γ after the immune cells described in this application are co-cultured with target cells;

Figure 6 shows the killing ability of the immune cells described in this application against 786-O cells;

Figure 7 shows the killing ability of the immune cells described in this application on Raji cells;

Figure 8 shows the killing ability of the immune cells described in this application on 293T-CD70 cells;

Figure 9 shows the killing ability of the immune cells described in the present application on 293T cells;

Figure 10 shows the expression efficiency of CD70 CAR in the immune cells described in this application;

Figure 11 shows the secretion of cytokine IL-2 by the immune cells described in this application;

Figure 12 shows the secretion of the cytokine IFN-γ from the immune cells described in this application;

Figure 13 shows the killing ability of the immune cells described in this application to 786-O cells;

Figure 14 shows the killing ability of the immune cells described in the present application on THP-1 cells;

Figure 15 shows the killing ability of the immune cells described in the present application on 293T cells;

Figure 16 shows the ability of immune cells described in this application to inhibit tumor growth.

Detailed ways

The following specific examples illustrate the implementation of the invention of this application. Those familiar with this technology can easily understand the other advantages and effects of the invention of this application from the content disclosed in this specification. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art related to the present invention.

Definition of Terms

In this application, the term "leukocyte" generally refers to a nucleated blood cell that has active mobility and can migrate from inside blood vessels to outside blood vessels, or from extravascular tissues to inside blood vessels. In addition to blood, white blood cells can also be present in the lymphatic system, spleen, tonsils, and other tissues of the body. In this application, the white blood cells may include granulocytes (such as neutrophils, eosinophils, basophils), agranulocytes (such as lymphocytes, monocytes, macrophages, phagocytes, Mast cells).

As used herein, the term "lymphocyte" refers to any monocytes, non-phagocytic leukocytes found in blood, lymph and lymphatic tissues, for example, the lymphocytes can be B lymphocytes, T lymphocytes or natural killer (NK) cell.

In this application, the term "peripheral blood mononuclear cell" (or peripheral blood mononuclear cell, PBMC) generally refers to any cell that has a single nucleus in the peripheral blood. For example, in the present application, the peripheral blood mononuclear cells may include T cells, B cells, NK cells, lymphocytes, monocytes and/or dendritic cells.

In this application, the term "Cas protein" also referred to as "CRISPR-related protein" generally refers to a class of enzymes complementary to the CRISPR sequence, which can use the CRISPR sequence as a guide to identify and cut a specific DNA strand. Non-limiting examples of Cas proteins include: Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csxl2), CaslO, Csyl, Csy2, Csy3, Csel, Cse2, Cscl , Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl4, CsxlO, Csxl6, Csxl6 , Csf2, Csf3, Csf4, and/or their homologues, or their modified forms. In some embodiments, the Cas protein is a Cas9 protein.

In this application, the term "Cas9 protein" or "Cas9 nuclease", also known as Csn1 or Csx12, generally refers to a type of protein in the type II CRISPR/Cas system that is involved in both crRNA biosynthesis and the destruction of invading DNA. Cas9 protein usually includes RuvC nuclease domain and HNH nuclease domain, which cut two different strands of double-stranded DNA molecules respectively. It has been used in different bacterial species such as S.thermophiles, Listeria innocua (Gasiunas, Barrangou et al. 2012; Jinek, Chylinski et al. 2012) and Streptococcus pyogenes (S. Pyogenes) (Deltcheva, Chylinski et al. 2011) describes the Cas9 protein. For example, for the Cas9 protein of Streptococcus pyogenes, see the SwissProt database accession number Q99ZW2 for its amino acid sequence; for the Neisseria meningitides Cas9 protein, see the UniProt database number A1IQ68 for its amino acid sequence; and Streptococcus thermophilus (Streptococcus thermophilus) Cas9 protein, its amino acid sequence is in UniProt database number Q03LF7; Staphylococcus aureus (Staphylococcus aureus) Cas9 protein, and its amino acid sequence is in UniProt database number J7RUA5.

In this application, the term "CD70" generally refers to a member of the tumor necrosis factor (TNF) family, which is a ligand of CD27. The CD70 of the present application may also include its functional variants and/or its functional fragments, which may be of natural origin or artificially synthesized. In some cases, an exemplary CD70 gene can be found in Genebank accession number: NM_001252.5. For example, the CD70 of the present application may include the nucleotide sequence shown in SEQ ID NO: 6, for example, the CD70 of the present application may include the amino acid sequence shown in SEQ ID NO: 23.

In this application, the terms "CRISPR/Cas system" or "CRISPR-Cas system" are used interchangeably, and generally refer to clusters of regularly spaced short palindrome repeats (CRISPR) and CRISPR binding protein (ie Cas protein) The composed nuclease system can cut almost all genomic sequences adjacent to the protospacer-adjacent motif (PAM) in eukaryotic cells (Cong et al. Science 2013.339:819-823). "CRISPR/Cas system" can be used to collectively refer to the transcripts of CRISPR-related ("Cas") genes, as well as other elements involved in their expression or directing their activities, and can include sequences encoding Cas genes, tracr (transactivation CRISPR) sequences (Such as tracrRNA or its active part), tracr partner sequence (in the context of endogenous CRISPR/Cas system, covering "direct repeats" and processed partial direct repeats), guide sequence (in the context of endogenous CRISPR/Cas system) Also called "spacer"), or other sequences and transcripts from the CRISPR locus. In certain embodiments, the CRISPR/Cas system may comprise one or more elements derived from the type I, type II, or type III CRISPR/Cas system. In some embodiments, one or more elements of the CRISPR/Cas system are derived from specific organisms that include the endogenous CRISPR system, such as Streptococcus pyogenes.

The formation of a CRISPR complex (comprising a guide sequence that hybridizes to a target sequence and complexes with one or more Cas proteins) results in the formation of the target sequence in or near (e.g., at 1, 2, 3, 4, 5, 6, Within 7, 8, 9, 10, 20, 50, or more base pairs) cleavage of one or two strands. The tracr sequence (which may comprise or consist of all or part of the wild-type tracr sequence (e.g., about or more than about 20, 26, 32, 45, 48, 54, 63, 67, 85, wild-type tracr sequence) Or more nucleotides)) can also form part of the CRISPR complex, such as by hybridizing along at least a part of the tracr sequence to all or part of the tracr partner sequence operably linked to the guide sequence. In some cases, the tracr sequence has sufficient complementarity with a tracr partner sequence to hybridize and participate in the formation of a CRISPR complex. In certain embodiments, when the alignment is performed, along the length of the tracr partner sequence, the tracr sequence has at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% sequence complementarity sex. In some cases, one or more vectors that drive the expression of one or more elements of the CRISPR system can be introduced into the host cell so that the expression of these elements of the CRISPR system directs the CRISPR at one or more target sites. The formation of complexes.

In general, the tracr partner sequence may include sufficient complementarity with the tracr sequence to promote the formation of a CRISPR complex at the target sequence, wherein the CRISPR complex includes a tracr partner sequence that hybridizes to the tracr sequence. Generally, the degree of complementarity is in terms of the best alignment of the tracr partner sequence and the tracr sequence along the length of the shorter of the two sequences. The optimal alignment can be determined by any suitable alignment algorithm, and the effects of secondary structure can be further taken into consideration, such as self-complementarity within the tracr sequence or tracr partner sequence. In the best alignment, the degree of complementarity between the tracr sequence and the tracr partner sequence along the length of the shorter of the two can be about or more than about 25%, 30%, 40%, 50% , 60%, 70%, 80%, 90%, 95%, 97.5%, 99%, or higher. The tracr sequence can be about or more than about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40 in length , 50 or more nucleotides.

In this application, in the context of CRISPR complex formation, the term "target sequence" generally refers to a sequence to which a guide sequence is designed to have complementarity, wherein the hybridization between the target sequence and the guide sequence can promote CRISPR The formation of complexes. Complete complementarity is not required, provided that there is sufficient complementarity to cause hybridization and promote the formation of a CRISPR complex. The target polynucleotide of the CRISPR complex can be any polynucleotide that is endogenous or exogenous to the eukaryotic cell. For example, the target polynucleotide may be a polynucleotide that resides in the nucleus of a eukaryotic cell. The target polynucleotide may be a sequence encoding a gene product (e.g., protein) or a non-coding sequence (e.g., regulatory polynucleotide or useless DNA). Without wishing to be bound by theory, the target sequence should be related to PAM (protospacer proximity motif); that is, related to a short sequence that can be recognized by the CRISPR complex.

In this application, the term "guide RNA" generally refers to the RNA component contained in CRISPR, and may also be referred to as guideRNA (gRNA). A guide RNA generally contains a guide sequence and a backbone sequence, and these two sequences can be in the same molecule or in different molecules. The role of the guide RNA can be to guide the Cas9 protein to cut the DNA site complementary to the guide sequence, or it can be the target sequence. In general, a guide sequence is any polynucleotide sequence that has sufficient complementarity with the target sequence to hybridize to the target sequence and direct the CRISPR complex to specifically bind to the target sequence. The degree of complementarity between the guide sequence and its corresponding target sequence is about or more than about 50% or more. Generally, the length of a guide sequence can be about or more than about 12 nucleotides. The backbone sequence is necessary in the guide RNA, and the remaining sequences except the guide sequence can generally include tracr sequence and tracr partner sequence, and these sequences generally will not change due to changes in the target sequence. The guide RNA may include single-stranded guide RNA (sgRNA) and double-stranded guide RNA composed of crRNA (CRISPR RNA) and tracrRNA (trans-activated crRNA). SgRNA can also be called a chimeric single-stranded guide RNA, which generally includes a guide sequence, a tracr partner sequence, and a tracr sequence.

In this application, the Cas protein, sgRNA and/or tracr partner sequence and tracrRNA sequence are operably linked to the same promoter and can be expressed. In some cases, the Cas enzyme, sgRNA, and/or tracr partner sequence and tracrRNA sequence may each be operably linked to separate regulatory elements located on separate vectors.

In this application, the term "MHC complex" is usually also called major histocompatibility complex (MHC), which is a collective term for a group of genes encoding animal major histocompatibility antigens. Human MHC is also called HLA (human leukocyte antigen, HLA) complex. Due to the multi-gene characteristics of MHC, based on the structure, tissue distribution and functional differences of its coding molecules, it can be divided into MHC class I, MHC class II, and MHC class III genes, which respectively code for MHC class I molecules, MHC class II molecules, and MHC III. Class molecule. MHC I molecules usually consist of four regions, three of which are located on the α chain (α1-α3), and β2 microglobulin (B2M) forms the fourth region. β-2 microglobulin, or B2M, is the light chain of class I MHC molecules and therefore is an indispensable part of the major histocompatibility complex (MHC). In the human genome, B2M is encoded by the b2m gene located on chromosome 15, while other MHC genes exist in the form of gene clusters on chromosome 6. The human B2M protein has 119 amino acids (see UniProt database code P61769).

As used herein, the term "T cell" generally refers to a type of thymus-derived cell that participates in various cell-mediated immune responses. For example, the T cells may include helper T cells (CD4 ⁺ T cells) and cytotoxic T cells (CTL, CD8 ⁺ T cells) including cytolytic T cells.

In this application, the term "T cell receptor (TCR)" generally refers to a specific receptor on the surface of T cells. The T cell receptor is a heterodimer and can contain two different subunits. Most T cell receptors (for example, 95% and above, 96% and above, 97% and above, etc.) contain α subunits and β subunits, and T cell receptors contain γ subunits and δ subunits. Each peptide chain can be divided into variable region (V region), constant region (C region), transmembrane region and cytoplasmic region. TCR can recognize processed polypeptide fragments that bind to MHC molecules. Because recognition requires the presentation of MHC molecules, it is also called MHC restriction. When the MHC molecules of the donor and recipient are different, TCR can recognize the difference in MHC and cause the activation and expansion of T cells, which may cause graft-versus-host disease (GvHD). Knockout of the TRAC gene can remove the expression of the TCRα chain, thereby removing the TCR from the surface of the T cell, and thus can prevent the TCR from recognizing allogeneic antigens and causing graft-versus-host disease.

