CN108251466A - A kind of method of enzymatic clarification esomeprazole - Google Patents

Abstract

The invention discloses a kind of methods of the enzymatic clarification esomeprazole of one kettle way, include the following steps：2 sulfydryl, 5 methoxybenzimidazol and 23,5 dimethyl of chloromethyl, 4 methoxy-pyridine hydrochloride in solvent are reacted in the presence of a base, material pH value is adjusted after reaction to 69；Material, monooxygenase, helper component and aqueous phase solvent are mixed, reacted with oxidant, generates esomeprazole, you can.The present invention method eliminate it is refined, purifying Omeprazole thioether the step of, simplify operating procedure, shorten the time of synthetic route, and be catalyzed reaction efficiency height, production cost is greatly reduced, have superior industrial applications value.

Description

A kind of method of enzymatic clarification esomeprazole

Technical field

The invention belongs to pharmacy and technical field of bioengineering, and in particular to a kind of method of enzymatic clarification esomeprazole.

Background technology

Esomeprazole (esomeprazole) be by Sweden AstraZeneca (AstraZeneca) company separation synthesize it is complete First isomers proton pump inhibitor (I-PPI) of ball, in September, 2000 are the S- isomeries of Omeprazole in Britain's Initial Public Offering The specific inhibitor of body and currently the only I-PPI proton pumps.Its entitled S-5- methoxyl groups -2- ((S)-((4- first of chemistry Oxygroup -3,5- dimethyl -2- pyridyl groups) methyl) sulfinyl) -1H- benzimidazoles, chemical constitution is as shown in following formula I.

The synthesis of esomeprazole biological enzyme has reaction yield high, and product chiral selectivity is preferable, and without heavy metal The advantage of chiral ligand.US5840552A screens a series of bacterial strains available for biooxidation reactions, is catalyzed chiral selectivity Preferably, product ee values are more than 99%.CN102884178A develops a kind of monooxygenase, and single secondary response can turn under two-phase system The concentration of substrate of change is 30g/L.All it is by Austria after purification but in the preparation process of current enzymatic clarification esomeprazole U.S. draws azoles thioether to carry out catalysis reaction for substrate.

The one pot reaction of enzymatic is current it has been reported that be the synthetic method that is concerned in recent years, major advantage It is：High catalytic efficiency, easy to operate, reaction condition is mild.Omeprazole thioether (chemical name：5- methoxyl groups -2- (4- first Oxygroup -3,5- dimethyl -2- pyridyl groups) methyl thio -1H- benzimidazoles)) it is typically by 2- sulfydryl -5- methoxyl group benzos Imidazoles and 2- chloromethyls -3,5- dimethyl -4-methoxypyridine hydrochloride are condensed to yield, which is usually single It is reacted in organic solvent, such as methanol (preparation of Omeprazole sulphone, military defense, Tang Lei etc., with clinic grind by pharmacy Study carefully, 2010.18.6.585-586), ethyl acetate, dichloromethane or toluene (CN1705656A).It is generally believed that above-mentioned solvent Or enzyme law catalysis larger to the toxic action of enzyme reaction is more harsh to reaction condition, and generally preceding step can be reacted and carry out one Fixed post processing purifying, therefore do not taken into account that usually based on the reaction condition and closed by the condensation reaction for starting point using one kettle way Into esomeprazole；Also, when toluene is as solvent, quantity of solvent is big, can not carry out one pot reaction with enzymatic.

Invention content

Technical problem solved by the invention is that overcoming existing esomeprazole enzyme preparation technique needs to use The Omeprazole thioether of purification is raw material, and process is more, it is complicated for operation the defects of, the enzymatic clarification Esso for providing a kind of one kettle way is beautiful The method for drawing azoles.The method of the present invention can simplify operating procedure, improve reaction efficiency, have superior industrial applications valency Value.

The present invention solves above-mentioned technical problem by the following technical programs.

The present invention provides a kind of methods of enzymatic clarification esomeprazole, include the following steps：

(1) by 2- sulfydryl -5- methoxybenzimidazols and 2- chloromethyls -3,5- dimethyl -4-methoxypyridine hydrochloride It is reacted in solvent in the presence of a base, material pH value is adjusted after reaction to 6-9；

(2) material, monooxygenase, helper component and aqueous phase solvent are mixed, is reacted with oxidant, generation angstrom Suo Meila azoles, you can.

