CN117660393A

CN117660393A - Application of NAD kinase and mutant thereof in biosynthesis

Info

Publication number: CN117660393A
Application number: CN202311632839.2A
Authority: CN
Inventors: 薛亚平; 钟锦兴; 汤恒; 李媛; 郑裕国
Original assignee: Zhejiang University of Technology ZJUT
Current assignee: Zhejiang University of Technology ZJUT
Priority date: 2023-12-01
Filing date: 2023-12-01
Publication date: 2024-03-08

Abstract

The invention discloses an NAD kinase with an amino acid sequence shown as SEQ ID NO.1 and application of a mutant thereof in preparing a medical intermediate, wherein the NAD kinase mutant is obtained by single-point mutation of 175 th, 176 th, 252 th and 332 th sites of the amino acid sequence shown as SEQ ID NO. 1. NAD kinase and its mutant can be used for biosynthesis of pranlukast intermediate 3AHAP, ursodeoxycholic acid UDCA and Ruimegem intermediate compound II, NAD kinase ScNADK is introduced into a multienzyme system to convert NAD+ into NADP+ and reduced by glucose dehydrogenase GDH to generate coenzyme NADPH, and the coenzyme NADPH provides reducing force for catalyzing and synthesizing medicine intermediate pranlukast intermediate 3AHAP, ursodeoxycholic acid UDCA and Ruimegem intermediate by the multienzyme system.

Description

Application of NAD kinase and mutant thereof in biosynthesis

Technical Field

The invention relates to the field of biotechnology; in particular to NAD kinase and mutants thereof and application thereof in preparing medical intermediates by biosynthesis.

Background

NAD kinase and NADH kinase use ATP or inorganic polyphosphate as a phosphorylation donor, specifically catalyzing 2' -hydroxy phosphorylation of NAD (H) ribose moiety to produce NADP (H). The intracellular NAD (H) content of the escherichia coli is far higher than the NADP (H) content, and NAD Kinase (NAD (H) Kinase) catalyzes the phosphorylation of NAD (H) and is converted into NADP (H), so that the NADP (H) is a direct source and a key step of NADP (H) synthesis in microorganisms.

3-Amino-2-hydroxyacetophenone, the English name of which is 1- (3-Amino-2-hydroxy phenyl) ethane (3 AHAP for short), is a key intermediate for synthesizing pranlukast. Pranlukast (Pranlukast) is an oral bronchial asthma therapeutic drug, belongs to leukotriene (CysLTs) receptor antagonists, and can effectively inhibit LTD4 receptor to treat asthma. Compared with other leukotriene antagonists, pranlukast has the characteristics of strong selective inhibition, wide applicability, small side effect and the like, and has wide market prospect and great research value.

Ursodeoxycholic acid (UDCA) is an endogenous bile acid that has been shown to solubilize gallstones and exhibits better efficacy than other endogenous bile acids in the treatment of gallbladder and liver related diseases. To date, UDCA is the only drug approved by the united states Food and Drug Administration (FDA) for the treatment of primary biliary cirrhosis.

The first class of CGRP receptor small molecule antagonists with rapidly disintegrating oral tablet dosage (ODT) is the rimegepam (Rimegepant) for the treatment of migraine by blocking CGRP receptors. The FDA in 2020 approved the CGRP receptor inhibitor nuttec ODT orally disintegrating tablet from Biohaven company for the treatment of adult acute migraine.

The pranlukast intermediate 3AHAP is synthesized mainly by chemical synthesis and can be obtained through a four-step reaction way. The second step of the pathway involves Fries rearrangement involving rearrangement of the phenolic ester to o-or p-acyl phenol under the catalysis of Lewis or Bronsted acids. However, this step has a high risk of environmental pollution due to the use of organic solvents such as chloroform and methylene chloride. In addition, catalysts used in the reaction system, such as AlCl3, BF3 and TiCl4, may release toxic gases, which are harmful to the environment.

Ursodeoxycholic acid UDCA is now prepared by chemical or biosynthetic pathways: this chemical pathway produces UDCA by seven-step synthesis, using Cholic Acid (CA) or chenodeoxycholic acid (CDCA) as starting substrate, which requires the use of toxic and dangerous hydrazine, crO3 and pyridine reagents and generates a large amount of waste, and furthermore the total yield is only about 30%. UDCA produced by chemical synthesis still fails to meet market demands far in quantity and quality.

The existing synthesis method of the ramiazepam intermediate is mainly a chemical method, and comprises a route of taking 3-amino-2-chloropyridine and 1-CBZ-4-piperidone as initial substrates, and the ramiazepam intermediate is prepared by multi-step reaction, and has the advantages of large pollution, low yield and complex operation, and does not accord with the conditions of industrial production. Therefore, a preparation method which is green and environment-friendly, high in yield and convenient to operate is needed to be searched.

Compared with chemical synthesis, the biosynthesis is more environment-friendly, efficient and safer, and the biosynthesis of pranlukast intermediate 3AHAP, ursodeoxycholic acid UDCA and Ruimegem intermediate is gradually developing. The biosynthesis is mainly free enzyme catalyzed synthesis or whole cell catalysis. The whole-cell catalysis or free enzyme catalysis synthesis takes m-nitroacetophenone 3NAP, 7-ketolithocholic acid 7-KLCA or pyridine-2, 3-diamine and 4-oxo-piperidone hydrochloride as substrates, and the pranlukast intermediate 3AHAP, ursodeoxycholic acid UDCA and the Ruimei gem intermediate are generated through multi-enzyme cascade reaction.

Biosynthesis of pranlukast intermediate 3AHAP, ursodeoxycholic acid UDCA and Ruimegem intermediate depends on multienzyme system catalysis, and the catalysis process needs NADPH as electron donor, and 1mol of substrate functional group needs to consume equimolar NADPH cofactor, so the concentration of NADPH cofactor has a great influence on the catalytic activity. However, NADPH cofactors are expensive and cannot be added in large amounts in practical industrial applications. Glucose dehydrogenase (Glucose dehydrogenase, GDH) can oxygen Glucose is converted to gluconic acid, and NAD (P) is added simultaneously ⁺ The reduction to NAD (P) H is a key enzyme of the coenzyme regeneration system in redox biosynthesis. CN116426578A discloses a method for biosynthesis of a prabezoar intermediate, which uses glucose dehydrogenase GDH to catalyze glucose to provide NADPH required to be consumed for a reaction path, without adding pure NADPH to a reaction system additionally, but the amount of NADP contained in cells is limited, NADPH which can be generated is small, the requirement of reduction reaction cannot be met, and generally, additional NADPH is still added to the reaction system in view of improving the reaction efficiency, which leads to increased cost. NADP cofactor prices are far lower than NADPH, while NAD prices are far lower than NADP. NAD kinase (NADK) phosphorylates nad+ is the only known mechanism for de novo NADP production. Nicotinamide adenine dinucleotide (NAD+) phosphate (NADP (H)) plays a critical role in redox homeostasis and metabolism, and if over-expression of NAD (H) kinase genes can be introduced, the redox balance state in the cell is regulated, possibly increasing the yield of the target product.