In this application, the term "Chimeric Antigen Receptor (CAR)" generally refers to a fusion protein containing an extracellular domain capable of binding antigen and at least one intracellular domain. CAR is the core component of chimeric antigen receptor T cells (CAR-T), which may include antigen (for example, tumor-specific antigen and/or tumor-associated antigen) binding domain, transmembrane domain, costimulatory domain, and Intracellular signal domain. In the present application, the CAR can be combined with the T cell receptor activation intracellular domain based on the specificity of the antigen (eg CD70) of the antibody. Genetically modified T cells expressing CAR can specifically recognize and eliminate malignant cells expressing target antigens. For descriptions of CAR and CAR-T cells, see, for example, Sadelain M, Brentjens R, Rivi`ere I. The basic principles of chimeric antigen receptor design. Cancer Discov. 2013; 3(4): 388-398; Turtle CJ, Hudecek M, Jensen MC, Riddell SR. Engineered T cells for anti-cancer therapy. Curr Opin Immunol. 2012; 24(5): 633-639; Dotti G, Gottschalk S, Savoldo B, Brenner MK. Design and development of therapies using chimeric antigen receptor-expressing T cells. Immunol Rev. 2014; 257(1):107-126; and WO2013154760, WO2016014789.

In this application, the term "antigen-binding domain" generally refers to a domain capable of binding to a target antigen. The antigen-binding domain may include a chimeric antigen receptor and fragments thereof, antibodies or antigen-binding fragments thereof that can specifically bind to an antigen. The antigen binding domain can be of natural origin, synthetic origin, semi-synthetic origin, or recombinant origin. In some cases, the antigen-binding structure may comprise single-chain antibodies.

In this application, the term "antibody" generally refers to a polypeptide molecule that can specifically recognize and/or neutralize a specific antigen. For example, an antibody may comprise an immunoglobulin consisting of at least two heavy (H) chains and two light (L) chains interconnected by disulfide bonds, and includes any molecule comprising its antigen binding portion. The term "antibody" includes monoclonal antibodies, antibody fragments or antibody derivatives, including but not limited to human antibodies, humanized antibodies, chimeric antibodies, single domain antibodies (e.g., dAb), single chain antibodies (e.g., scFv), And antibody fragments that bind to the antigen (e.g., Fab, Fab' and (Fab)2 fragments). The term "antibody" also includes all recombinant forms of antibodies, such as antibodies expressed in prokaryotic cells, unglycosylated antibodies, and any antigen-binding antibody fragments and derivatives thereof described in this application. Each heavy chain can be composed of a heavy chain variable region (VH) and a heavy chain constant region. Each light chain can be composed of a light chain variable region (VL) and a light chain constant region. The VH and VL regions can be further divided into hypervariable regions called complementarity determining regions (CDR), which are interspersed in more conserved regions called framework regions (FR). Each VH and VL can be composed of three CDRs and four FR regions, which can be arranged in the following order from the amino terminus to the carboxy terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4. The variable regions of the heavy and light chains contain binding domains that interact with antigens.

In the present application, the term "single-chain antibody (scFv)" may be an antibody formed by the heavy chain variable region and the light chain variable region of the antibody, or comprising an antibody connected by a linker.

In this application, the term "transmembrane domain (Transmembrane Domain)" generally refers to the domain in the CAR that passes through the cell membrane, which is connected to the intracellular signal transduction domain and plays a role in transmitting signals.

In the present application, the term "costimulatory domain" generally refers to an intracellular domain that can provide immune costimulatory molecules, which are cell surface molecules required for effective response of lymphocytes to antigens.

In this application, the term "hinge region" generally refers to the connecting region between the antigen binding domain and the transmembrane region.

In this application, the term "signal transduction domain" generally refers to a domain located inside a cell capable of transducing signals. In the present application, the intracellular signal transduction domain can transmit signals into the cell. Generally, a signal transduction domain is any continuous amino acid sequence used to direct protein targeting. For example, the intracellular signaling domain is the intracellular signaling domain of the chimeric antigen receptor.

In this application, the term "immune cell" generally refers to a cell that participates in an immune response, such as promoting an immune effector response. Examples of immune cells include, but are not limited to, T cells, B cells, natural killer (NK) cells, mast cells, granulocytes, monocytes, lymphocytes, and macrophages. The term also includes engineered immune cells, such as immune cells that have been genetically modified by adding exogenous genetic material in the form of DNA or RNA to the total genetic material of the cell.

In this application, the terms "polypeptide", "peptide", "protein" and "protein" are used interchangeably and generally refer to polymers of amino acids having any length. The polymer can be linear or branched, it can contain modified amino acids, and can be interrupted by non-amino acids. These terms also cover amino acid polymers that have been modified. These modifications may include: disulfide bond formation, glycosylation, lipidation (Iipidation), acetylation, phosphorylation, or any other manipulation (such as binding to a labeling component). The term "amino acid" includes natural and/or unnatural or synthetic amino acids, including glycine and D and L optical isomers, as well as amino acid analogs and peptidomimetics.

The terms "polynucleotide", "nucleotide", "nucleotide sequence", "nucleic acid" and "oligonucleotide" are used interchangeably and generally refer to a polymeric form of nucleotides of any length, Such as deoxyribonucleotides or ribonucleotides, or their analogs. A polynucleotide can have any three-dimensional structure, and can perform any function, known or unknown. The following are non-limiting examples of polynucleotides: coding or non-coding regions of genes or gene fragments, multiple loci (one loci) defined by linkage analysis, exons, introns, messenger RNA (mRNA), Transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short hairpin RNA (shRNA), micro-RNA (miRNA), ribozyme, cDNA, recombinant polynucleotide, branched polynucleotide, plasmid, vector, any sequence Of isolated DNA, isolated RNA of any sequence, nucleic acid probes, and primers. A polynucleotide may contain one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modification of the nucleotide structure can be carried out before or after assembly of the polymer. The sequence of nucleotides can be interrupted by non-nucleotide components. Polynucleotides can be further modified after polymerization, such as by conjugation with labeled components.

In this application, the "vector" generally refers to a nucleic acid molecule capable of self-replication in a suitable host, and is used to transfer the inserted nucleic acid molecule into and/or between host cells. The vector may include a vector mainly used for inserting DNA or RNA into cells, a vector mainly used for replicating DNA or RNA, and a vector mainly used for expression of DNA or RNA transcription and/or translation. The carrier also includes a carrier having a variety of the above-mentioned functions. The vector may be a polynucleotide that can be transcribed and translated into a polypeptide when introduced into a suitable host cell. Generally, by culturing a suitable host cell containing the vector, the vector can produce the desired expression product.

In this application, the term "plasmid" usually refers to DNA molecules other than chromosomes or nucleoids in bacteria, yeasts and other organisms. They exist in the cytoplasm and have the ability to replicate autonomously, enabling them to maintain a constant copy in the progeny cells. Count and express the genetic information carried. Plasmids are used as gene carriers in genetic engineering research.

In this application, the term "retroviral vector" generally refers to a virus particle that can control and express foreign genes, but cannot self-package into a virus particle that has the ability to proliferate. Most of these viruses have reverse transcriptase. Retroviruses contain at least three genes: gag, which contains the genes that make up the virus's center and structure; pol, which contains the genes for reverse transcriptase, and env, which contains the genes that make up the virus coat. Through retroviral transfection, the retroviral vector can randomly and stably integrate its own genome and the foreign genes it carries into the host cell genome. For example, the CAR molecule can be integrated into the host cell.

In this application, the term "lentiviral vector" generally refers to a diploid RNA viral vector belonging to retrovirus. The lentiviral vector is based on the genome of the lentivirus. Many of the sequence structures related to the viral activity are removed to make it biologically safe, and then the sequence of the target gene required for the experiment is introduced into the genome skeleton And express the structure, and prepare it into a vector. Through lentiviral vector transfection, the retroviral vector can randomly and stably integrate its own genome and the foreign genes it carries into the host cell genome. For example, the CAR molecule can be integrated into the host cell.

In this application, the term "and/or" should be understood to mean any one of the optional items or two of the optional items.

In this application, the term "comprising" generally refers to the inclusion of explicitly specified features, but not excluding other elements.

In this application, the term "about" generally refers to a range of 0.5%-10% above or below the specified value, such as 0.5%, 1%, 1.5%, 2%, 2.5%, above or below the specified value. Variation within the range of 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or 10%.

Detailed description of the invention

Guide RNA and CRISPR/Cas system

In one aspect, the present application provides a method for preparing modified immune cells, which includes the following steps: administering to the immune cells a guide RNA targeting a nucleic acid molecule encoding CD70.

On the other hand, the present application provides a CRISPR/Cas system, which may include an RNA component, sometimes referred to as guide RNA (gRNA).

The guide RNA described in this application may include single-stranded guide RNA (sgRNA) and double-stranded guide RNA composed of crRNA (CRISPR RNA) and tracrRNA (trans-activated crRNA). In some embodiments, the guide RNA is a double-stranded structure composed of one crRNA and one tracrRNA. CrRNA generally contains a guide sequence and a tracr partner sequence, and tracrRNA generally contains a tracr sequence. In some embodiments, the guide RNA may be a single-stranded molecule, and the single-stranded molecule may include a guide sequence, a tracr partner sequence, and a tracr sequence. This single-stranded molecule is also called a chimeric single-stranded guide RNA (sgRNA). When the tracr sequence and the tracr partner sequence are contained in a single transcript, the hybridization between the two produces a transcript with a secondary structure (e.g., hairpin). The sequence used in the hairpin structure may be a loop forming sequence, for example, a sequence that may be four nucleotides in length, for example, the sequence used in the hairpin structure may have a sequence of the sequence GAAA. Longer or shorter loop sequences can also be used, such as alternative sequences. In some cases, these sequences may include triplets (e.g., AAA), as well as other nucleotides (e.g., C or G). Examples of loop forming sequences may include CAAA and AAAG. In some cases, the transcript or transcribed polynucleotide sequence may have at least two or more hairpins. In some specific cases, the transcript may have two, three, four, or five hairpins. In other cases, the transcript can have up to five hairpins. In some cases, the single transcript may also include a transcription termination sequence, for example, a Poly-U sequence, or for example, a six U nucleotide sequence. The present application provides a guide RNA targeting a nucleic acid molecule encoding CD70, wherein the guide RNA may include a molecule with a length of 17 nucleotides, for example, the guide RNA may include a core as shown in SEQ ID NO: 29 Nucleotide sequence: n1n2n3n4n5n6n7n8n9n10n11n12n13n14n15n16n17, where n1=A, C, G or U, n2=A, C, G or U, n3=A, C, G or U, n4=A, C, G or U, n5= C, G or U, n6 = A, C, G or U, n7 = A, C, G or U, n8 = C, G or U, n9 = A, C, G or U, n10 = A, C, G or U, n11 = A, C, G or U, n12 = A, C, G or U, n13 = C, G or U, n14 = A, C, G or U, n15 = A, C, G or U, n16=A, C, G or U, n17=A, C, G or U. For example, follow the order from the 5'end to the 3'end.

In some embodiments, the guide RNA described in the present application may include the nucleotide sequence shown in any one of SEQ ID NO: 7-15.

For example, the guide RNA described in this application may include the nucleotide sequence shown in SEQ ID NO: 7: GCUGGAUGCACACCACG. For example, the guide RNA described in this application may include the nucleotide sequence shown in SEQ ID NO: 8: GUGCGGCGCAGGCCCUA. For example, the guide RNA described in the present application may include the nucleotide sequence shown in SEQ ID NO: 9: CGCAGGGACGCACCCAUA. For example, the guide RNA described in this application may include the nucleotide sequence shown in SEQ ID NO: 10: CAUCCAGCGCUUCGCAC. For example, the guide RNA described in this application may include the nucleotide sequence shown in SEQ ID NO: 11: GAUCGCCGCGGCGAUGC. For example, the guide RNA described in this application may include the nucleotide sequence shown in SEQ ID NO: 12: ACCCCAAGUGACUCGAG. For example, the guide RNA described in this application may include the nucleotide sequence shown in SEQ ID NO: 13: CUACGUAUCCAUCGUGA. For example, the guide RNA described in this application may include the nucleotide sequence shown in SEQ ID NO: 14: UUGGUCCCAUUGGUCGC. For example, the guide RNA described in this application may include the nucleotide sequence shown in SEQ ID NO: 15: GGCUGCUUUGGUCCCAU.

In some cases, the guide RNA described in this application may include the nucleotide sequence shown in SEQ ID NO: 30: n1n2n3n4n5n6n7n8n9n10n11n12n13n14n15n16n17, where n1=A, C or G, n2=A, C, G or U, n3 = A, C, G or U, n4 = A, C, G, n5 = C or G, n6 = A, C, G or U, n7 = A, C, G or U, n8 = C, G or U, n9 = C, G or U, n10 = A, C or G, n11 = A, C, G or U, n12 = A, C, G or U, n13 = C, G or U, n14 = A, C or G, n15=A, C, G or U, n16=A, C, G or U, n17=A, C or G. For example, follow the order from the 5'end to the 3'end.

In some more specific cases, the guide RNA may include the nucleotide sequence shown in any one of SEQ ID NO: 7-13.