In step (1), the 2- sulfydryls -5- methoxybenzimidazols (hereinafter referred compound A) and 2- chloromethyls -3,5- The dosage and proportioning of dimethyl -4-methoxypyridine hydrochloride (hereinafter referred compound B) are that this field is conventional, reaction equation It is as follows：

In the present invention, the method for the enzymatic clarification esomeprazole prepares synthesis esomeprazole using one kettle way, I other words：Without removing solvent, being filtered, washed and the post-processing operations such as purifying after the step (1)；Before step (2), Without removing solvent, being filtered, washed and the pretreatment operations such as purifying.

In step (1), the alkali is the alkali that this field is reacted conventionally used for such, such as can be sodium hydroxide, hydrogen-oxygen Change one or more in potassium, sodium methoxide and triethylamine.

In step (1), the solvent can be solvent commonly used in the art, such as including but not limited to benzene, toluene, It is one or more in alcohol, ether, halogenated hydrocarbons, ester and dimethyl sulfoxide.The alcohol is better selected from methanol, ethyl alcohol, propyl alcohol, isopropanol And butanol, the halogenated hydrocarbons are better selected from dichloromethane, chloroform and carbon tetrachloride, the ether is better selected from ether, methyl Tertbutyl ether, tetrahydrofuran and 2- methyltetrahydrofurans, the ester are better selected from ethyl acetate and isopropyl acetate.It is described molten Agent can also further include water.Preferably, the solvent is mixed solvent, it is mentioned previously above molten including at least two Agent, such as three kinds.More preferably, the mixed solvent includes at least isopropanol.It is described in the specific embodiment of the present invention Solvent for toluene, isopropyl alcohol and water, toluene, isopropyl alcohol and water mass ratio be preferably (5-20)：(1-3)：(1-2), more preferably Ground is (5-7)：(1-3)：(1-2).

In the specific embodiment of the present invention, the mass ratio of the solvent and reaction raw materials is 2.5:1 hereinafter, it is preferred that 1.1:1 hereinafter, wherein, the quality of the reaction raw materials is the gross mass of compound A and compound B.In this case, The solvent dosage used in step (1) is substantially less than solvent dosage used in the prior art, has better economy.

In step (1), the method and condition of the reaction is the conventional method and condition of such reaction, such as can join Examine the method and condition that the step is reacted in CN1705656A.In the present invention, the temperature of the reaction is preferably 40-75 DEG C, more It is 48-72 DEG C goodly.The time of the reaction is preferably 1-3h, is more preferably 2-3h.

In step (1), the method for adjusting material pH value is this field conventional method, is generally adjusted with acid, such as vinegar Acid, hydrochloric acid etc..The material pH value is preferably 7.5-8.

In step (2), the method and condition of the mixing can be the method and condition of this field routine, and order by merging is not Limit.Typically monooxygenase, helper component and aqueous phase solvent are added in the material.

In step (2), the use form of the monooxygenase is unlimited, can be in enzyme powder, enzyme solution and genetic engineering bacterium It is one or more.The monooxygenase can be monooxygenase commonly used in the art, preferably cyclohexanone monooxygenase.It should Work as understanding, level and understanding based on the prior art, the obtained cyclohexanone monooxygenase of genetic engineering have preferably catalysis Convert the effect of Omeprazole thioether, it is preferred to use the obtained non-natural cyclohexanone monooxygenase of genetic engineering, such as " engineering CHMO polypeptides " disclosed in CN102884178A.By common sense in the field, the gene of the cyclohexanone monooxygenase The gene of engineering bacteria be typically from Lysinibacillus sp., Ustilago sp., Arthrobacter sp., Brevibacterium sp., Acinetobacter sp., Mycobacterium sp., Aspergillus sp. or Cunninghamella sp..In the present invention, preferably, the amino acid sequence of the cyclohexanone monooxygenase is SEQ ID NO.2, SEQ ID NO.4 or SEQ ID NO.6.More preferably, the nucleotides sequence of the cyclohexanone monooxygenase is classified as SEQ ID NO.1, SEQ ID NO.3 or SEQ ID NO.5.The dosage of the monooxygenase can be according to the type difference of its addition, by this The mode of field routine is selected.For example, in one embodiment of the present invention, the monooxygenase is made in the form of enzyme powder With the mass ratio of enzyme powder and total solvent is (5-6) g/kg.