Disclosure of Invention

The first aspect of the invention provides an NAD kinase, a mutant thereof and a construction method thereof, in order to overcome the defect of low enzyme activity of the NAD kinase in the prior art. The NAD kinase and the mutant thereof have the advantages that the enzyme activity is improved, the cost is reduced, and the industrial production is facilitated; the technical problem to be solved in the second aspect is to overcome the problems of high pollution, high cost, low reaction rate and the like in the prior art for synthesizing the pranlukast intermediate 3AHAP, ursodeoxycholic acid UDCA and the Ruimegempam intermediate, and the invention provides a green, safe, low-cost, mild and effective biosynthesis method.

In a first aspect of the invention there is provided an NAD kinase derived from Saccharomyces cerevisiae having the amino acid sequence shown in SEQ ID NO. 1.

The invention also provides an NAD kinase mutant, which is obtained by single-point mutation at 175, 176, 252 and 332 of an amino acid sequence shown in SEQ ID NO. 1.

The mutant is obtained by site-directed mutagenesis technology and can have NAD kinase NADK activity, namely NAD phosphate group-added activity for preparing NADP, and in particular, the NAD kinase mutant has improved activity for converting NAD into NADP.

NAD kinase of the amino acid sequence shown in SEQ ID NO.1 may be referred to as wild-type enzyme of NAD kinase in the present invention. Is an amino acid sequence derived from Saccharomyces cerevisiae and annotated as NAD kinase (ScNADK), and is obtained by optimization of the invention. The nucleotide sequence of the wild-type enzyme may be the nucleotide sequence shown as SEQ ID NO. 10.

Further, the NAD kinase mutant, preferably the mutation is one of the following:

(1) Mutating threonine at position 175 of the amino acid sequence shown in SEQ ID NO.1 into alanine or histidine;

(2) The 176 th leucine of the amino acid sequence shown in SEQ ID NO.1 is mutated into valine;

(3) Mutating arginine at position 252 of the amino acid sequence shown in SEQ ID NO.1 into histidine or alanine;

(4) Isoleucine at position 332 of the amino acid sequence shown in SEQ ID NO.1 is mutated into histidine, arginine or lysine.

Because of the specificity of the amino acid sequences, any fragment of a peptide protein or variant thereof, such as a conservative variant, biologically active fragment or derivative thereof, comprising an amino acid sequence of the present invention is within the scope of the present invention, as long as the fragment of the peptide protein or peptide protein variant has a homology of 90% or more to the amino acid sequence described above. In particular, the alteration comprises a deletion, insertion or substitution of an amino acid in the amino acid sequence; wherein, for conservative changes of the variant, the substituted amino acid has similar structure or chemical properties as the original amino acid, such as replacement of leucine with isoleucine, the variant may also have non-conservative changes, such as replacement of alanine with glycine.

Further, SEQ ID NO.1 is an amino acid sequence annotated as NAD kinase (ScNADK) derived from Saccharomyces cerevisiae.

The amino acid sequence of the 175 th threonine of the amino acid sequence shown in SEQ ID NO.1 is mutated into alanine, and the amino acid sequence is shown in SEQ ID NO. 2.

The amino acid sequence of the 175 th threonine of the amino acid sequence shown in SEQ ID NO.1 is mutated into histidine, and the amino acid sequence is shown in SEQ ID NO. 3.

The amino acid sequence of the leucine to valine at position 176 of the amino acid sequence shown in SEQ ID NO.1 is shown in SEQ ID NO. 4.

The amino acid sequence of the arginine mutation at position 252 of the amino acid sequence shown in SEQ ID NO.1 to histidine is shown in SEQ ID NO. 5.

The amino acid sequence of the 252 th arginine mutation of the amino acid sequence shown in SEQ ID NO.1 into alanine is shown in SEQ ID NO. 6.

The amino acid sequence of the amino acid sequence shown in SEQ ID NO.1, in which the 332 th isoleucine is mutated into histidine, is shown in SEQ ID NO. 7.

The amino acid sequence of the amino acid sequence shown in SEQ ID NO.1, in which the 332 th isoleucine is mutated into arginine, is shown in SEQ ID NO. 8.

The amino acid sequence of the amino acid sequence shown in SEQ ID NO.1, in which the 332 th isoleucine of the amino acid sequence is mutated into lysine, is shown in SEQ ID NO. 9.

The invention also provides a coding gene of the NAD kinase or the mutant thereof.

Wherein the nucleotide sequence of the coding gene corresponding to the amino acid sequence shown in SEQ ID NO.1 is shown in SEQ ID NO. 10.

Because of the specificity of the nucleotide sequence, any variant of the polynucleotides of the present invention, as long as it has more than 90% homology with the aforementioned polynucleotides, falls within the scope of the present invention. A variant of the polynucleotide refers to a polynucleotide sequence having one or more nucleotide changes. Variants of the polynucleotide may be variants that are either naturally occurring or non-naturally occurring, including substitution, deletion and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide, which may be a substitution, deletion, or insertion of a polynucleotide, without substantially altering the function of the peptide protein it encodes.

The invention also provides a recombinant expression vector comprising a gene encoding NAD kinase or a mutant thereof. And recombinant genetic engineering bacteria constructed by utilizing the recombinant expression vector and containing the coding genes of the NAD kinase or the mutant thereof. The recombinant genetically engineered bacterium expression host is usually escherichia coli BL21 (DE 3).

The NAD kinase or its mutants can be obtained as follows: culturing recombinant genetically engineered bacteria containing the coding genes of the NAD kinase or the mutant thereof, inducing the expression of the NAD kinase or the mutant thereof, and separating and purifying the obtained culture solution to obtain the NAD kinase or the mutant thereof.

In a second aspect of the invention there is provided the use of an NAD kinase or mutant thereof as described above in the biosynthesis of pranlukast intermediate 3AHAP, ursodeoxycholic acid UDCA or ramelteon intermediate.

Further, the application method comprises the following steps: NAD kinase or a mutant thereof is introduced into a multienzyme reaction system, NAD+ is converted into NADP+, glucose dehydrogenase GDH reduces NADP+ to generate coenzyme NADPH, and the coenzyme NADPH provides electrons for a biosynthesis pharmaceutical intermediate pranlukast intermediate 3AHAP, ursodeoxycholic acid UDCA or a Ruimepam intermediate compound II, namely provides reducing capability.

Specifically, the application of NAD kinase or mutants thereof in biosynthesis of pranlukast intermediate 3AHAP is as follows: NAD kinase or its mutant is introduced into a multienzyme reaction system to convert NAD+ into NADP+, and glucose dehydrogenase GDH reduces NADP+ into coenzyme NADPH, and the coenzyme NADPH is supplied to nitroreductase coupling hydroxylamine phenylmutase to biologically convert substrate m-nitroacetophenone into pranlukast intermediate 3-amino-2-hydroxyacetophenone.