For example, the guide RNA described in this application may include the nucleotide sequence shown in SEQ ID NO: 7: GCUGGAUGCACACCACG. For example, the guide RNA described in this application may include the nucleotide sequence shown in SEQ ID NO: 8: GUGCGGCGCAGGCCCUA. For example, the guide RNA described in the present application may include the nucleotide sequence shown in SEQ ID NO: 9: CGCAGGGACGCACCCAUA. For example, the guide RNA described in this application may include the nucleotide sequence shown in SEQ ID NO: 10: CAUCCAGCGCUUCGCAC. For example, the guide RNA described in this application may include the nucleotide sequence shown in SEQ ID NO: 11: GAUCGCCGCGGCGAUGC. For example, the guide RNA described in this application may include the nucleotide sequence shown in SEQ ID NO: 12: ACCCCAAGUGACUCGAG. For example, the guide RNA described in this application may include the nucleotide sequence shown in SEQ ID NO: 13: CUACGUAUCCAUCGUGA. For example, follow the order from the 5'end to the 3'end.

In this application, the guide RNA sequence may be 5'-(X)n-SEQ ID NO: 29-skeleton sequence-3', where X can be selected from any base of A, U, C and G, n is any integer of 0-15. The value of n does not affect the function of the RNA. For example, n can be 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15. When n is any integer from 0 to 15, the guide RNAs of different lengths in this application can effectively recognize the target sequence and achieve the purpose of knockout. In some cases, n=13, in other cases, n=2.

The present application provides a guide RNA targeting a nucleic acid molecule encoding CD70. The guide RNA may include a sequence of 19 nucleotides in length. In some cases, the guide RNA may include the nucleotide sequence shown in SEQ ID NO: 58: n1n2n3n4n5n6n7n8n9n10n11n12n13n14n15n16n17n18n19, where n1=A, C, G or U, n2=C, G or U, n3= A, C, G or U, n4 = A, C, G or U, n5 = A, C, G or U, n6 = A, C, G or U, n7 = C, G or U, n8 = A, C, G or U, n9 = A, C, G or U, n10 = C, G or U, n11 = A, C, G or U, n12 = A, C, G or U, n13 = A, C, G or U, n14 = A, C, G or U, n15 = C, G or U, n16 = A, C, G or U, n17 = A, C, G or U, n18 = A, C, G or U, n19=A, C, G or U. For example, follow the order from the 5'end to the 3'end.

In some embodiments, the guide RNA described in the present application may include the nucleotide sequence shown in any one of SEQ ID NO: 49-57.

For example, the guide RNA described in this application may include the nucleotide sequence shown in SEQ ID NO: 49: GCGCUGGAUGCACACCACG. For example, the guide RNA described in this application may include the nucleotide sequence shown in SEQ ID NO: 50: CGGUGCGGCGCAGGCCCUA. For example, the guide RNA described in this application may include the nucleotide sequence shown in SEQ ID NO: 51: CCCGCAGGACGCACCCAUA. For example, the guide RNA described in this application may include the nucleotide sequence shown in SEQ ID NO: 52: UGCAUCCAGCGCUUCGCAC. For example, the guide RNA described in the present application may include the nucleotide sequence shown in SEQ ID NO: 53: GUGAUCGCCGCGGCGAUGC. For example, the guide RNA described in this application may include the nucleotide sequence shown in SEQ ID NO: 54: UCACCCCAAGUGACUCGAG. For example, the guide RNA described in this application may include the nucleotide sequence shown in SEQ ID NO: 55: AGCUACGUAUCCAUCGUGA. For example, the guide RNA described in this application may include the nucleotide sequence shown in SEQ ID NO: 56: CUUUGGUCCCAUUGGUCGC. For example, the guide RNA described in this application may include the nucleotide sequence shown in SEQ ID NO: 57: CGGGCUGCUUUGGUCCCAU.

In some cases, the guide RNA described in this application may include the nucleotide sequence shown in SEQ ID NO: 59: n1n2n3n4n5n6n7n8n9n10n11n12n13n14n15n16n17n18n19, where n1=A, C, G or U, n2=C, G or U, n3 = A, C or G, n4 = A, C, G or U, n5 = A, C, G or U, n6 = A, C, G, n7 = C or G, n8 = A, C, G or U, n9 = A, C, G or U, n10 = C, G or U, n11 = C, G or U, n12 = A, C or G, n13 = A, C, G or U, n14 = A, C, G or U, n15=C, G or U, n16=A, C or G, n17=A, C, G or U, n18=A, C, G or U, n19=A, C or G. For example, follow the order from the 5'end to the 3'end.

In some more specific cases, the guide RNA may comprise the nucleotide sequence shown in any one of SEQ ID NO: 49-55.

For example, the guide RNA described in this application may include the nucleotide sequence shown in SEQ ID NO: 49: GCGCUGGAUGCACACCACG. For example, the guide RNA described in this application may include the nucleotide sequence shown in SEQ ID NO: 50: CGGUGCGGCGCAGGCCCUA. For example, the guide RNA described in this application may include the nucleotide sequence shown in SEQ ID NO: 51: CCCGCAGGACGCACCCAUA. For example, the guide RNA described in this application may include the nucleotide sequence shown in SEQ ID NO: 52: UGCAUCCAGCGCUUCGCAC. For example, the guide RNA described in the present application may include the nucleotide sequence shown in SEQ ID NO: 53: GUGAUCGCCGCGGCGAUGC. For example, the guide RNA described in this application may include the nucleotide sequence shown in SEQ ID NO: 54: UCACCCCAAGUGACUCGAG. For example, the guide RNA described in this application may include the nucleotide sequence shown in SEQ ID NO: 55: AGCUACGUAUCCAUCGUGA. For example, follow the order from the 5'end to the 3'end.

In some cases, the guide RNA may include a backbone sequence, and the backbone sequence does not affect the recognition of the target sequence by the sgRNA. Therefore, the backbone sequence may be any feasible sequence in the prior art. The backbone sequence generally includes the tracr partner sequence and the tracr sequence. The structure of the skeleton sequence can be found in the literature Nowak et al. Nucleic Acids Research 2016.44:9555-9564 in Figure 1 (Figure 1), A and B, Figure 3 (Figure 3), A, B, C, and Figure 4( Figure 4) The parts other than the spacer sequence described in A, B, C, D, and E.

The backbone sequence of this application can be derived from the backbone sequence described in the PCT application publication WO2019011118A1, for example, it can be the nucleotide sequence shown in any one of SEQ ID NO: 39-48 (listed as 5'to 3') , Where the first region in lowercase font represents the tracr partner sequence, and the second region in lowercase font represents the tracr sequence, and the last poly-U sequence represents the transcription terminator. The number of U in poly-U is not limited to that shown in this example, and can be increased or decreased. In some cases, poly-U can be removed without affecting activity. In some cases, it is possible to use backbone sequences with a similarity of about or more than about 50%, 60%, 70%, 80%, 90% or more to the following sequences. In some cases, the tracr sequence may be a separate transcript from the transcript containing the tracr partner sequence. In some cases, the chimeric single-stranded guide RNA (sgRNA) design can incorporate a duplex structure of at least 12 bp between the direct repeat and the tracrRNA. In some cases, it contains the key RNA secondary structure that binds to the Cas9 protein, but the sequence is mutated or the design containing the inserted sequence can also be used, such as the published literature Nowak et al. Nucleic Acids Research 2016.44:9555 -9564 and Adamson et al. Cell 2016.167:1867-1882.

Table 1 Exemplary skeleton sequence

The backbone sequence of the present application may include the nucleotide sequence shown in any one of SEQ ID NO: 37-38, for example, the backbone sequence may include the nucleotide sequence shown in SEQ ID NO: 37.

In this application, the guide RNA may be a single-stranded guide RNA. In other cases, the guide RNA may be a double-stranded guide RNA including crRNA and tracrRNA.

CrRNA generally contains a guide sequence and a tracr partner sequence, and tracrRNA generally contains a tracr sequence. Generally speaking, the guide sequence has a certain complementarity with the target sequence, and the tracr partner sequence has a certain complementarity with the tracr sequence. The structure of the Tracr partner sequence (also called the same direction repeat sequence) and the tracr sequence are usually as described in Figure 1 (Figure 1) in the literature (Nowak et al. Nucleic Acids Research 2016.44:9555-9564) except for the spacer sequence. The complementary part of the tracr partner sequence and the tracr sequence can be truncated by 1 to 10 base pairs (base pair) and still have good activity, as in the literature (Cong et al. Science 2013.339:819-23) Figure 2 (Figure 2) except for the spacer sequence and the guide sequence described in B.

This application provides crRNA, and the crRNA may include the nucleotide sequence shown in SEQ ID NO: 29: n1n2n3n4n5n6n7n8n9n10n11n12n13n14n15n16n17, where n1=A, C, G or U, n2=A, C, G or U, n3 =A, C, G or U, n4 = A, C, G or U, n5 = C, G or U, n6 = A, C, G or U, n7 = A, C, G or U, n8 = C , G or U, n9 = A, C, G or U, n10 = A, C, G or U, n11 = A, C, G or U, n12 = A, C, G or U, n13 = C, G Or U, n14=A, C, G or U, n15=A, C, G or U, n16=A, C, G or U, n17=A, C, G or U. For example, follow the order from the 5'end to the 3'end.

In some embodiments, the crRNA described in the present application may include the nucleotide sequence shown in any one of SEQ ID NO: 7-15.

For example, the crRNA described in this application may include the nucleotide sequence shown in SEQ ID NO: 7: GCUGGAUGCACACCACG. For example, the crRNA described in this application may include the nucleotide sequence shown in SEQ ID NO: 8: GUGCGGCGCAGGCCCUA. For example, the crRNA described in the present application may include the nucleotide sequence shown in SEQ ID NO: 9: CGCAGGAACGCACCCAUA. For example, the crRNA described in the present application may include the nucleotide sequence shown in SEQ ID NO: 10: CAUCCAGCGCUUCGCAC. For example, the crRNA described in the present application may include the nucleotide sequence shown in SEQ ID NO: 11: GAUCGCCGCGGCGAUGC. For example, the crRNA described in the present application may include the nucleotide sequence shown in SEQ ID NO: 12: ACCCCAAGUGACUCGAG. For example, the crRNA described in the present application may include the nucleotide sequence shown in SEQ ID NO: 13: CUACGUAUCCAUCGUGA. For example, the crRNA described in this application may include the nucleotide sequence shown in SEQ ID NO: 14: UUGGUCCCAUUGGUCGC. For example, the crRNA described in this application may include the nucleotide sequence shown in SEQ ID NO: 15: GGCUGCUUUGGUCCCAU.

In this application, the crRNA sequence may be 5'-(X)n-SEQ ID NO: 29-skeleton sequence-3', wherein X can be selected from any base of A, U, C and G, n It is any integer of 0-15. The value of n does not affect the function of the crRNA. For example, n can be 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15. When n is any integer from 0 to 15, the crRNAs of different lengths in the present application can effectively recognize the target sequence and achieve the purpose of knockout. In some cases, n=13, in other cases, n=2.

On the other hand, this application also provides tracr partner sequences and tracrRNA sequences. In general, the tracr partner sequence may include any sequence that has sufficient complementarity with the tracrRNA sequence to promote one or more of the following functions: (1) Excision of sgRNA flanking the tracr partner sequence in cells containing the corresponding tracrRNA sequence And (2) forming a CRISPR complex at the target sequence, wherein the CRISPR complex may include a tracr partner sequence that hybridizes to a tracrRNA sequence. Generally, the degree of complementarity is in terms of the best alignment of the tracr partner sequence and the tracrRNA sequence along the length of the shorter of the two sequences. The optimal alignment can be determined by any suitable alignment algorithm, and the secondary structure can be further calculated, such as the self-complementarity of the tracrRNA sequence or the tracr partner sequence itself. In some cases, the tracrRNA sequence and the tracr partner sequence may be included in a single transcript, such that a hybridization between the two produces a transcript with a secondary structure (such as a hairpin). The tracrRNA sequence may have sufficient complementarity with the tracr partner sequence to hybridize and participate in the formation of a CRISPR complex.