In step (2), the helper component can be helper component (or confactor) commonly used in the art, usually Can be reduced coenzyme, such as NADPH and/or NADH disclosed in CN102884178A, alternatively, the helper component It can be the combination that oxidized coenzyme, dehydrogenase and dehydrogenase correspond to substrate.The oxidized coenzyme is preferably NADP⁺With/ Or NAD⁺.The use form of the dehydrogenase is unlimited, can be one or more in enzyme powder, enzyme solution and genetic engineering bacterium.Institute It can be dehydrogenase commonly used in the art to state dehydrogenase, preferably ketoreductase (also known as alcohol dehydrogenase), be more preferably different Propyl alcohol dehydrogenase.By common sense in the field, the gene of the genetic engineering bacterium of the ketoreductase is typically from Lactobacillus Sp., Yarrowialipolytica sp. or Gluconobacteroxydans.Preferably, the amino of the ketoreductase Acid sequence is SEQ ID NO.8, SEQ ID NO.10 or SEQ ID NO.12.More preferably, the nucleotide of the ketoreductase Sequence is SEQ ID NO.7, SEQ ID NO.9 or SEQ ID NO.11.In addition, the ketoreductase is alternatively commercially available production Product, such as the still ES-KRED-104 of the section's biological medicine Shanghai Co., Ltd or KRED- of Suzhou Chinese biotechnology of enzymes Co., Ltd 127。

By common sense in the field, reduced coenzyme may not need regeneration, but can also be realized using additional helper component The regeneration of reduced coenzyme.The additional helper component can be appropriate dehydrogenase, such as glucose dehydrogenase, grape Sugar-phosphate dehydrogenase, hydrogenlyase, phosphorous acidohydrogenase and ketoreductase and corresponding substrate, such as be grape respectively Sugar, G-6-P, formic acid, phosphorous acid or alcohol.Wherein, the dehydrogenase is preferably aforementioned described ketoreductase.

In certain embodiments of the present invention, the helper component is reduced coenzyme.In other realities of the present invention It applies in mode, the helper component is ketoreductase, NADP⁺And secondary alcohol.It is described auxiliary in other embodiments of the present invention It is ketoreductase, NADPH and secondary alcohol to help component.In other embodiments of the present invention, in step (2), in reaction system It is full cell effect, due to carrying coenzyme NADP 11 or NADP in full cell⁺, thus the additional helper component used for ketone also Protoenzyme and secondary alcohol.In other embodiments of the present invention, in step (2), reaction system is cyclohexanone monooxygenase and ketone The full cell effect of reductase, due to carrying coenzyme NADP 11 or NADP in full cell⁺, and at the same time ketoreductase has also been carried, The additional helper component thus used is secondary alcohol.It is it should be understood that secondary when having been contained in the solvent in step (1) During alcohol, such as isopropanol, in step (2), without adding additional secondary alcohol again.

In the preferred embodiment of the present invention, the cyclohexanone monooxygenase and the ketoreductase are with gene work The form of journey bacterium is used.By common sense in the field, cyclohexanone monooxygenase and ketoreductase are expressed respectively two are may be used Strain gene engineering bacterium can also be directly using the genetic engineering bacterium of coexpression.

When containing reduced coenzyme in the helper component, the mass ratio of the reduced coenzyme and total solvent is preferably (0.1-1.5)g/kg.When containing oxidized coenzyme in the helper component, the oxidized coenzyme is compared with the quality of total solvent It is (0.08-0.12) g/kg goodly.The dosage of the correspondence substrate of the dehydrogenase and dehydrogenase need to only meet oxidized coenzyme energy Enough it is regenerated as reduced coenzyme.

In step (2), the aqueous phase solvent can be the conventional use of aqueous phase solvent of enzyme catalysis field, preferably phosphate Buffer solution and/or Tris-HCl buffer solutions, the phosphate buffer solution can be buffer solution of potassium phosphate.The water phase The pH value of solvent is preferably 7-10, is more preferably 8-9.In addition, when cyclohexanone monooxygenase used is made in the form of enzyme solution Used time, the aqueous phase solvent is the part in addition to cyclohexanone monooxygenase in enzyme solution, by common sense in the field, wherein can be with Containing other addible substances when usually preparing enzyme solution, such as MgCl can also be contained in Tris-HCl buffer solutions₂.It is described The mass ratio of solvent described in aqueous phase solvent and step (1) is preferably (1-5.6):1.

In step (2), phase transfer catalyst can also be added in before the reaction.The phase transfer catalyst can be conventional uses Phase transfer catalyst, preferably benzyltriethylammoinium chloride (TEBAC), tetrabutylammonium bromide (TBAB), tetrabutyl chlorination Ammonium (TBAC), 4-butyl ammonium hydrogen sulfate, tri-n-octyl methyl ammonium chloride, dodecyl trimethyl ammonium chloride, tetradecyltrimethylammonium One in ammonium chloride, methyltriphenylphosphonium bromide, ethyltriphenylphosphonium bromide, tetraphenylphosphonibromide bromide and benzyl triphenyl phosphonium chloride phosphine Kind is several.The mass ratio of the phase transfer catalyst and total solvent is preferably (0.5-6) g/kg, is more preferably (0.9- 6)g/kg.In the case where using phase transfer catalyst, the efficiency of enzymic catalytic reaction can be further improved, reduces enzyme process reaction Time.