Further, the reaction process is as follows: NAD kinase or its mutant converts NAD+ into NADP+, glucose dehydrogenase GDH reduces NADP+ to generate coenzyme NADPH, and nitrobenzene reductase nbzA catalyzes m-nitroacetophenone 3NAP to generate 3-hydroxyaminoacetophenone 3HAAP under the action of NADPH providing electrons; hydroxylamine benzene variant enzyme habA catalyzes the production of 3-amino-2-hydroxyacetophenone 3AHAP from 3-hydroxyaminoacetophenone 3 HAAP.

The reaction formula is shown as follows:

specifically, the method preferably used is as follows:

the method comprises the steps of using nitrobenzene reductase nbzA, hydroxylamine benzene variant enzyme habA, glucose dehydrogenase GDH, NAD kinase or mutants thereof as catalysts to form an enzyme mixing system, using m-nitroacetophenone 3NAP as a substrate, adding glucose, coenzyme NAD and ATP, and constructing a reaction system to synthesize the 3-amino-2-hydroxyacetophenone 3AHAP.

Further, in the reaction system, the concentration of the substrate m-nitronitroethanone 3NAP is 1-50 g/L, and the concentration of glucose is 20-80 g/L.

The solvent of the reaction system is a buffer solution having a pH of 6.5 to 8, preferably a phosphate buffer solution having a pH of 7 to 8 and a pH of 20 to 50 mM.

The reaction temperature is 25 to 50℃and preferably 30 to 35 ℃. The reaction time is 1 to 5 hours.

In the reaction system, the concentration of coenzyme NAD is 1-15 mM, and the concentration of ATP is 1-15 mM.

After the reaction is finished, the reaction liquid is separated and purified to prepare the 3-amino-2-hydroxyacetophenone 3AHAP pure product.

The catalyst comprises nitrobenzene reductase nbzA, hydroxylamine benzene mutant enzyme habA, glucose dehydrogenase GDH and NAD kinase or mutants thereof, and the form of the catalyst can be an enzyme form or a thallus form. The enzyme forms include free enzymes, immobilized enzymes, including purified enzymes, crude enzymes, fermentation broths, vector immobilized enzymes, cell debris, etc.: the forms of the bacterial cells include viable bacterial cells and/or dead bacterial cells.

The catalyst is preferably in the form of wet thalli or crude enzyme liquid, and when the catalyst is in the form of crude enzyme liquid, the mass concentration of nitrobenzene reductase nbzA crude enzyme liquid in a reaction system is 2-10 g/L, the mass concentration of hydroxylamine benzene variant enzyme habA crude enzyme liquid is 20-50 g/L, the mass concentration of glucose dehydrogenase GDH crude enzyme liquid is 40-80 g/L, and the mass concentration of NAD kinase or mutant crude enzyme liquid thereof is 10-30 g/L.

Further, the wet cell of nitrobenzene reductase nbzA, hydroxylamine benzene mutase habA, glucose dehydrogenase GDH, NAD kinase or mutants thereof may be prepared as follows: respectively inoculating recombinant genetic engineering bacteria seed liquid containing genes for encoding nitrobenzene reductase nbzA, hydroxylamine benzene mutase habA, glucose dehydrogenase GDH or NAD kinase or mutants thereof into LB culture medium containing kanamycin or streptomycin, culturing at 35-37 ℃ until OD600 reaches 0.8, adding inducer IPTG with the final concentration of 0.5-1 mM into fermentation liquor, performing induction culture at 28-30 ℃, centrifuging the obtained culture, and collecting bacterial precipitate to obtain wet bacterial bodies of nitrobenzene reductase nbzA, hydroxylamine benzene mutase habA, glucose dehydrogenase GDH, NAD kinase or mutants thereof.

The crude enzyme solution can be prepared as follows: suspending wet bacteria of nitrobenzene reductase nbzA, hydroxylamine benzene variant enzyme habA, glucose dehydrogenase GDH or NAD kinase or mutants thereof in 50mM phosphate buffer solution with pH of 8.0, homogenizing and crushing, centrifuging the crushed solution to remove sediment, and obtaining crude enzyme solution containing nitrobenzene reductase nbzA, hydroxylamine benzene variant enzyme habA, glucose dehydrogenase GDH or NAD kinase or mutants thereof. The crude enzyme solution can be further purified by a nickel column, dialyzed and desalted to obtain pure proteins of nitrobenzene reductase nbzA, hydroxylamine benzene variant enzyme habA, glucose dehydrogenase GDH or NAD kinase or mutants thereof.

The recombinant genetically engineered bacterium containing the genes for encoding the nitrobenzene reductase nbzA, the hydroxylamine benzene variant enzyme habA, the glucose dehydrogenase GDH or the NAD kinase or the mutant thereof is prepared by inserting the encoding genes for the nitrobenzene reductase nbzA, the hydroxylamine benzene variant enzyme habA, the glucose dehydrogenase GDH or the NAD kinase or the mutant thereof into a recombinant expression vector and transferring the recombinant genetically engineered bacterium into host bacterium.

Nitrobenzene reductase nbzA, hydroxylamine benzene variant enzyme habA, glucose dehydrogenase GDH can be obtained by referring to CN116426578A, and the encoding genes are disclosed in Chinese patent CN 116426578A. According to CN116426578A, recombinant genetically engineered bacteria containing genes encoding the nitrobenzene reductase nbzA, the hydroxylamine benzene variant enzyme habA and the glucose dehydrogenase GDH can be obtained.

The invention also provides application of NAD kinase or a mutant thereof in biosynthesis of ursodeoxycholic acid UDCA, and the application method comprises the following steps: introducing NAD kinase or its mutant into a multienzyme reaction system to make NAD ⁺ Conversion to NADP ⁺ Glucose dehydrogenase GDH reduces NADP+ to form coenzyme NADPH, and supplies hydroxysteroid dehydrogenase 7b-HSDH to biologically convert substrate 7-ketolithocholic acid 7-KLCA into ursodeoxycholic acid UDCA.

Further, the reaction process is as follows: NAD kinase or its mutant converts NAD+ into NADP+, glucose dehydrogenase GDH reduces NADP+ to generate coenzyme NADPH, and hydroxysteroid dehydrogenase 7b-HSDH catalyzes substrate 7-ketolithocholic acid 7-KLCA under the action of NADPH providing electron to generate ursodeoxycholic acid UDCA.

The reaction formula is shown as follows:

specifically, the method preferably used is as follows:

the enzyme mixing system is formed by taking hydroxysteroid dehydrogenase 7b-HSDH, glucose dehydrogenase GDH, NAD kinase or mutants thereof as catalysts, 7-ketolithocholic acid 7-KLCA is taken as a substrate, glucose, coenzyme NAD and ATP are added, and a reaction system is constructed to synthesize ursodeoxycholic acid UDCA.