The guide RNA of the present application may also include modifications (e.g., chemical modifications), for example, deletion, insertion, translocation, inactivation, and/or activation of nucleotides. The modification may include introducing one or more mutations (including single or multiple base pair changes), increasing the number of hairpins, cross-linking, breaking specific nucleotide stretches, and other modifications. Modifications can include the inclusion of at least one non-naturally occurring nucleotide, or one modified nucleotide, or an analog thereof. The guide RNA may be modified at ribose, phosphate and/or base moieties. The modified guide RNA may include 2'-O-methyl analogs, 2'-deoxy analogs, or 2'-fluoro analogs. The nucleic acid backbone of the guide RNA can be modified, for example, a phosphorothioate backbone can be used. Locked nucleic acid (LNA) or bridged nucleic acid (BNA) can also be used. Examples of modifications in the guide RNA may also include, but are not limited to: 2-aminopurine, 5-bromo-uridine, pseudouridine, inosine, 7-methylguanosine. These modifications can be applied to any component of the CRISPR system of this application. In some cases, these modifications can be made to RNA components (e.g., the guide RNA or chimeric polynucleotide sequence). For example, the chemical modification of the guide RNA may include 2'-methoxy and/or 3'-phosphorothioate modification. In some cases, it contains the key RNA secondary structure that binds to the Cas9 protein, but the sequence is mutated or the design containing the inserted sequence can also be used, such as the published literature Nowak et al. Nucleic Acids Research 2016.44:9555 -9564 and Adamson et al. Cell 2016.167:1867-1882.

Generally speaking, the CRISPR/Cas system is characterized by an element that promotes the formation of a CRISPR complex (also called a protospacer in the context of an endogenous CRISPR system) at the site of the target sequence. In the context of CRISPR complex formation, "target sequence" refers to a sequence to which the guide RNA is designed to have complementarity, wherein the hybridization between the target sequence and the guide RNA promotes the formation of the CRISPR complex. Full complementarity is not necessary, as long as there is sufficient complementarity to cause hybridization and promote the formation of CRISPR complexes. A target sequence can contain any polynucleotide, such as DNA or RNA polynucleotide.

In certain embodiments, the methods of the present application may include administering one or more of the Cas proteins to host cells (e.g., immune cells).

In another aspect, this application provides a CRISPR enzyme. In some cases, the CRISPR enzyme may be a type II CRISPR system enzyme. In some cases, the CRISPR enzyme may be a Cas9 protein. In certain embodiments, the Cas9 protein may be a Streptococcus pneumoniae, Streptococcus pyogenes, or Streptococcus thermophilus Cas9 protein, and may include mutant Cas9 proteins derived from these organisms. The Cas protein can also be a homolog or ortholog of Cas9 protein. The system described in this application may include the Cas protein.

The Cas protein may comprise any other protein, and optionally a linking sequence between any two domains. Examples of proteins that can be fused to the Cas protein include, but are not limited to, epitope tags, reporter genes, and protein domains having one or more of the following activities: methylase activity, demethylase activity, transcription activation Activity, transcription repressive activity, transcription release factor activity, histone modification activity, RNA cleavage activity and nucleic acid binding activity.

In the present application, the method may include the following steps: a-1) administering the guide RNA of the present application targeting a nucleic acid molecule encoding CD70 to immune cells; ) Modified immune cells include chimeric antigen receptor (CAR) and/or T cell receptor (TCR). In this application, the method can be referred to as a "knockout before transfection" method.

For example, the method may first administer the guide RNA described in this application that targets a nucleic acid molecule encoding CD70 to immune cells to construct CD70 knockout T cells. Prepare a CD70 chimeric antigen receptor (CAR) (for example, a plasmid containing a nucleic acid molecule encoding CD70 CAR can be prepared (such as a viral plasmid, such as a lentivirus)), and then CD70 knockout T cells are transfected with the plasmid. Express CD70 CAR. For example, the method can obtain the CD70KO-CAR-T-01B, CD70KO-CAR-T-02B and CD70KO-CAR-T-03B cells described in this application.

In this application, the modified immune cells obtained by using the "knockout and transfection" method can have a more specific killing effect on tumor cells (for example, tumor cells expressing CD70).

In this application, the method may include the following steps: b-1) making immune cells include chimeric antigen receptors (CAR) and/or T cell receptors (TCR); and b-2) Step b-1) The modified immune cell administers the guide RNA described in the present application targeting the nucleic acid molecule encoding CD70. In this application, the method can be referred to as a "transfection first and then knockout" method.

For example, the method can prepare a CD70 chimeric antigen receptor (CAR) (for example, a plasmid containing a nucleic acid molecule encoding CD70 CAR can be prepared (such as a viral plasmid, such as a lentivirus)), and the plasmid can be transfected into T cells Thereby, the T cell expresses CD70 CAR; and then the guide RNA of the present application targeting the nucleic acid molecule encoding CD70 is administered to the T cell modified by the transfection. For example, the method can obtain the CD70KO-CAR-T-01A, CD70KO-CAR-T-02A and CD70KO-CAR-T-03A cells described in this application.

Immune cells, cell populations and pharmaceutical compositions

In another aspect, the present application provides a modified immune cell. The immune cells may include T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, monocytes, dendritic cells, granulocytes, lymphocytes, leukocytes, and/or peripheral blood mononuclei cell. In some cases, the immune cells may include T lymphocytes. The T lymphocytes may include thymocytes, natural T lymphocytes, immature T lymphocytes, mature T lymphocytes, resting T lymphocytes or activated T lymphocytes. The T cell may be a helper T cell (Th), such as a helper T cell 1 (Th1) or a helper T cell 2 (Th2) cell. The T lymphocytes may be CD4 ⁺ helper T cells (HTL; CD4 ⁺ T cells), cytotoxic T cells (CTL; CD8 ⁺ T cells), tumor infiltrating cytotoxic T cells (TIL; CD8 ⁺ T cells), CD4 ^⁺ / CD8 ⁺ T cells, CD4 ^{^-} / CD8 ^- T cells or any other subtypes of T lymphocytes. In some cases, the modified T cell is a human T cell. Before expanding and genetically modifying the cells of the present application, a source of cells can be obtained from a subject, such as a patient, by various non-limiting methods. T cells can be obtained from many non-limiting sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, cord blood, thymus tissue, tissue at the site of infection, ascites, pleural effusion, spleen tissue, and tumors. In some cases, any number of T cell lines available and known to those skilled in the art can be used. In other cases, the cells may be derived from a healthy donor, from a patient diagnosed with cancer, or obtained from a patient diagnosed with an infection. In other cases, the cell is part of a mixed population of cells with different phenotypic characteristics.

In some cases, the immune cells may include B cells. In some cases, the B cells may include effector B cells (plasma cells) and memory B cells. The B cells may include B2 cells, B1 cells, marginal zone B cells, follicular B cells, and regulatory B cells. In some cases, the immune cells may include macrophages. The B cells may include type I macrophages (M1) and type II macrophages (such as M2a, M2B, M2c). In some cases, the immune cells may include NK cells. In some cases, the NK cells may include CD56bright and CD56dim. In some cases, the NK cells may include NK1 and NK2. In some cases, the NK cells may include A-NK and NA-NK.

In the present application, the immune cell may be a "universal type" immune cell. For example, the TCR in the immune cell may be knocked out and/or inactivated.

The expression and/or activity of the T cell receptor α constant region protein and/or the T cell receptor β constant region protein in the immune cell is down-regulated. In some cases, the down-regulation may include down-regulating the expression and/or activity of the nucleic acid molecule encoding the cell receptor alpha constant region protein and/or the T cell receptor beta constant region protein; and/or, including down-regulating the cell receptor alpha constant region protein and/or T cell receptor beta constant region protein. The expression and/or activity of cell receptor alpha constant region protein and/or T cell receptor beta constant region protein.

In some cases, the down-regulation may include administering to the immune cells one or more substances selected from the group consisting of antisense RNA, siRNA, shRNA, CRISPR/Cas system, RNA editing system such as ADAR, RNA guidance The endonucleases, zinc finger proteases, Mega-TAL nucleases, TALENs and Meganucleases. In some cases, the down-regulation may include administering to the immune effector cells targeting the nucleic acid molecule (e.g., a nucleic acid encoding the cell receptor alpha constant region protein and/or the T cell receptor beta constant region protein). Molecule) The guide RNA of the exon part. For example, the guide RNA targeting the nucleic acid molecule encoding the cell receptor alpha constant region protein may comprise the nucleotide sequence shown in SEQ ID NO: 28.

The expression and/or activity of the MHC complex in the immune cell is down-regulated. In some cases, the down-regulation may include down-regulating the expression and/or activity of the nucleic acid molecule encoding the cellular MHC complex; and/or, including down-regulating the expression and/or activity of the cellular MHC complex protein.

In some cases, the down-regulation may include administering to the immune cells one or more substances selected from the group consisting of antisense RNA, siRNA, shRNA, CRISPR/Cas system, RNA editing system such as ADAR, RNA guidance The endonucleases, zinc finger proteases, Mega-TAL nucleases, TALENs and Meganucleases. In some cases, the down-regulation may include administering to the immune effector cell a guide RNA that targets the exon portion of the nucleic acid molecule (e.g., a nucleic acid molecule encoding the MHC complex of the cell). In some cases, the MHC complex may comprise B2M. The guide RNA targeting the nucleic acid molecule encoding the B2M may use the guide RNA in the prior art. For example, the guide RNA targeting the nucleic acid molecule encoding the B2M may include any one of SEQ ID NO. 33-36. The nucleotide sequence shown.

In the present application, the immune cells described in the present application may include chimeric antigen receptors (CAR) and/or T cell receptors (TCR).

In the present application, the CAR may comprise a chimeric antigen receptor targeting a tumor-specific antigen, wherein the tumor-specific antigen is selected from the following group: CD70, CD19, CD20, CD123, EpCAM and BCMA.

In some cases, the CAR may comprise an antigen binding domain. The antigen binding domain can specifically bind to a tumor antigen, wherein the tumor specific antigen is selected from the group consisting of CD70, CD19, CD20, CD123, EpCAM and BCMA. In some cases, the antigen binding domain may include a single chain antibody scFv. In some more specific cases, the single-chain antibody may be a single-chain antibody that targets CD70. For example, the single-chain antibody may comprise the amino acid sequence shown in any one of SEQ ID NO: 26-27.

In this application, the CAR may comprise a transmembrane domain. In some cases, the transmembrane domain may comprise a transmembrane domain derived from a protein selected from: CD8, CD28, 4-1BB, CD4, CD27, CD7, PD-1, CTLA-4, LAG -3, TCRα, TCRβ, TCRγ, TCRδ, CD3ε, CD3δ, CD3γ, CD3ζ, cytokine receptor, CD5, ICOS, OX40, NKG2D, 2B4, CD244, FcεR, FcεRIγ, BTLA, CD30, GITR, HVEM, DAP10, CD2, NKG2C, LIGHT, DAP12, CD40L, TIM1, CD226, DR3, CD45, CD80, CD86, CD9, CD16, CD22, CD33, CD37, CD64, CD134, CD137, CD154 and SLAM.

In this application, the CAR may include a costimulatory domain. In some cases, the costimulatory domain may comprise a costimulatory domain selected from the following proteins or a combination thereof: CD28, CD137, CD27, CD2, CD7, CD8, CD80, CD86, OX40, CD226, DR3, SLAM, CDS, ICAM, NKG2D, NKG2C, B7-H3, 2B4, FcεRIγ, BTLA, GITR, HVEM, DAP10, DAP12, CD30, CD40, CD40L, TIM1, PD-1, PD-L1, PD-L2, 4- 1BBL, OX40L, ICOS-L, CD30L, CD70, CD83, HLA-G, MICA, MICB, lymphotoxin β receptor, LFA-1, LIGHT, JAML, CD244, CD100, ICOS, CD83 ligand, CD40 and MyD88 .

In this application, the CAR may comprise an intracellular signal transduction domain, wherein the intracellular signal transduction domain may comprise an intracellular signal transduction domain derived from a protein selected from the group consisting of: CD3zeta , CD3delta, CD3gamma, CD3ε, CD79a, CD79b, CD66d, CD5, CD22, FcRγ, FcRβ, FcRε, FceRIγ, FceRIβ, FcγRIIa, bovine leukemia virus (BLV) gp30, Epstein-Barr virus (EBV) LMP2A, simian immunodeficiency virus (SIV) PBj14Nef, Kaposi's sarcoma herpes virus (KSHV) K1, DAP10, DAP12, and a domain containing at least one immunoreceptor tyrosine activation motif (ITAM).

In the present application, the CAR may include a hinge region, and the hinge region may connect the antigen binding domain and the transmembrane domain. In some cases, the hinge region may comprise a hinge region derived from a protein selected from the group consisting of CD8, CD28, IgG, 4-1BB, CD4, CD27, CD7, PD-1, and CH2CH3.

In the present application, the CAR may include an antigen binding domain, a hinge region, a transmembrane domain, a costimulatory domain, and/or a signal transduction domain. For example, the CAR may include the amino acid sequence shown in any one of SEQ ID NO: 21-22.

The modified immune cell described in the present application may include the CAR. For example, the CAR may include the amino acid sequence shown in any one of SEQ ID NO: 21-22.