Further, in the reaction system, the concentration of the substrate 7-ketolithocholic acid 7-KLCA is 10-40 g/L, and the mass fraction of glucose is 2-5%.

The solvent of the reaction system is a buffer solution having a pH of 6.5 to 8, preferably a phosphate buffer solution having a pH of 7 to 8 and a pH of 50 to 100 mM.

The reaction temperature is 25 to 50℃and preferably 30 to 35 ℃. The reaction time is 0.25 to 1 hour.

After the reaction is finished, separating and purifying the reaction liquid to obtain ursodeoxycholic acid UDCA pure product.

The catalyst comprises hydroxysteroid dehydrogenase 7b-HSDH, glucose dehydrogenase GDH, NAD kinase or mutants thereof, and the form of the catalyst can be an enzyme form or a bacterial form. The enzyme forms include free enzymes, immobilized enzymes, including purified enzymes, crude enzymes, fermentation broths, vector immobilized enzymes, cell debris, etc.: the forms of the bacterial cells include viable bacterial cells and/or dead bacterial cells.

The catalyst is preferably in the form of wet bacteria or crude enzyme liquid, and when the catalyst is in the form of wet bacteria, the mass concentration of the hydroxysteroid dehydrogenase 7b-HSDH wet bacteria in the reaction system is 5-15 g/L, the mass concentration of the glucose dehydrogenase GDH wet bacteria is 2-10 g/L, and the mass concentration of the NAD kinase or a mutant wet bacteria thereof is 5-15 g/L.

Further, it is preferable that the mass ratio of the wet cell of hydroxysteroid dehydrogenase 7b-HSDH, glucose dehydrogenase GDH, NAD kinase or a mutant thereof is 2:1:2.

the concentration of the substrate 7-ketolithocholic acid 7-KLCA is 10-40 g/L, so that the substrate 7-ketolithocholic acid 7-KLCA is in a supersaturated state in a reaction system.

Hydroxysteroid dehydrogenase 7b-HSDH is wild-type or mutant, and is obtainable by reference to patent CN 109182284A or other publications or patents. Culturing recombinant genetically engineered bacteria containing the encoding gene of the hydroxysteroid dehydrogenase 7b-HSDH, inducing the expression of the hydroxysteroid dehydrogenase 7b-HSDH to obtain wet bacterial cells of the hydroxysteroid dehydrogenase 7b-HSDH, and further obtaining wet enzyme liquid or separating and purifying to obtain pure protein.

The invention also provides application of NAD kinase or mutant thereof in biosynthesis of the intermediate of the Ruimegempam, wherein the application method comprises the following steps: NAD kinase or a mutant thereof is introduced into a multienzyme reaction system, NAD+ is converted into NADP+, glucose dehydrogenase GDH reduces NADP+ to generate coenzyme NADPH, imine reductase IRED is supplied, and substrates pyridine-2, 3-diamine and 4-oxo-piperidone hydrochloride are reduced to generate a precursor compound II of the Ruimepam intermediate.

The precursor compound II of the remigem intermediate is further reacted with N, N' -carbonyl diimidazole CDI to generate a compound I.

The reaction formula is shown as follows:

in the reaction process, the introduction of NAD kinase and the mutant thereof converts a large amount of NAD+ irrelevant to the reaction in cells into NADP+, provides enough and necessary NADP (H) for the synthesis route and provides energy for the reaction, thereby not only overcoming the problems of extra addition of NADPH, consumption of pure NADPH and high production cost in the biosynthesis route, but also improving the catalysis efficiency.

Specifically, the method preferably used is as follows:

an enzyme mixing system is formed by taking imine reductase IRED, glucose dehydrogenase GDH, NAD kinase or mutants thereof as catalysts, pyridine-2, 3-diamine and 4-oxo-piperidone hydrochloride are taken as substrates, glucose, coenzyme NAD and ATP are added, a reaction system is constructed, and reduction reaction is carried out, so that a precursor compound II of the Ruimei gemma intermediate is generated.

Further, in the reaction system, the concentration of the substrate pyridine-2, 3-diamine is 3-20 g/L, the concentration of 4-oxo-piperidone hydrochloride is 1-10 g/L, and the concentration of glucose is 3-20 g/L.

Preferably, the molar ratio of pyridine-2, 3-diamine to 4-oxo-piperidone hydrochloride is 2-10:1.

Further, the solvent of the reaction system is buffer solution with pH of 6.5-8, and the reaction system contains DMAO with volume fraction of 5%. Preferably, the phosphate buffer solution with pH 7-8 and 50-100 mM contains 5% DMAO by volume.

The reaction temperature is 25 to 50℃and preferably 25 to 30 ℃. The reaction time is 10 to 15 hours.

And after the reaction is finished, separating and purifying the reaction liquid to obtain a pure product of the precursor compound II of the remigempam intermediate.

The catalyst comprises imine reductase IRED, glucose dehydrogenase GDH, NAD kinase or mutants thereof, and the form of the catalyst can be in the form of enzyme or bacterial form. The enzyme forms include free enzymes, immobilized enzymes, including purified enzymes, crude enzymes, fermentation broths, vector immobilized enzymes, cell debris, etc.: the forms of the bacterial cells include viable bacterial cells and/or dead bacterial cells.

The catalyst is preferably in the form of wet thalli and crude enzyme liquid, and when the catalyst is in the form of wet thalli, the mass concentration of the imine reductase IRED wet thalli in a reaction system is 10-40 g/L, and the mass concentration of the NAD kinase or a mutant wet thalli thereof is 5-15 g/L. The glucose dehydrogenase GDH is added in the form of dry powder, and the mass concentration is 0.5-1 g/L.

The imine reductase IRED can be obtained by referring to patent CN116813612A, recombinant genetically engineered bacteria containing the coding gene of the imine reductase IRED are cultivated, the expression of the imine reductase IRED is induced, wet thalli of the imine reductase IRED are obtained, and wet enzyme liquid is obtained by further crushing, or pure protein is obtained by separation and purification.

The invention has the beneficial effects that: 1. according to the invention, through modifying the key amino acid residues of NAD kinase NADK, the specific enzyme activity of key enzyme can be improved, the enzyme activity of the constructed NAD kinase mutant is obviously improved compared with that of wild enzyme, the use of cells can be effectively reduced, and the cost is further reduced, so that the method can be applied to industrial production in biosynthesis of pranlukast intermediate 3AHAP, ursodeoxycholic acid UDCA and Ruimepam intermediate. 2. According to the invention, NAD kinase NADK is introduced into a multienzyme reaction system, NADP is catalyzed to generate NADP and is supplied to the multienzyme reaction system to react to generate expensive cofactor NADPH, so that the required consumed NADP (H) is provided for catalyzing the multienzyme reaction system to generate pranlukast intermediate 3AHAP, ursodeoxycholic acid UDCA and ruimegpam intermediate, and pure NADPH is not required to be additionally added into the reaction system, thereby reducing the production cost and improving the catalytic efficiency. Compared with the problems of large pollution, high cost and low reaction rate existing in the prior art, the biosynthesis method provided by the invention is green and safe, has high atomic economy, low cost, mildness and effectiveness, high catalytic efficiency and great industrial value.