The modified immune cell described in this application may include a nucleic acid molecule encoding the CAR. For example, the nucleic acid molecule encoding the CAR may include the amino acid sequence shown in any one of SEQ ID NO: 4-5.

On the other hand, the present application provides a cell population, the cell population may comprise the immune cell, and at least 80% (for example, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 95%, at least 98%, at least 99% or more) immune cells basically CD70 is not expressed on it. Substantially not expressing can include not substantially expressing CD70 protein, not transcribing CD70 RNA, and/or not substantially replicating CD70 DNA. In this application, the term "substantially not expressed" generally means that no protein and/or nucleotide expression can be detected using conventional means. For example, flow cytometry can be used to detect the expression of CD70 protein. For another example, genomic DNA can be extracted first, and then TIDE analysis can be used to detect the nucleic acid expression status of CD70.

Pharmaceutical composition, method, use and carrier

In another aspect, the present application provides a pharmaceutical composition. The pharmaceutical composition may comprise the immune cells of the present application and/or the cell population of the present application, and a pharmaceutically acceptable carrier. In this application, the term "pharmaceutically acceptable carrier" generally refers to any and all solvents, dispersion media, coatings, antibacterial agents that are compatible with the administration of immune cells and/or cell populations of this application. And antifungal agents, isotonic agents and absorption delay agents. Unless it is incompatible with the immune cells of the present application and/or the cell population of the present application, any conventional medium or reagent can be considered for use in the pharmaceutical composition of the present application.

In some aspects, the methods of the present application can include administering one or more of the Cas proteins to host cells (e.g., immune cells). In some cases, the method of the present application may include administering one or more of the tracr partner sequence and tracrRNA sequence to a host cell (e.g., immune cell). The method of the present application also includes delivering the one or more guide RNAs, the one or more vectors or one or more transcription forms thereof to host cells (for example, immune cells), and/or one One or more proteins. In some aspects, the application further provides cells produced by the methods and organisms (such as animals, plants, or fungi) that include the cells or are produced by the cells. In some cases, Cas enzyme combined with guide RNA can be delivered to the cell. Conventional viral and non-viral based gene transfer methods can be used to introduce nucleic acid sequences into mammalian cells or target tissues. The method of the present application can be used to introduce nucleic acid encoding the CRISPR/Cas system into cells in culture or in a host organism. Non-viral vector delivery systems include DNA plasmids, RNA (e.g., guide RNA), naked nucleic acids, and nucleic acids complexed with delivery excipients (e.g., liposomes). Viral vector delivery systems include DNA and RNA viruses, which have episomal or integrated genomes after being delivered to cells.

In another aspect, the present application provides a vector, which can contain the isolated nucleic acid molecule. In this application, the vector may be selected from one or more of plasmids, retroviral vectors and lentiviral vectors. For example, the vector of the present application contains the following nucleotide sequences in sequence from the 5'end: a gene encoding the CD70 single-chain antibody, a CD8a hinge region, a CD8a transmembrane region, and a 4-1BB intracellular domain. The gene and the gene encoding the CD3ζ activation domain. In addition, the vector may also contain other genes, such as a marker gene that allows the vector to be selected in a suitable host cell and under suitable conditions. In addition, the vector may also contain expression control elements that allow the coding region to be correctly expressed in a suitable host. Such control elements are well known to those skilled in the art. For example, they may include promoters, ribosome binding sites, enhancers, and other control elements that regulate gene transcription or mRNA translation. In some embodiments, the expression control sequence is a tunable element. The specific structure of the expression control sequence may vary according to the function of the species or cell type, but usually includes 5'non-transcribed sequences and 5'and 3'non-translated sequences involved in transcription and translation initiation, such as TATA box, plus Cap sequence, CAAT sequence, etc. For example, the 5' non-transcriptional expression control sequence may include a promoter region, and the promoter region may include a promoter sequence for transcriptional control functionally linked to the nucleic acid. One or more nucleic acid molecules described in this application can be operably linked to the expression control element.

Nucleic acid non-viral delivery methods include lipofection, nuclear transfection, microinjection, gene gun, viral particles, liposomes, immunoliposomes, polycation or lipid nucleic acid conjugates, naked DNA, artificial virions And reagents to enhance DNA uptake. RNA or DNA virus-based systems can be used to deliver nucleic acids. For example, the virus can be targeted to specific cells in the body to effectively load the virus into the nucleus. The viral vector may be directly administered to the patient (in vivo) or may be in an indirect form, for example, the virus is used to treat cells in vitro, and then the treated cells are administered to the patient (ex vivo). Conventional virus-based systems can include retroviral vectors, lentiviral vectors, adenovirus vectors, adeno-associated virus vectors, and herpes simplex virus vectors for gene transfer. In some cases, retroviruses, lentiviruses, and adeno-associated viruses can be used to transfer genes into the host genome to allow long-term expression of the inserted genes. Lentiviral vectors are retroviral vectors that can transduce or infect non-dividing cells and typically produce higher viral titers. The lentiviral vector may include a long terminal repeat sequence 5'LTR and a truncated 3'LTR, RRE, rev response element (cPPT), central termination sequence (CTS) and/or post-translational regulatory element (WPRE). The molecule can be constructed on the lentiviral vector by digestion with BamHI and SalI. The choice of retroviral gene transfer system will depend on the target tissue.

For example, a single vector may contain 1 or more (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 or more A) the guide RNA. In some cases, one or more (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 or More than one) the vector containing the target sequence, and optionally delivering it to the cell.

The method of the present application may include introducing the vector described in the present application into immune effector cells. For example, the vector described in this application can be introduced into the immune effector cells, such as T lymphocytes, B cells, macrophages or natural killer (NK) cells. In certain embodiments, each or each cell may contain one or one of the vectors described in this application. In certain embodiments, each or each cell may contain multiple (e.g., 2 or more) or multiple (e.g., 2 or more) vectors described in the present application. For example, the vector described in this application can be introduced into the cell. For example, a retroviral vector can be used to transfect immune effector cells, and the viral genome with the nucleic acid encoding the fusion protein can be integrated into the host genome to ensure long-term and stable expression of the target gene. For another example, a transposon is used to introduce a plasmid carrying the nucleic acid encoding the fusion protein and a plasmid carrying a transposase into the target cell. For another example, nucleic acid molecules can be added to the genome by means of gene editing (such as CRISPR/Cas9). In this application, the vector with the nucleic acid encoding the fusion protein described in this application can be introduced into the cell by methods known in the art. Non-limiting examples include viral transduction, electroporation transfection , Liposome delivery, polymer carrier, chemical carrier, lipid complex, polymer complex, dendrimer, nanoparticle, emulsion, natural endocytic or phagocytic pathway, cell penetrating peptide, microinjection, micro Needle delivery method, particle bombardment method, etc.

For example, the electroporation transfection method can be used, and non-limiting examples of electroporation instruments that can be used include: Neon Transfection System (Thermo Fisher Scientific), Gemini Instrument, AgilePulse/CytoPulse Instrument (BTX-Harvard Apparatus), 4D- Nucleofector system, Amaxa Nucleofector II, Nucleofector 20 2b instrument (Lonza), CTX-1500A instrument (Celetrix), MaxCyte GT or VLX instrument (MaxCyte), Gene Pulser Xcell (Biorad). Based on the manufacturer's guidance, the pulse duration, intensity, interval between pulses, and the number of pulses can be modified to achieve the best conditions for high transfection efficiency and low mortality.

In the examples of this application, the main transfected cell types are human primary T cells, lymphocytes, and peripheral blood mononuclear cells. In theory, most cell types can use electroporation transfection to deliver vectors into cells . In some cases, lymphocytes from a single donor or a mixture of lymphocytes from multiple donors can be transfected. Because primary lymphocytes are mostly taken from the peripheral blood of human donors, the maximum number of cells that can be obtained from a single donor at a time is limited, which limits the total number of cells that can be processed in each batch. If a mixture of cells from multiple donors can be transfected, so that the cells processed in a single batch do not need to be from the same donor, the total number of cells that can be processed can be doubled, and the number of cells that can be produced in a single batch can be increased. , Expand the scale of production, thereby reducing the cost of production.

On the other hand, the application provides the use of the immune cell, the cell population and/or the pharmaceutical composition in the preparation of a medicine for the treatment of tumors. In some cases, the tumor may include kidney cancer, glioblastoma, breast cancer, and/or acute myeloid leukemia.

Without intending to be limited by any theory, the following examples are only used to illustrate the fusion protein, preparation method, use, etc. of the present application, and are not used to limit the scope of the present invention. The meanings of the abbreviations are as follows: "h" refers to hours, "min" refers to minutes, "s" refers to seconds, "ms" refers to milliseconds, "d" refers to days, "μL" refers to microliters, "mL" refers to milliliters, and "L" "Refers to liters, "bp" refers to base pairs, "mM" refers to millimoles, and "μM" refers to micromoles.

Example

Example 1: Obtain CD70 CAR sequence

Through patent search, the CAR sequence targeting CD70 was obtained from the international application PCT/US2015/025047: ΔCD27-4-1-BB-CD3ζ, named CD70-CAR-01. The sequence structure of CD70-CAR-01 is: human CD27 extracellular domain, human CD27 transmembrane domain, 4-1BB costimulatory signal transduction domain and CD3 signal transduction domain, which are connected in sequence, and its amino acid sequence is as SEQ ID NO: 18 As shown, the nucleotide sequence encoding CD70-CAR-01 is shown in SEQ ID NO:1. A human CD70 antibody was obtained from PCT/EP2012/054733: clone 41D12, the amino acid sequence of the antibody heavy chain variable region is shown in SEQ ID NO: 19, and the nucleotide sequence encoding the antibody heavy chain variable region is shown in SEQ ID NO: 2, the nucleotide sequence of the antibody light chain variable region is shown in SEQ ID NO: 20, and the nucleotide sequence encoding the antibody light chain variable region is shown in SEQ ID NO: 3. The 41D12 was transformed into scFv, and the variable region of the heavy chain and the variable region of the light chain were connected by three GGGGS connecting peptides. Design two scFvs with different connection sequences, from 5'end to 3'end, one is the heavy chain variable region before the light chain variable region (41D12scFv-02, the amino acid sequence is shown in SEQ ID NO: 26 ), one is the variable region of the light chain before the variable region of the heavy chain (41D12scFv-03, the amino acid sequence is shown in SEQ ID NO: 27).

These two CD70-targeting scFvs were sequentially connected with CD8a hinge region, CD8a transmembrane region, 4-1BB intracellular domain and CD3ζ activation domain to obtain two CAR sequences, which were named: CD70-CAR-02 (amino acid sequence As shown in SEQ ID NO: 21, the nucleotide sequence is shown in SEQ ID NO: 4) and CD70-CAR-03 (the amino acid sequence is shown in SEQ ID NO: 22, and the nucleotide sequence is shown in SEQ ID NO: 5) Shown). The 5'end of the scFv is connected to the CD8a signal peptide (amino acid sequence is shown in SEQ ID NO: 24) through linker-Flag-linker (amino acid sequence is shown in SEQ ID NO: 25).

Example 2: Construction of CD70 chimeric antigen receptor molecule and cloned into lentiviral vector

2.1 Synthesis of gene sequence containing chimeric antigen receptor

The chimeric antigen receptor gene sequence targeting CD70 was synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. and cloned into the pUC57 vector (Suzhou Jinweizhi Biotechnology Co., Ltd.). When synthesizing genes, restriction enzymes BamHI (NEB: R3136S) and SalI (NEB: R3138S) restriction sites were added at the 5'end and 3'end of the gene, respectively.

2.2 Construction of a lentiviral vector expressing CD70 chimeric antigen receptor

The gene sequences of CD70 chimeric antigen receptors: CD70-CAR-01, CD70-CAR-02, and CD70-CAR-03 were cut from pUC57 vector using BamHI and SalI restriction sites, and the bands were cut by restriction enzymes After detection by agarose gel electrophoresis, the DNA fragments of CD70 chimeric antigen receptor were obtained by gel recovery and purification (QIAGEN, Item No. 28706). The CD70 chimeric antigen receptor DNA fragment recovered by restriction digestion was cloned into a lentiviral vector (Addgene, catalog number 12252) by T4 ligase (NEB: M0202S) to obtain 3 recombinant plasmids expressing CD70 chimeric antigen receptor: p -lenti-CD70-CAR-01, p-lenti-CD70-CAR-02, p-lenti-CD70-CAR-03. The 3 lentiviral vectors were sent to Suzhou Jinweizhi Biotechnology Co., Ltd. for sequencing verification. The sequencing primers were: Lenti-For: TCAAGCCTCAGACAGTGGTTC (SEQ ID NO: 16), Lenti-Rev: CCTCATAAAGAGACAGCAACCAGG (SEQ ID NO: 17), and sequencing verification 3 All lentiviral vectors were constructed correctly.