Drawings

FIG. 1 is a reaction conversion chart of NAD+, NADP+, NADH, NADPH.

FIG. 2 is a standard graph of protein content in example 5.

FIG. 3 is a bar graph comparing the specific activities of NAD kinase and its mutant pure enzymes.

FIG. 4 is a bar graph showing the comparison of the conversion rates of the substrate m-nitroacetophenone to pranlukast intermediate 3AHAP under different multi-enzyme systems.

FIG. 5 is a bar graph comparing the conversion of the substrate 7-ketolithocholic acid 7-KLCA to ursodeoxycholic acid UDCA under various multienzyme systems.

FIG. 6 is a bar graph comparing the conversion of the biosynthesis of the compound II of the intermediate of the Rametagepam in various multienzyme systems.

Detailed Description

The invention is further illustrated by means of the following examples, which are not intended to limit the scope of the invention. The experimental methods, in which specific conditions are not noted in the following examples, were selected according to conventional methods and conditions, or according to the commercial specifications.

The capital english letters of the present invention represent amino acids as known to those skilled in the art, and according to the present invention, the corresponding amino acid residues are represented herein.

The experimental methods in the invention are all conventional methods unless otherwise specified, and the gene cloning operation can be specifically found in the "molecular cloning Experimental guidelines" by J.Sam Broker et al.

The reagents and materials used in the present invention are commercially available.

NADP (H) detection kit used in the examples was purchased from EnzychromTM, coenzyme NADP and NAD, ATP, chromatographically pure grade methanol and acetonitrile, phthalic dicarboxaldehyde, N-acetyl-L-cysteine all purchased from the Ballkultd of the chemical technology of carbofuran; streptomycin, kanamycin and IPTG were purchased from Shanghai workers; yeast powder and peptone are purchased from Oxoid company; glucose-6 phosphate and glucose-6 phosphate dehydrogenase are purchased from Shanghai such as Ji Biotech development Co; the plasmid extraction kit and the DNA purification recovery kit are purchased from catalpa in Qingzhou family of biological technology limited company; one-step cloning kit was purchased from nuuzan limited; e.coli BL21 (DE 3), plasmid pET-28a (+), pCDFDuet-1, total gene synthesis, etc., were completed by the division of biological engineering (Shanghai); DNA markers, low molecular weight standard proteins, protein pre-gels were purchased from beijing GenStar limited; clonExpress IIOneStep Cloning Kit seamless cloning kit was purchased from Nanjinouzan Biotech Co., ltd; pfu DNA polymerase and DpnI endonuclease were purchased from Semer Feishi technologies (China); primer synthesis and sequence sequencing work are completed by catalpa in Hangzhou, optimago biotechnology company. The above methods of reagent use are referred to in the commercial specifications.

The reagents used in the downstream catalysis process, i.e., m-nitroacetophenone, 3-amino-2-hydroxyacetophenone, 7-ketolithocholic acid 7-KLCA, ursodeoxycholic acid UDCA, pyridine-2, 3-diamine and 4-oxopiperidone hydrochloride, were purchased from Ara Ding Shiji (Shanghai, china), and other commonly used reagents were purchased from national pharmaceutical group chemical reagent Co.

The following examples detect the reaction progress product by High Performance Liquid Chromatography (HPLC) and analyze the product.

The HPLC analysis method of the product 3-amino-2-hydroxyacetophenone comprises the following steps: chromatographic column-A phenyl group; column temperature/40 ℃; flow rate/1 mL/min; detection wavelength/235 nm; mobile phase: 13.5mM trifluoroacetic acid: pure acetonitrile=75:25.

The HPLC analysis method of ursodeoxycholic acid UDCA comprises the following steps: column/QSC 18,5 μm, 4.6X1250 mm; column temperature/30 ℃; flow rate/1 mL/min; detection wavelength/210 nm; mobile phase: 20mM phosphate buffer, pure acetonitrile=40: 60.

separation and purification method of the precursor compound II of the intermediate of the remigem: after the reaction, saturated Na was used ₂ CO ₃ The solution was adjusted to pH 10 and extracted with ethyl acetate (3X 1 mL). Then using anhydrous Na ₂ SO ₄ Drying, distilling under reduced pressure to remove the organic solvent, and purifying the crude product by silica gel column chromatography to obtain the calculated mass of the compound II.

The HPCL analysis method of NADP (H) is as follows; column/QSC 18,5 μm, 4.6X1250 mm; column temperature/30 ℃; flow rate/1 mL/min;detection wavelength/261 nm; the sample injection amount is 10 mu L; mobile phase: the gradient mobile phase contained two solvents (pH 6.8, 50mM in PBS buffer and chromatographic grade methanol) and the procedure set forth in Table 1. Method for mobile phase configuration of PBS buffer at pH 6.8, concentration 50 mM: 1L of Na at 50mM concentration was prepared ₂ HPO ₄ Aqueous (alkaline) and NaH ₂ PO ₄ (acidic) aqueous solution, then in 1LNaH ₂ PO ₄ Slowly adding Na into aqueous solution (acidity) ₂ HPO ₄ Aqueous (alkaline), pH meter test probes were simultaneously placed in a beaker until pH 6.8. After the buffer solution is prepared, pumping and filtering the water film, filling the water film into a 2L blue mouth bottle, removing bubbles by ultrasonic waves for 30min, and standing the water film to normal temperature for standby.

TABLE 1

High throughput NADP (H) detection method:

transformants were inoculated into 96-well plates and incubated in a shaking table at a constant temperature of 37℃for 12-16 hours at a shaking speed of 200rpm. Then, the seed culture solution of the 96-well plate is transferred to a 96-well plate fermentation culture medium, and an IPTG inducer is added when the OD 600=0.4-0.7, and the culture is performed in a shaking table at a constant temperature of 28 ℃ for 12-16 hours, and the shaking table rotation speed is 200rpm. The cultured 96 and Kong Fajiao solutions were centrifuged at 4000rpm for 10 minutes, and the supernatant was discarded to collect the cells. The collected cells were resuspended in phosphate buffer pH7.5 and iATPSnFR1.1 to prepare 50g/L of a suspension. A small amount of ATP powder was poured into a 1.5mL EP tube, and phosphate buffer solution at pH7.5 was added to prepare a 100mM ATP solution. 90. Mu.L of the prepared 50g/L iATPSnFR1.1 suspension was added to a black, bottom-opaque flat 96-well plate, and 10. Mu.L of 100mM ATP solution was added to react for 3min, and the excitation wavelength at 485nm and the fluorescence intensity at 515nm were measured.

Example 1: preparation of genetically engineered bacteria

Wild-type nitroreductase (nbzA), hydroxylamine phenylmutase (habA), hydroxysteroid dehydrogenase (7 b-HSDH), imine Reductase (IRED) and Glucose Dehydrogenase (GDH) deposited in the laboratory were plate streaked for activation and sequencing for subsequent recombinase expression; genes encoding wild-type nitroreductase (nbzA), hydroxylamine phenylmutase (habA), glucose Dehydrogenase (GDH) are disclosed in chinese patent CN 116426578A. According to the method of CN116426578A, the coding gene is inserted into a recombinant expression vector and then transferred into host bacterium E.coli BL21 (DE 3) for transformation, so as to prepare recombinant genetic engineering bacteria containing the genes for coding nitrobenzene reductase nbzA, hydroxylamine benzene variant enzyme habA and glucose dehydrogenase GDH.

Hydroxysteroid dehydrogenase (7 b-HSDH) was obtained as in patent CN 109182284A and was wild-type. Imine Reductase (IRED) is obtained according to patent CN116813612 a.

Wild-type NAD kinase (NADK) derived from Saccharomyces cerevisiae, genBank No.: NC_001148.4, the amino acid sequence is shown as SEQ ID NO.1, the nucleotide sequence is shown as SEQ ID NO.10, after complete gene synthesis, the recombinant expression vector pCDFDuet-1-ScNADK is obtained by inserting the recombinant expression vector pCDFDuet-1-ScNADK into the expression host E.coli BL21 (DE 3), and sequencing verification shows that the recombinant expression vector pCDFDuet-1-ScNADK is used for the expression of subsequent recombinant enzymes.

LB liquid medium composition: peptone 10g/L, yeast powder 5g/L, naCl 10g/L, water-dissolved constant volume, and sterilizing at 121 ℃ for 20min for later use.

After streaking and activating the engineering bacteria without error in sequencing, selecting single colony, inoculating the single colony into 10ml LB liquid culture medium containing 50 mug/ml kanamycin or streptomycin, shake culturing for 10-12h at 37 ℃, transferring the single colony into 100ml fresh LB liquid culture medium also containing 50 mug/ml kanamycin or streptomycin according to the inoculation amount of 2%, shake-culturing at 37 ℃ until the OD600 reaches about 0.8, cooling to 30 ℃, adding IPTG until the final concentration is 0.5mM, inducing and culturing for 16h, centrifuging the culture solution at 8000rpm for 10min after culturing is finished, discarding the supernatant, collecting the bacteria, and storing in a refrigerator at-20 ℃ for standby.

Example 2 construction of NAD kinase mutants I to VIII (175, 176, 252 and 332)

Mutations at positions 175, 176, 252 and 332 were made on the basis of the wild-type NAD kinase ScNADK sequence described in example 1. The primer sequences of PCR were designed for the mutants mutated at positions 175, 176, 252 and 332 of the mutated NAD kinase NADK sequence, and the sequences of the mutations were as shown in tables 2-5:

TABLE 2

Sequence number	Primer name	Primer sequences
			1	175AF	CATTCGCGCTTGGAGCGCTTGGGTTCTTGTCC
2	175HF	CATTCGCGCTTGGACATCTTGGGTTCTTGTCC
			5	175R	TCCAAGCGCGAATGCAAGAACGGGAGGCA

TABLE 3 Table 3

Sequence number	Primer name	Primer sequences
			1	176VF	TCGCGCTTGGAACCGTGGGGTTCTTGTCCCCC
2	176R	GGTTCCAAGCGCGAATGCAAGAACGGGAG

TABLE 4 Table 4

Sequence number	Primer name	Primer sequences
			1	252HF	GAGAGTTTTTGACTCATACCACGGCTGACGGT
2	252AF	GAGAGTTTTTGACTGCGACCACGGCTGACGGT
			3	252R	AGTCAAAAACTCTCCATCAATAAAGATGT

TABLE 5

Sequence number	Primer name	Primer sequences
			1	332HF	TATCGGTGGATGGGCATCCACAGCAGGACCTT
2	332RF	TATCGGTGGATGGGCGTCCACAGCAGGACCTT
			3	332KF	TATCGGTGGATGGGAAACCACAGCAGGACCTT
4	332R	CCCATCCACCGATAACTTTACTACGGAGT

The PCR (25. Mu.L) amplification system was:

25. Mu.L of 2 XPCR buffer, 1.5. Mu.L of each of the upstream and downstream primers, 1. Mu.L of template plasmid, 1. Mu.L of dNTP, 1. Mu.L of high-fidelity enzyme, and ddH were added ₂ O was made up to 50. Mu.L.

The PCR amplification procedure was:

(1) pre-denaturation at 95℃for 5min, (2) denaturation at 95℃for 30 sec, annealing at 60℃for 30 sec, extension at 72℃for 5min, repeating 30 cycles, (3) extension at 72℃for 10min, and (4) preservation at 4 ℃.

After the PCR is finished, 5 mu L of the amplified product is taken for nucleic acid gel electrophoresis analysis, 2 mu L of Dpn I endonuclease is added into the obtained PCR product with clear target band, and the template is digested for 1h at 37 ℃. After the completion of the reaction, clear up was transformed into BL21 competent cells, which were plated on LB solid medium containing 50. Mu.g/mL of calicheamicin, cultured overnight at 37℃and harvested to obtain transformants containing the mutant.

EXAMPLE 3 high throughput screening of mutant libraries

Screening was performed according to the following experimental procedure:

the transformants obtained in example 2 were inoculated into 96-well plates and cultured in a shaking table at a constant temperature of 37℃for 12-16 hours at a shaking speed of 200rpm. The seed culture solution of the 96-well plate is then transferred to 96-well plate fermentation medium and is at OD ₆₀₀ When the temperature is between 0.4 and 0.7, adding the IPTG inducer, and culturing in a shaking table at the constant temperature of 28 ℃ for 12 to 16 hours, wherein the rotation speed of the shaking table is 200rpm. The cultured 96 and Kong Fajiao solutions were centrifuged at 4000rpm for 10 minutes, and the supernatant was discarded to collect the cells. The collected cells were resuspended in phosphate buffer pH7.5 and iATPSnFR1.1 to prepare 50g/L of a suspension. A small amount of ATP powder was poured into a 1.5mL EP tube, and phosphate buffer solution at pH7.5 was added to prepare a 100mM ATP solution. 90 μl of the prepared 50g/L iATPSnFR1.1 suspension was added to a black, bottom-opaque flat 96-well plate, 10 μl of 100mM ATP solution was added and reacted for 3min, the excitation wavelength at 485nm was measured, and the fluorescence intensity at 515nm emission wavelength was used to screen positive clones.