Example 3: Preparation of lentivirus of CD70 chimeric antigen receptor molecule

3.1 Extract plasmid

The recombinant plasmid verified by sequencing was retransformed into Escherichia coli stbl3 (purchased from Beijing Cresbo). Pick a single clone from the transformed plate into a 3ml shake tube containing ampicillin in liquid LB medium, at 37°C at 220 rpm, shake culture on a shaker for 8 hours. Extract 500 μl from the activated bacterial solution and inoculate it into 250 ml of liquid LB medium containing ampicillin at 37°C and 220 rpm, shaking in a shaker for 12-16 hours. Use Qiagen HiSpeed Plasmid Maxi Kit (Cat. No. 12662) to perform plasmid extraction according to the experimental procedure provided by the kit. After the plasmid was extracted, Nanodrop (Thermo Fisher Scientific) was used to determine the plasmid concentration, and the supercoiled plasmid content was detected by DNA agarose gel.

3.2 Culturing 293T cells

After the frozen 293T cells (purchased from ATCC) were taken out of liquid nitrogen, they were continuously shaken in a 37°C water bath to promote their thawing. After wiping the mouth of the tube with medical alcohol, move it to a 15ml centrifuge tube containing 10ml of preheated DMEM complete medium (90% DMEM + 10% FBS + 1% penicillin/streptomycin) in advance, and blow gently, 1000 rpm Centrifuge for 3 min, aspirate and discard the supernatant. Add 10ml DMEM complete medium, gently blow evenly, and then inoculate it into a 10cm petri dish, and cultivate in a cell culture incubator _{containing 5% CO 2 at 37°C.} On the second day, when the cell density reaches 80%-90%, the cells are subcultured, the medium is aspirated and washed once with 10ml PBS, 3ml trypsin containing 0.25% EDTA is added, and placed in the incubator for 1-2min (during this period Take it out and observe under the microscope whether the cells are rounded). After the cells became round, 1ml of DMEM complete medium was added to terminate the trypsinization, transferred to a 15ml centrifuge tube, centrifuged at 1000rpm for 3min, and the supernatant was aspirated. According to the needs of the experiment, pass the passage at a ratio of 1:3 or 1:5, and inoculate it into a new 10cm petri dish to continue culturing or cryopreservation.

3.3 Preparation of lentivirus

On the first day, inoculate 293T cells: inoculate cells according to about 1.7×10 ⁷ cells/T175 flask (cultivation in 30 ml culture medium), so that they can be transfected when the cell density reaches 80-90% on the second day.

The next day, plasmid transfection: before transfection, the medium needs to be changed to DMEM medium with 10% FBS but no double antibodies. First prepare the plasmid complexes separately: add the following plasmids to 1.5ml Opti-MEM (Thermo Fisher Scientific, article number 31985-070) and mix well: 9μg of psPAX2 plasmid (Addgene, article number: 12260), 18μg of pMD2.G Plasmid (Addgene, article number: 12259), 18 μg viral vector plasmid. There are 3 types of viral vector plasmids: p-lenti-CD70-CAR-01, p-lenti-CD70-CAR-02, and p-lenti-CD70-CAR-03. Then prepare the transfection reagent complex: According to the mass ratio of plasmid to PEI 1:3, add 67.5μl (2mg/ml) PEI (polysciences, catalog number 24765) to 1.5ml Opti-MEM and mix well, then let it stand at room temperature for 5 minutes; Add the transfection reagent complex to the plasmid complex, mix well and let stand for 20 min. Finally, the transfection complex was slowly dropped into the 293T cell culture dish, mixed gently, and cultured in a cell incubator _{containing 5% CO 2 at 37°C.}

On the fourth day, the virus was collected: the culture supernatant was collected for 48 hours after transfection, and the cell debris was removed by centrifugation at 2000 rpm for 10 minutes. Use a 0.45μm filter membrane to filter the supernatant, and transfer the filtrate to a special centrifuge tube for balance. Use an ultracentrifuge at 25000rpm to ultracentrifuge for 2h. After discarding the supernatant, resuspend the lentivirus in X-VIVO-15 medium, and store the lentivirus in an ultra-low temperature refrigerator at -80℃. According to this procedure, lentiviruses containing CD70-CAR-01, CD70-CAR-02 and CD70-CAR-03 were obtained.

Example 4: Isolation and activation of human primary T cells

Dilute human peripheral blood mononuclear cells (PBMCs, purchased from Shanghai Miaoshun Biotech) to 2×10 ⁶ /ml, and use anti-human CD3/CD28 magnetic beads (Thermo Fisher Scientific) according to the ratio of cells to magnetic beads of 1:3 To activate T cells, 300IU/ml IL-2 (PeproTech: 200-02) was added to the medium at the same time. CD70 expression was detected in the control T cells on the 3rd, 5th, 7th and 10th day of activation. Adjust the cell density to 1×10 ⁶ /ml, take a certain volume of T cells, add CD70 antibody (BD Biosciences, catalog number 561935) to stain the cells, and incubate at 4°C for half an hour. After staining, the cells were washed with PBS and resuspended. Use flow cytometry to detect the expression of CD70. It was found that CD70 was highly expressed in activated T cells, and T cells expressing CD70 accounted for 12% on the 5th day (see Figure 1).

Example 5: Preparation of CD70 sgRNA

5.1 Design CD70 gRNA

Use ChopChop software to design gRNA targeting human CD70 gene. First log in to the ChopChop website: http://chopchop.cbu.uib.no/. Then do the following operations on the website page: enter CD70 in the Target bar code box; select Homo sapiens (hg38/GRCh38) in the In bar code box; select the Using bar code box: CRISPR/Cas9; select knock-out in the For bar code box. Finally, click the Find target sites button to obtain the CD70 target sequence. The guide sequence obtained from the aforementioned CD70 target sequence is shown in Table 2.

Table 2 Nucleotide sequence of sgRNA

Connect the backbone sequence (take SEQ ID NO: 37 as an example) to the 3'end of the guide sequence in Table 2 to obtain the nucleotide sequence of the sgRNA targeting CD70.

5.2 Preparation and purification of sgRNA

First, PCR amplifies and synthesizes the transcription template, the reaction system is 20 μl, as shown in Table 3 below, and the reaction conditions are as shown in Table 4.

Table 3 PCR reaction system

试剂Reagent	体积(μl)Volume (μl)
Q5 hot start HF 2X mixQ5 hot start HF 2X mix	1010
正向引物(10μM)：sgRNA引物Forward primer (10μM): sgRNA primer	11
反向引物(10μM)：通用引物Reverse primer (10μM): universal primer	11
ddH ₂O ddH ₂ O	88

Table 4 PCR reaction conditions

Then sgRNA was transcribed in vitro, and the reaction system was 20 μl, as shown in Table 5. Add reagents and operate on ice, then react at 37°C for 2-4 hours, add 1μl of DNAase enzyme after completion, and react at 37°C for 15 minutes. For specific operation steps, please refer to PCT Patent Application Publication WO2019011118A1.

Table 5 Transcription reaction system

试剂Reagent	体积(μl)Volume (μl)
上一步的PCR产物PCR product from the previous step	88
转录buffer Transcription buffer	1010
T7转录酶 T7 transcriptase	22

Next, the sgRNA was purified, the magnetic beads (Beckman, A63987) were taken out of the refrigerator and turned upside down 8-10 times, and shaken repeatedly until all the magnetic beads were fully suspended. Then add magnetic beads to the sgRNA product in a volume of 1:1.8 times, and incubate at room temperature for 5-10 minutes. After incubation, place it on the magnetic separator for 2 minutes, aspirate the supernatant, and leave the EP tube on the magnetic separator. Add 200μl of 80% ethanol to each tube for cleaning. There is no need to shake and keep the EP tube on the magnetic separator. Aspirate the supernatant, repeat this step once, and finally aspirate the supernatant as much as possible. Air dry at room temperature for 5 minutes, add 100μl RNAase free water and mix well, let stand at room temperature for 2-5 minutes, put the EP tube on the magnetic separator for 1-2 minutes until the magnetic beads are adsorbed by the magnet, and remove the supernatant with sgRNA Transfer the liquid to a new EP tube. Finally, Nanodrop was used to determine the concentration of purified sgRNA according to the operating instructions.

Example 6: Preparation of CD70 knockout T cells

6.1 Knockout CD70

After removing the magnetic beads from the activated T cells, use CRISPR/Cas9 electrotransduction to knock out CD70 in the T cells. Refer to patent WO2019011118A1 for the cell processing operation flow. In short, use the sgRNA in Example 5 and Cas9 protein purchased from IDT to mix in the T buffer provided by the Neon kit (Thermo, MPK1096), incubate at room temperature for 5 to 10 minutes, and then follow the T cell provided by the manufacturer The electroporation guide was mixed with 6μl T cells resuspended in T buffer at a quantity of 0.2×10 ⁶ /ml, and the electroporation was performed in a 10μl pipette tip of Neon. Please refer to the literature Schumann et al. PNAS 2015.112:10437-10442 for the electro-transfer method.

T cells were knocked out with the sgRNA in Table 1, and they were named T-KO-sgRNA-19, T-KO-sgRNA-17, T-KO-sgRNA-8, T-KO-sgRNA-7, T -KO-sgRNA-13, T-KO-sgRNA-18, T-KO-sgRNA-4, T-KO-sgRNA-6, T-KO-sgRNA-24, T-KO-sgRNA-66 and T-KO -sgRNA-15, while selecting unknocked T cells (control T cells) as a negative control.

6.2 Detection of CD70 knockout efficiency

The CD70 knockout T cells and the control T cells were cultured for a period of time, and then flow cytometry and TIDE analysis were used to detect the knockout efficiency.

(1) The CD70 knockout T cells were cultured for 72 hours, and then the expression of CD70 molecules in the cells was detected by fluorescent antibody staining and flow cytometry. The basic steps are as follows: Centrifuge the T cells cultured in a certain volume and add the corresponding The fluorescent antibody was incubated in the dark for 30 minutes, washed once with PBS, resuspended in an appropriate volume of PBS, and finally detected by flow cytometry for the expression of CD70 molecules. Taking the non-knockout cells as a control, the knockout efficiency was calculated according to the expression of CD70, and the calculation formula was knockout efficiency=(CD70 percentage of non-knockout cells-CD70 percentage of knockout cells)/CD70 percentage of non-knockout cells. Note: When calculating the elimination efficiency by this method, for T-KO-sgRNA-66 and T-KO-sgRNA-15, after deducting the blank background from the flow cytometry, the calculated elimination efficiency is a negative number. It may be due to cellular stress that caused the up-regulation of CD70 expression, so the knockout efficiency was recorded as 0%.

(2) After CD70 knockout T cells and control T cells are cultured to a certain number, the cells are collected, and the genome is extracted with QIAGEN DNeasy Blood&Tissue Kit (Cat. No. 69504) according to the operating instructions, and then the extracted genomic DNA is electrophoresed on agarose gel Detection. Using the extracted genomic DNA as a template, design appropriate primers to purify and recover the target gene after PCR amplification, sequence both control T cells and knockout T cells, and put the sequencing results on the website https://tide.deskgen. com/, analyze the efficiency of CD70 knockout for each different sgRNA. This method was not used to detect the knockout efficiency of T-KO-sgRNA-66 and T-KO-sgRNA-15.

The knockout efficiency is shown in Table 6.

Table 6 CD70 knockout efficiency

Example 7: Preparation of CD70-knockout anti-CD70-CAR-T cells using the method of first transfection and then knockout

After T cell activation for 2 days, count the T cells and adjust their cell concentration to 1×10 ⁶ /ml, inoculate 500 μl per well into 24 wells, and respectively add the CD70-CAR-01 and CD70-CAR contained in Example 3 -02 and CD70-CAR-03 DNA sequence lentiviruses were added to T cell culture wells to transfect T cells, and untransfected T cells were used as a negative control to obtain different groups of chimeras that could express the targeted human CD70 antigen Antigen receptor T cells are named: CD70-CAR-T-01, CD70-CAR-T-02 and CD70-CAR-T-03.

Then follow the steps in Example 6 to use electroporation to introduce CD70 sgRNA-19 into untransfected T cells, CD70-CAR-T-01A, CD70-CAR-T-02A, and CD70-CAR-T-03A T cells CD70 knockout was performed, and the T cells obtained were named: control T cells-KO (T-KO), CD70KO-CAR-T-01A, CD70KO-CAR-T-02A and CD70KO-CAR-T-03A T cells. T cells that have not been transfected or knocked out are control T cells (CT). Continue to cultivate T cells in each group to a resting state. According to Example 6, the T cell genomes of each group were extracted, and it was determined by PCR and TIDE analysis that in these CAR-T cells, CD70 had been successfully knocked out. Table 7 shows the knockout efficiency of T-KO, CD70KO-CAR-T-01A, CD70KO-CAR-T-02A and CD70KO-CAR-T-03A cells.

Table 7 CD70 knockout efficiency

Example 8: Detection of CD70 knock-out anti-CD70-CAR expression in T cells

The expression of the CD70 gene knockout anti-CD70-CAR molecule prepared in Example 7 in each group of T cells was detected by fluorescent antibody staining and flow cytometry. The basic steps are as follows: the anti-CD70 lentivirus infected 48h was collected by centrifugation. -CAR-T cells (CD70KO-CAR-T-01A, CD70KO-CAR-T-02A and CD70KO-CAR-T-03A cells) and Lentiviral uninfected T cells, adding biotinylated human CD70 protein (100μg/ ml) (Acrobiosystems), incubate for 30 minutes at 4°C in the dark, and wash once with PBS. Resuspend in an appropriate volume of PBS and add the secondary antibody PE-Streptavidin (BD Biosciences, Catalog No. 554061), incubate at 4°C for 20 minutes in the dark, wash with PBS once, then resuspend in an appropriate amount of PBS, and finally use a flow cytometer to detect the antibody. The expression efficiency of CD70-CAR molecules on the surface of T cells is shown in Figure 2. The control T cells are unstained as control T cells that have not knocked out CD70 and are not transfected with virus, and control T cells are unstained CD70 cells. T cells transfected with virus.

Example 9: Detection of cytokines after CD70 knock-out anti-CD70-CAR-T and different target cells are co-cultured

Firstly, the expression in 786-O cells (purchased from the cell bank of the Chinese Academy of Sciences), Raji cells (purchased from the cell bank of the Chinese Academy of Sciences), K562 (purchased from the cell bank of the Chinese Academy of Sciences) and 293T (purchased from ATCC) cells were detected. Take a certain volume of cells, stain them with CD70 antibody and analyze by flow cytometry, it is found that 786-O and Raji cells highly express CD70, while K562 cells and 293T cells do not express CD70 (see Figure 3). A lentivirus carrying the CD70 gene (Genebank: NM_001252.5, SEQ ID NO: 6) was used to transfect 293T cells to prepare a 293T-CD70 cell line expressing CD70 protein. See Example 3 for the lentivirus preparation process. Count the CD70-knockout anti-CD70-CAR-T cells and control T cells and adjust the concentration to 1×10 ⁶ /ml, and then inoculate 100 μl per well into a flat-bottom 96-well plate and incubate at 37°C. 786-O, Raji cells and 293T-CD70 expressing CD70 protein, 293T negative cells not expressing CD70 protein were added to the anti-CD70 ^{according to the target ratio of 1:1, that is, the cell concentration is 1×10 6 /ml, 100μl/well} -Co-culture in CAR-T cells or control T cells.

The supernatant after 24 hours of co-cultivation of the above cells was transferred to a new 96-well plate, and the secretion of IL-2 and IFN-γ cytokines of CAR-T cells was detected using an ELISA kit (Thermo Fisher Scientific, Catalog No. 88-7316). Plate preparation and supernatant cytokine detection follow the standard procedures provided by the kit.

The results are shown in Figure 4 and Figure 5. As can be seen from the figure, CD70 knockout anti-CD70-CAR-T cells and CD70-positive cells (786-O, Raji and 293T-CD70) are co-cultured to release high levels of IL. -2 and IFN-γ. However, anti-CD70-CAR-T cells and CD70-negative cells 293T co-cultured almost no secretion of cytokine release, and the negative control T cells did not induce cytokine release regardless of whether they were co-cultured with CD70-positive cells and CD70-negative cells. It was verified that the cytokine release in the co-culture assay was CAR-dependent and CD70-specific.

Example 10: Detection of the killing ability of CD70-knockout anti-CD70-CAR-T on target cells

First, the cells were plated, 780-O cells, Raji cells, 293T-CD70 cells and 293T cells were transfected with lentivirus with luciferase (GenBank: AAR29591.1) to prepare cell lines labeled with luciferase, respectively Named as: 780-O.luc cells, Raji.luc cells, 293T.CD70.luc cells and 293T.luc cells. The cell line labeled with luciferase was plated into a 96-well flat-bottom opaque white plate at a ^{cell concentration of 1×10 5 /ml, 50 μl/well.} A total of 3 effective target ratios of 2.5:1, 1:1 and 0.5:1 were set, and the T cells of each group were co-cultured with the target cells. Place the 96-well plate in a 37°C 5% CO ₂ cell incubator for overnight culture.

After the cells were co-cultured for 24 hours, the remaining luciferase activity (relative light unit, RLU) of the target cells was measured to detect the killing ability of each CAR-T on different target cells. The specific steps are: centrifugation of the co-cultured cells at 800 rpm for 5 minutes, aspirate the supernatant and add 100 μl of D-luciferin substrate (Thermo Fisher Scientific: 88293), mix well and avoid light for 5 minutes, and detect in chemiluminescence mode on the microplate reader The fluorescence intensity. In the absence of effector cells, the maximum luciferase activity was obtained by adding medium to the target cells as a control.

After the T cells of each group were co-cultured with the target cells for 24 hours, the killing results are shown in Figure 6-Figure 9. The data confirms that the CD70 knockout anti-CD70-CAR-T cells all have different levels of killing ability against 786-O.luc, Raji.luc and the stable cell line 293T-CD70.luc expressing CD70, and CAR-T has the ability to kill The dose-dependent killing effect of 786-O.luc, Raji.luc and 293T.CD70.luc cells, in the case of an effective target ratio of 2.5:1, more than 60% of the clones have a killing efficiency of more than 50%, and an effective target ratio of 1 :1 and 0.5:1, its killing efficiency began to decrease. At the same time, the data in Figure 9 confirmed that when CAR T cells were co-cultured with the CD70-negative cell line 293T.luc, no significant decrease in luciferase activity was detected under the three effective target ratios, that is, the killing rate did not increase significantly, indicating CAR T cells do not have a dose-dependent killing effect against the CD70-negative cell line 293T.luc. The above data proves that the killing effect of anti-CD70 CAR T cells against tumor cells is specific to CD70.

Example 11: Preparation of CD70-knockout anti-CD70-CAR-T cells using the method of knockout and transfection

Dilute human peripheral blood mononuclear cells (PBMCs, purchased from Shanghai Miaoshun Biotech) to 2×10 ⁶ /ml, according to the method of Example 6.1, use electrotransformation to introduce the CD70 sgRNA-19 obtained in Example 5 into T cells , Perform CD70 knockout. Twenty-four hours after electroporation, count the T cells and adjust their cell concentration to 1×10 ⁶ /ml. Use anti-human CD3/CD28 magnetic beads (Thermo Fisher Scientific) to activate T cells in a ratio of 1:3 between cells and magnetic beads. Cells, while adding 300IU/ml IL-2 (PeproTech, Catalog No. 200-02) to the culture medium. Two days after T cell activation, lentiviruses containing the DNA sequences of CD70-CAR-01, CD70-CAR-02 and CD70-CAR-03 were added to the T cell culture wells to transfect T cells, and untransfected T cells were used as Negative control, obtained different groups of chimeric antigen receptor T cells that can express targeting human CD70 antigen, named: CD70KO-CAR-T-01B, CD70KO-CAR-T-02B and CD70KO-CAR-T-03B . The anti-CD70 expression efficiency of CD70KO-CAR-T-01B, CD70KO-CAR-T-02B and CD70KO-CAR-T-03B in the resting state is shown in Figure 10. The CD70 knockout efficiency is shown in Table 8. The results indicate that CD70 knockout by electrotransduction before activating T cells can also prepare CD70 knockout anti-CD70-CAR-T cells.

Table 8 CD70 knockout efficiency

组别Group	敲除效率(％)Knockout efficiency (%)
对照T细胞Control T cell	0.180.18
对照T细胞-KOControl T cell-KO	93.593.5
CD70 KO-CAR-T-01BCD70 KO-CAR-T-01B	95.595.5
CD70 KO-CAR-T-02BCD70 KO-CAR-T-02B	95.395.3
CD70 KO-CAR-T-03BCD70 KO-CAR-T-03B	93.193.1

Example 12: CD70 KO-CAR-T cells prepared by knockout and transfection can efficiently secrete cytokines

Refer to the experimental protocol of Example 9 to detect CD70 knock-out anti-CD70-CAR-T (CD70 KO-CAR-T) and different target cells (human renal clear cell adenocarcinoma cell 786-O cell, human monocytic leukemia cell THP-1 cells, human Burkitt's lymphoma cells Raji cells, CD70 positive cells 293T-CD70 cells or human chronic myeloid leukemia cells K562 cells) cytokine secretion after co-culture.

The results are shown in Figure 11 and Figure 12. For each target cell, the abscissa shows control T cells, CD70 knockout T cells, CD70 KO-CAR-T-01B, CD70 KO-CAR-T-02B and CD70 in turn. The result of KO-CAR-T-03B secreting cytokines. It can be seen from the figure that CD70 KO-CAR-T and CD70-positive cells (786-O cells, Raji cells, THP-1 cells and 293T-CD70 cells) are co-cultured to release high levels of IL-2 and IFN- γ. However, there is almost no cytokine release after CD70 KO-CAR-T is co-cultured with CD70-negative cells K562, and the negative control T cells do not induce cytokine release regardless of whether they are co-cultured with CD70-positive cells and CD70-negative cells. Cytokine release in the co-culture assay is CAR dependent and CD70 specific.

Example 13: CD70 KO-CAR-T cells prepared by knocking out first and then transfecting can efficiently kill tumor cells

Refer to the experimental protocol in Example 10 to detect the CD70 knock-out anti-CD70-CAR-T (CD70 KO-CAR-T-01B～CD70 KO-CAR-T-03B) and different target cells after co-cultivation to kill different target cells ability.

After each group of T cells and target cells were co-cultured for 24 hours, the killing results are shown in Figure 13-15 (Figure 13-15 respectively show against human renal clear cell adenocarcinoma cell 786-O cell, human monocytic leukemia cell THP- 1 cells and CD70-negative cells 293T cells, where these cells are labeled with luciferase LUC).

The results of Figure 13-15 show that CD70 KO-CAR-T cells all have different levels of killing ability to 786-O.luc and THP-1.luc, and CAR-T has the ability to target 786-O.luc (ie with Dose-dependent killing effect of LUC-labeled 786-O cells) and THP-1.luc cells (that is, THP-1 cells with LUC-labeled THP-1 cells), the killing efficiency of the two cells in the case of an effective target ratio of 5:1 More than 90%, even at an effective target ratio of 0.5:1, its killing efficiency is reduced but 50%.

At the same time, the data in Figure 15 confirmed that when CD70 KO-CAR-T cells and CD70-negative cell line 293T.luc (ie 293-T cells with LUC label) were co-cultured, luciferase was not detected under the four effective target ratios. The activity is significantly reduced, that is, its killing rate did not increase significantly, indicating that CD70 KO-CAR-T does not have a dose-dependent killing effect on the CD70-negative cell line 293T.luc. The above data prove that the killing effect of CD70 KO-CAR-T on tumor cells is CD70 specific.

Example 14: The CD70 knockout anti-CD70-CAR-T cells prepared by the method of knockout first and then transfection can well control tumor production in animals

THP-1 tumor cell line (ATCC, ATCC-TIB-202), expand and culture (RPMI-1640+0.05mM 2-mercaptoethanol+10% FBS) after routine resuscitation, and harvest the logarithmic growth phase after at least 2 passages Cell. After the THP-1 tumor cells were collected by centrifugation, they were resuspended to 2.5×10 ⁷ cells/mL with a mixture of PBS and Matrigel (1:1). Take 30 female NOG mice (Vital River Laboratory Animal Technology Co., LTD.), and inoculate 0.2 mL of cell suspension (5×10 ⁶ THP-1 tumor cells) subcutaneously in the right abdomen of all animals under sterile conditions. Seven days after the tumor cells were inoculated, the size of the tumor was measured with a ruler. When the tumor reached 100-150mm ³ , the mice were randomly divided into groups and the CAR-T cells of different groups were injected back.