The positive clones obtained by the preliminary screening were subjected to bacterial culture and re-screening, bacterial cells of positive mutants were obtained as described in example 1, and then the collected recombinant NAD kinase or its mutants were washed twice with 50mM phosphate buffer at pH8.0, and then resuspended in 50mL phosphate buffer at pH8.0, homogenized and crushed, and the crushed solution was centrifuged to remove the precipitate, thereby obtaining a crude enzyme solution containing NAD kinase or its mutants for protein purification.

EXAMPLE 4 protein purification of NAD kinase or mutants I-VIII thereof

(1) Reagent configuration: ni column equilibration buffer (1L): 50mM Tris-HCL,200mM NaCl,50mM imidazole, pH7, 2mM 2-mercaptoethanol; eluent (1L): 50mM Tris-HCL,200mM NaCl,250mM imidazole, pH7, 2mM 2-mercaptoethanol; 20% (v/v) ethanol (200 mL).

(2) Sample treatment: the crude enzyme solution of NAD kinase or its mutant obtained in example 3 was taken as a protein purification sample.

(3) The protein purifier line was rinsed with ultrapure water at a flow rate of 4mL/min for 10min.

(4) The Ni column was attached to the instrument, rinsed with equilibration solution, and then rinsed to baseline stability at a flow rate of 4 mL/min. (5) The sample was applied at a flow rate of 2mL/min, with a single application of about 20mL. The remaining amount of the sample was observed, avoiding inhalation of air.

(6) After loading, rinsing with equilibration solution was continued at a flow rate of 2mL/min until baseline stabilized.

(7) After baseline stabilization, the eluate was rinsed at a flow rate of 2mL/min and the change in UV value was observed. When the UV value appears to rise, 90 seconds later the protein is collected in a 10mL centrifuge tube pre-chilled and placed on ice. (8) continuing to wash with eluent until baseline stability.

(9) The baseline was again stabilized by rinsing with equilibration solution and the loading purification of the next sample continued.

(10) After the completion, the column was washed with 20% ethanol at a flow rate of 5mL/min for 20min, and the column was protected. The whole purification process needs to keep low temperature, so as to avoid the inactivation of enzyme.

Example 5 comparison of enzyme Activity of NAD kinase and mutants No. 2 to No. 9

The positive clones obtained from the initial screening of example 4 and purified from the protein of example 5 (T175A, T175H, L176V, R252H, R252A, I332H, I R and I332K, mutants 2-9 respectively) were subjected to a rescreen reaction, which was tested for mutant catalytic efficiency by HPLC.

The protein concentration of the purified NAD kinase and positive clones thereof is determined by adopting a BCA kit, and the principle is as follows: cu (Cu) ²⁺ Reduced to Cu in a meta-alkaline environment ²⁺ It can form blue complex with BCA reagent, and its protein content can be calculated by referring to standard curve. The specific operation method is as follows:

1. and (5) drawing a standard curve.

(1) Reagents were added separately to a clean standard 96-well transparent plate according to Table 6.

TABLE 6

Hole number	1	2	3	4	5	6	7	8
									Protein standard solution (mu L)	0	1	2	4	8	12	16	20
Deionized water (mu L)	20	19	18	16	12	8	4	0
									Corresponding protein content (ug)	0	0.5	1.0	2.0	4.0	6.0	8.0	10.0

(2) Configuration of BCA working fluid

Adding the BCA reagent A and the BCA reagent B into a 2mL EP tube according to the volume ratio of 50:1, and uniformly mixing for later use.

(3) And adding the prepared working solution into the front 8 air parts, placing the vertical horse into an enzyme-labeled instrument, slightly vibrating, preserving the temperature at 37 ℃ for 30min, and then measuring the absorption value at 562 nm. A standard curve can be made based on absorbance values corresponding to standard protein concentrations, as shown in fig. 2, with the standard curve equation y=0.19397x+0.03427.

The catalytic efficiency of NAD kinase was compared with that of its mutants by HPLC measurement of the amount of NADP produced. Definition of enzyme activity: the amount of enzyme required to catalyze the production of 1. Mu. Mol NADP per minute of NAD and ATP at 35℃and pH 7.5 was 1 enzyme activity unit (U).

Specific enzyme activity (U/g): number of enzyme activities contained per gram of pure enzyme.

Reaction system (1 ml): 200mM pH 7.5Tris-HCL,2mM NAD,10mM ATP,10mM MgCl ₂ 0.1g/L NAD kinase or mutant pure enzyme. Liquid phase detection of NADP production after mixing reaction for 10minThe specific enzyme activity of NAD kinase or its mutant was calculated by calculating the enzyme activity and obtaining the protein concentration of NAD kinase or its mutant according to a standard curve (FIG. 2). Three replicates were performed for each set of samples. The specific enzyme activity results are shown in FIG. 3 and Table 7.

TABLE 7

The results in Table 7 and FIG. 3 show that the mutant pure enzyme has a greatly improved specific enzyme activity compared with the wild-type NAD kinase. Wherein the R252A mutant with the number of 6 has the highest specific activity.

Example 6 verification of catalytic efficiency of NAD kinase addition

(1) The catalytic efficiency of NAD kinase addition was compared to that of NAD kinase not added by measuring the amount of 3-amino-2-hydroxyacetophenone produced. The 2ml reaction system comprises: 20g/L substrate m-nitroacetophenone, 10mM ATP,8mM NAD,50mM phosphate buffer, pH8.0, 50g/L glucose, 5g/L nitroreductase crude enzyme and 35g/L hydroxylamine phenylmutase crude enzyme, and 60g/L glucose dehydrogenase crude enzyme, 15g/L ScNADK kinase (wild-type) crude enzyme or optimal mutant (R252A mutant No. 6) crude enzyme (equivalent amount of PBS buffer was added to control nbzA-habA-GDH), the reaction temperature was set at 30℃and after 2 hours of reaction, a sample of the reaction solution was taken for treatment, the concentration of 3-amino-2 hydroxyacetophenone was measured using HPLC and the 3AHAP yield, yield and conversion rate were calculated as shown in Table 8 and FIG. 4.

TABLE 8

As can be seen from the results of FIG. 4 and Table 8, the catalytic efficiency is greatly improved after the NAD kinase ScNADK is introduced into the multienzyme system, the yield is improved from 1.59g/L to 3.19g/L after 2 hours of reaction, and the substrate conversion rate is improved from 7.9% to 16%; after the ScNADK mutant R252A is introduced into a multienzyme system, the yield is improved from 1.59g/L to 4.21g/L, and the highest substrate conversion rate reaches 21.1%.