In this experiment, mice were randomly divided into 5 groups: buffer group, control T cell-KO group, CD70 KO-CAR-T-01B group, CD70 KO-CAR-T-02B group and CD70 KO-CAR-T -03B group, 5 mice in each group. Prepare pre-warmed 1640 complete medium (RMPI-1640+10% FBS) in advance, and transfer it to 15 mL centrifuge tubes, 5 mL per tube. Take the cryopreservation tube out of the low-temperature storage place and quickly place it in a 37°C water bath. After the water bath dissolves, transfer the cells to a 15mL centrifuge tube and mix it with the culture medium. The cells were centrifuged at 1800 rpm for 5 minutes, resuspended in 1640 complete medium, and cultured in a constant temperature incubator at 37°C for 4 hours. Then take an appropriate amount of cells and trypan blue to count the cell density and viability. Adjust the cell density of the test product with 1640 complete medium. Each group of the test product was given 5×10 ⁶ total T cells per animal (approximately 2.5×10 ⁷ CAR-positive cells), and the administration was carried out by adjusting the administration volume. After the CAR-T cells were reinfused, the size of the tumor was measured twice a week with a ruler, and the observation was continued for 42 days. The result is shown in Figure 16.

The results in Figure 16 show that the CD70 KO-CAR-T-01B group, CD70 KO-CAR-T-02B group, and CD70 KO-CAR-T-03B group can significantly inhibit tumor growth. Starting from day 21, the tumors in the CD70 KO-CAR-T-01B group began to grow. However, the CD70 KO-CAR-T-02B group and the CD70 KO-CAR-T-03B group have long-term good control of tumor growth (see Figure 16), showing good anti-tumor effects.

Example 15: Preparation of universal anti-CD70-CAR-T cells

After the CD70-CAR-T-01, CD70-CAR-T-02 and CD70-CAR-T-03 cells in Example 7 were activated for 3 days, the TRAC gRNA (SEQ ID NO: 28) and CD70 sgRNA-19 (SEQ ID NO: 7) into untransfected T cells, CD70-CAR-T-01, CD70-CAR-T-02 and CD70-CAR-T-03T cells, knock In addition to their TRAC and CD70, the resulting T cells were named as control UT cells, CD70KO-UCAR-T-01, CD70KO-UCAR-T-02 and CD70KO-UCAR-T-03T cells, respectively. T cells that have not been transfected or knocked out are control T cells. Continue to cultivate T cells in each group to a resting state. According to the steps in Example 6.2, the genomes of each group of T cells were extracted, and it was determined by PCR and TIDE analysis that CD70 had been successfully knocked out in these CAR-T cells.

Obtain the guide sequence of TRACsgRNA (SEQ ID NO: 28) and the guide sequence of B2MsgRNA (SEQ ID NO: 33-36), connect the backbone sequence (SEQ ID NO: 37) at the 3'end of these guide sequences to obtain TRAC sgRNA, respectively And 4 pieces of B2MsgRNA (called B2MsgRNA-1, B2MsgRNA-2, B2MsgRNA-3, B2MsgRNA-4 in turn).

These sgRNAs and CD70-targeted sgRNA-19 (SEQ ID NO: 7) were introduced into untransfected T cells, CD70-CAR-T-01, CD70-CAR-T-02 and CD70-CAR-T-03T In the cells, knock out their TRAC, B2M and CD70 to get CD70 knockout universal CART cells. Then extract the genome of each group of CART cells, and confirm that CD70 has been successfully knocked out in these CAR-T cells by PCR and TIDE analysis.

The foregoing detailed description is provided by way of explanation and examples, and is not intended to limit the scope of the appended claims. Various changes of the embodiments listed in this text are obvious to those of ordinary skill in the art, and are reserved within the scope of the appended claims and their equivalents.

Claims

The method for preparing a modified immune cell includes the following steps: administering a guide RNA targeting a nucleic acid molecule encoding CD70 to the immune cell, wherein the guide RNA comprises the nucleotide sequence shown in SEQ ID NO: 29.
The method according to claim 1, wherein the guide RNA sequence is 5'-(X)n-SEQ ID NO: 29-skeleton sequence-3', wherein X is selected from any one of A, U, C and G Base, n is any integer of 0-15.
The method according to claim 2, wherein said n is 2.
The method according to any one of claims 1 to 3, wherein the guide RNA comprises the nucleotide sequence shown in SEQ ID NO:30.
The method of any one of claims 1-4, wherein the guide RNA is a single-stranded guide RNA.
The method according to claim 5, wherein the single-stranded guide RNA comprises the nucleotide sequence shown in any one of SEQ ID NO: 7-15.
The method according to any one of claims 1-6, wherein the guide RNA is a double-stranded guide RNA comprising crRNA and tracrRNA.
The method according to claim 7, wherein the crRNA comprises the nucleotide sequence shown in any one of SEQ ID NO: 7-15.
8. The method of any one of claims 1-8, wherein the guide RNA comprises a chemical modification.
9. The method of any one of claims 1-9, which comprises administering Cas protein to immune cells.
The method according to any one of claims 1-10, wherein the immune cells comprise T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, monocytes, dendritic cells , Granulocytes, lymphocytes, white blood cells and/or peripheral blood mononuclear cells.
The method according to any one of claims 1-11, which further comprises the following step: down-regulating the expression and/or activity of T cell receptor α constant region protein and/or T cell receptor β constant region protein in immune cells .
The method according to any one of claims 1-12, which further comprises the step of down-regulating the expression and/or activity of MHC complexes in immune cells.
The method of claim 13, wherein the MHC complex includes B2M.
The method according to any one of claims 12-14, wherein the down-regulation comprises down-regulation of nucleic acid molecules encoding the T cell receptor alpha constant region protein, T cell receptor beta constant region protein and/or MHC complex And/or includes down-regulating the expression and/or activity of the cell receptor α constant region protein, T cell receptor β constant region protein and/or MHC complex.
The method according to any one of claims 12-15, wherein the down-regulation comprises administering to the immune cells one or more substances selected from the group consisting of antisense RNA, siRNA, shRNA, CRISPR/Cas system , RNA editing systems such as ADAR, RNA-guided endonucleases, zinc finger proteases, Mega-TAL nucleases, TALENs and Meganucleases.
The method of any one of claims 12-16, wherein the down-regulation comprises administering to the immune cells a guide RNA targeting an exon portion of the nucleic acid molecule.
The method according to any one of claims 12-17, wherein the guide RNA targeting the nucleic acid molecule encoding the cell receptor alpha constant region protein comprises the nucleotide sequence shown in SEQ ID NO: 28.
The method according to any one of claims 14-18, wherein the guide RNA targeting the nucleic acid molecule encoding the B2M comprises the nucleotide sequence shown in any one of SEQ ID NO. 33-36.
The method according to any one of claims 1-19, further comprising the step of causing the modified immune cell to include a chimeric antigen receptor (CAR) and/or a T cell receptor (TCR).
The method according to any one of claims 1-20, which further comprises the step of making the modified immune cells include those expressing chimeric antigen receptors (CAR) and/or T cell receptors (TCR) Nucleic acid molecule.
The method according to any one of claims 1-21, which comprises the following steps:

a-1) administering the guide RNA of any one of claims 1-9 targeting a nucleic acid molecule encoding CD70 to immune cells; and,

a-2) The immune cells modified by the step a-1) include chimeric antigen receptor (CAR) and/or T cell receptor (TCR).
The method according to any one of claims 1-21, which comprises the following steps:

b-1) Make immune cells include chimeric antigen receptor (CAR) and/or T cell receptor (TCR); and,

b-2) administering the guide RNA of any one of claims 1-9 targeting a nucleic acid molecule encoding CD70 to the immune cells modified by the step b-1).
A modified immune cell prepared according to the method of any one of claims 1-23.
The immune cell according to claim 24, which comprises a chimeric antigen receptor (CAR) and/or a T cell receptor (TCR).
The immune cell according to any one of claims 24-25, which comprises a chimeric antigen receptor targeting a tumor-specific antigen, wherein the tumor-specific antigen is selected from the following group: CD70, CD19, CD20, CD123 , EpCAM and BCMA.
The immune cell according to any one of claims 24-26, wherein the chimeric antigen receptor comprises an antigen binding domain that specifically binds to the tumor-specific antigen.
The immune cell of claim 27, wherein the antigen binding domain comprises a single chain antibody.
The immune cell of any one of claims 27-28, wherein the antigen binding domain comprises a single chain antibody targeting CD70.
The immune cell according to claim 29, wherein the single-chain antibody comprises an amino acid sequence shown in any one of SEQ ID NOs: 26-27.
The immune cell according to any one of claims 24-30, wherein the chimeric antigen receptor comprises a transmembrane domain, wherein the transmembrane domain comprises a transmembrane domain derived from a protein selected from : CD8, CD28, 4-1BB, CD4, CD27, CD7, PD-1, CTLA-4, LAG-3, TCRα, TCRβ, TCRγ, TCRδ, CD3ε, CD3δ, CD3γ, CD3ζ, cytokine receptor, CD5, ICOS, OX40, NKG2D, 2B4, CD244, FcεR, FcεRIγ, BTLA, CD30, GITR, HVEM, DAP10, CD2, NKG2C, LIGHT, DAP12, CD40L, TIM1, CD226, DR3, CD45, CD80, CD86, CD9, CD16, CD22, CD33, CD37, CD64, CD134, CD137, CD154 and SLAM.
The immune cell according to any one of claims 24-31, wherein the chimeric antigen receptor comprises a costimulatory domain, wherein the costimulatory domain comprises a costimulatory domain selected from the following proteins or Combinations: CD28, CD137, CD27, CD2, CD7, CD8, CD80, CD86, OX40, CD226, DR3, SLAM, CDS, ICAM, NKG2D, NKG2C, B7-H3, 2B4, FcεRIγ, BTLA, GITR, HVEM, DAP10, DAP12, CD30, CD40, CD40L, TIM1, PD-1, PD-L1, PD-L2, 4-1BBL, OX40L, ICOS-L, CD30L, CD70, CD83, HLA-G, MICA, MICB, lymphotoxin β receptor Ligand, LFA-1, LIGHT, JAML, CD244, CD100, ICOS, CD83, CD40 and MyD88.
The immune cell according to any one of claims 24-32, wherein the chimeric antigen receptor comprises an intracellular signal transduction domain, wherein the intracellular signal transduction domain comprises derived from The intracellular signal transduction domain of the protein or a combination thereof: CD3zeta, CD3delta, CD3gamma, CD3ε, CD79a, CD79b, CD66d, CD5, CD22, FcRγ, FcRβ, FcRε, FceRIγ, FceRIβ, FcγRIIa, Bovine Leukemia Virus (BLV) gp30 , Epstein-Barr virus (EBV) LMP2A, Simian immunodeficiency virus (SIV) PBj14 Nef, Kaposi's sarcoma herpes virus (KSHV) K1, DAP10, DAP12 and contains at least one immune receptor tyrosine activation motif (ITAM) The domain.
The immune cell according to any one of claims 24-33, wherein the chimeric antigen receptor comprises a hinge region that connects the antigen binding domain and the transmembrane domain, and the The hinge region includes a hinge region derived from a protein selected from the group consisting of CD8, CD28, IgG, 4-1BB, CD4, CD27, CD7, PD-1, and CH2CH3.
The immune cell according to any one of claims 24-34, wherein the chimeric antigen receptor comprises the amino acid sequence shown in any one of SEQ ID NO: 21-22.
The immune cell according to any one of claims 24-35, which comprises a nucleic acid molecule encoding the chimeric antigen receptor.
The immune cell according to claim 36, wherein the nucleic acid molecule comprises the nucleotide sequence shown in any one of SEQ ID NO: 4-5.
A cell population comprising the immune cell of any one of claims 24-37, and at least 80% of the immune cells in the cell population do not substantially express CD70.
A pharmaceutical composition comprising the immune cell according to any one of claims 24-37 and/or the cell population according to claim 38, and a pharmaceutically acceptable carrier.
Use of the immune cell according to any one of claims 24-37, the cell population according to claim 38 and/or the pharmaceutical composition according to claim 39 in the preparation of a medicine for the treatment of tumors.
The use according to claim 40, wherein the tumor comprises renal cancer, glioblastoma, breast cancer and/or acute myeloid leukemia.
The CRISPR/Cas system includes a guide RNA and a Cas protein, wherein the guide RNA comprises the nucleotide sequence shown in SEQ ID NO:29.
The system according to claim 42, wherein the guide RNA sequence is 5'-(X)n-SEQ ID NO: 29-skeleton sequence-3', wherein X is selected from any base of A, U, C and G Base, n is any integer of 0-15.
The system according to any one of claims 42-43, wherein the guide RNA comprises the nucleotide sequence shown in SEQ ID NO:30.
The system according to any one of claims 42-44, wherein the guide RNA comprises the nucleotide sequence shown in any one of SEQ ID NO: 7-15.
The system of any one of claims 42-45, wherein the guide RNA comprises a chemical modification.
The system of any one of claims 42-46, wherein the Cas protein comprises a Cas9 protein.