(2) The catalytic efficiency of NAD kinase added was compared with that of NAD kinase not added by measuring the amount of ursodeoxycholic acid UDCA produced. The 10ml reaction system comprises: 10g/L substrate 7-ketolithocholic acid 7-KLCA,100mM pH8.0 phosphate buffer, 20g/L glucose, 10mM ATP,8mM NAD,10g/L hydroxysteroid dehydrogenase 7b-HSDH cells, 5g/L glucose dehydrogenase cells and 10g/L ScNADK kinase or its optimal mutant cells (equal amount of PBS buffer is added to control 7 b-HSDH-GDH), the reaction temperature is set at 30℃for 15min, and after the reaction, a sample of the reaction solution is taken for treatment, the concentration of ursodeoxycholic acid UDCA is measured by HPLC and the UDCA yield, yield and conversion rate are calculated as shown in Table 9 and FIG. 5.

TABLE 9

The results of FIG. 5 and Table 9 show that the catalytic efficiency is greatly improved after the NAD kinase ScNADK is introduced into the multienzyme system, the yield is greatly improved from 0.46g/L to 5.96g/L after 15 minutes of reaction, and the substrate conversion rate is improved from 4.6% to 59.6%; after the ScNADK mutant R252A is introduced into a multienzyme system, the yield is improved from 0.46g/L to 7.75g/L, the substrate conversion rate reaches the highest 77.5%, and the conversion rate and the yield are improved by more than 10 times.

(3) The catalytic efficiency of NAD kinase added was compared to that of NAD kinase not added by measuring the amount of the produced compound II, an intermediate of remigempam. The 10ml reaction system comprises: 5.46g/L pyridine-2, 3-diamine, 1.36 g/L4-oxopiperidone hydrochloride, 100mM pH7.5 phosphate buffer, 5% (v/v) DMSO,3.6g/L glucose, 10mM ATP,8mM NAD,0.39g imine reductase cell IRED and 5mg glucose dehydrogenase powder, 0.15g ScNADK kinase or optimal mutant cell (equal amount of PBS buffer and 1mg NADP, no NAD and ATP were added to control IRED-GDH), the reaction temperature was set at 25℃and after 12 hours of reaction, the product quality was calculated by separating and purifying the reaction liquid samples, and the yield and conversion rate were as shown in Table 10 and FIG. 6.

Table 10

FIG. 6 and Table 10 show that the catalytic efficiency is improved after the NAD kinase ScNADK is introduced into the multienzyme system, the yield is improved from 1.45g/L to 1.84g/L after 12 hours of reaction, and the substrate conversion rate is improved from 21.3% to 27%; after the ScNADK mutant R252A is introduced into a multienzyme system, the yield is improved to 2.06g/L from 1.45g/L, and the substrate conversion rate reaches the highest 30.2%.

It is apparent that the above examples are given by way of illustration only and are not limiting of the embodiments. Other variations or modifications of the above teachings will be apparent to those of ordinary skill in the art. It is not necessary here nor is it exhaustive of all embodiments. While still being apparent from variations or modifications that may be made by those skilled in the art are within the scope of the invention.

Claims

1. An NAD kinase derived from Saccharomyces cerevisiae, the amino acid sequence of which is shown in SEQ ID NO. 1.

2. An NAD kinase mutant, which is characterized in that the NAD kinase mutant is obtained by single point mutation at 175, 176, 252 and 332 of an amino acid sequence shown in SEQ ID NO. 1.

3. The NAD kinase mutant according to claim 2, characterized in that the mutation is one of the following:

4. A gene encoding the NAD kinase or a mutant thereof according to any one of claims 1-3.

5. A recombinant expression vector comprising a gene encoding the NAD kinase or a mutant thereof according to claim 4.

6. The recombinant genetically engineered bacterium containing the coding gene of NAD kinase or its mutant constructed by the recombinant expression vector of claim 5.

7. The application of NAD kinase with an amino acid sequence shown as SEQ ID No.1 or NAD kinase as claimed in any one of claims 1-3 or a mutant thereof in biosynthesis of pranlukast intermediate 3AHAP, ursodeoxycholic acid UDCA or remigermpam intermediate compound II.

8. The application according to claim 7, characterized in that the method of application is: NAD kinase or its mutant is introduced into a multienzyme reaction system to convert NAD+ into NADP+, and glucose dehydrogenase GDH reduces NADP+ into coenzyme NADPH, which provides reducing capability for synthesizing medicine intermediate pranlukast intermediate 3AHAP, ursodeoxycholic acid UDCA or Ruimepam intermediate compound II.

9. The application of claim 8, wherein the method of application is one of:

introducing NAD kinase or a mutant thereof into a multienzyme reaction system, converting NAD+ into NADP+, reducing NADP+ by glucose dehydrogenase GDH to generate coenzyme NADPH, supplying nitroreductase to couple hydroxylamine phenylmutase, and biologically converting substrate m-nitroacetophenone into a pranlukast intermediate 3-amino-2-hydroxyacetophenone;

the reaction formula is shown as follows:

(II) introducing NAD kinase or a mutant thereof into a multi-enzyme reaction system, and introducing NAD ⁺ Conversion to NADP ⁺ Glucose dehydrogenase GDH reduces NADP+ to generate coenzyme NADPH, supplies hydroxysteroid dehydrogenase 7b-HSDH, and biologically converts substrate 7-ketolithocholic acid 7-KLCA into ursodeoxycholic acid UDCA;

the reaction formula is shown as follows:

(III) introducing NAD kinase or a mutant thereof into a multienzyme reaction system, converting NAD+ into NADP+, reducing NADP+ by glucose dehydrogenase GDH to generate coenzyme NADPH, supplying imine reductase IRED, and reducing substrates pyridine-2, 3-diamine and 4-oxo-piperidone hydrochloride to generate a precursor compound II of the remigermpam intermediate;

the reaction formula is shown as follows:

10. the application according to claim 9, characterized in that the method of application is one of the following:

the method comprises the steps of (A) forming an enzyme mixing system by taking nitroreductase nbzA, hydroxylamine phenylmutase habA, glucose dehydrogenase GDH, NAD kinase or mutants thereof as catalysts, adding glucose, coenzyme NAD and ATP by taking m-nitroacetophenone 3NAP as a substrate, and constructing a reaction system to synthesize 3-amino-2 hydroxyacetophenone 3AHAP;

(II) using hydroxysteroid dehydrogenase 7b-HSDH, glucose dehydrogenase GDH, NAD kinase or mutants thereof as catalysts to form an enzyme mixing system, using 7-ketolithocholic acid 7-KLCA as a substrate, adding glucose, coenzyme NAD and ATP, and constructing a reaction system to synthesize ursodeoxycholic acid UDCA;

And thirdly, an enzyme mixing system is formed by taking imine reductase IRED, glucose dehydrogenase GDH, NAD kinase or mutants thereof as catalysts, pyridine-2, 3-diamine and 4-oxo-piperidone hydrochloride are taken as substrates, glucose, coenzyme NAD and ATP are added, a reaction system is formed, and a reduction reaction is carried out, so that a precursor compound II of the rui-Mei-gemm intermediate is generated.