In step (2), the oxidant can be oxidant commonly used in the art, preferably oxygen.By this field Common sense, when the oxidant is oxygen, can by be continuously passed through oxygen, it is continuous be passed through the modes such as air or oxygen pressurize come Introduce oxygen into reaction system.

In step (2), the other methods and condition of the reaction are the method and condition of this field routine.The reaction Temperature is preferably 10-40 DEG C, is more preferably 18-32 DEG C, is most preferably 23-32 DEG C.

Above, " total solvent " refers to the sum of aqueous phase solvent of solvent and step (2) in step (1).

By common sense in the field, the step of can also be post-processed after the reaction of step (2).The post processing Step is this field routine operation, includes but not limited to solvent, filtering, cleaning and drying and other steps.

On the basis of common knowledge of the art, above-mentioned each optimum condition can be combined arbitrarily to get each preferable reality of the present invention Example.

The reagents and materials used in the present invention are commercially available.

The positive effect of the present invention is：

The method of enzymatic clarification esomeprazole of the present invention, by 2- sulfydryl -5- methoxybenzimidazols and 2- chloromethyl -3, 5- dimethyl -4-methoxypyridine hydrochloride be reaction raw materials, esomeprazole is prepared using one kettle way, eliminate it is refined, The step of purifying Omeprazole thioether simplifies operating procedure, shortens the time of synthetic route, and is catalyzed reaction efficiency height, greatly Width reduces production cost, has superior industrial applications value.

Specific embodiment

It is further illustrated the present invention below by the mode of embodiment, but does not therefore limit the present invention to the reality It applies among a range.Test method without specific conditions in the following example, according to conventional methods and conditions or according to quotient Product specification selects.

In following embodiments, the condition of high performance liquid chromatography is as follows：

Purity detecting condition：

Shimadzu liquid chromatograies, Phenomenex chromatographic columns, mobile phase are 10mM phosphate (pH7.6):Acetonitrile (60: 40), flow velocity 1mL/min, 35 DEG C of column temperature, ultraviolet detection wavelength 300nm, detection duration 15min.

Retention time：Product (3.8min), substrate (8.2min).

Chiral ee values testing conditions：

1260 liquid chromatogram instruments of Angilent, DAICEL CHIRAL AGP chromatographic columns, mobile phase are pH6.0 phosphate Buffer solution:Acetonitrile (85:15), flow velocity 0.6mL/min, 25 DEG C of column temperature, ultraviolet detection wavelength 300nm.

Appearance time：Esomeprazole (3.726min), isomer impurities (2.649min).

In formula：A_API：The peak area of product esomeprazole；

A_IMP：The peak area of isomer impurities.

Embodiment 1：The structure of cyclohexanone monooxygenase genetic engineering bacterium

Entrust Shanghai Jierui Biology Engineering Co., Ltd customization synthesizing cyclohexanone monooxygenase gene segment SEQ ID NO.1, SEQ ID NO.3 and SEQ ID NO.5, the amino acid sequence of corresponding encoded is respectively SEQ ID NO.2, SEQ ID NO.4 and SEQ ID NO.6.Then using the genetic fragment as template, extend that (genetic fragment both ends add Nde I by PCR amplification With BamH I internally-cut enzyme segments), and the genetic fragment is inserted into pET28a plasmids using Nde I and BamH I restriction enzyme sites In, finally the carrier for connecting acquisition is transferred in e. coli bl21 (DE3), structure includes the cyclohexanone monooxygenase gene Recombination bacillus coli engineering strain is denoted as bacterial strain 1#, bacterial strain 2# and bacterial strain 3# respectively.

The primer sequence of wherein PCR amplification extension design is as follows：

Forward primer F1：GGAATTCCATATGAGTACCAAGATGGATTTTGATGC(SEQ ID NO.13)

Reverse primer R1：CGCGGATCCTTACGCATTAGCCTGCTGTTTGG(SEQ ID NO.14)

Embodiment 2：The structure of ketoreductase genetic engineering bacterium

Entrust Shanghai Jierui Biology Engineering Co., Ltd customization synthesis ketoreductase genetic fragment SEQ ID NO.7, SEQ ID NO.9 and SEQ ID NO.11, the amino acid sequence of corresponding encoded is respectively SEQ ID NO.8, SEQ ID NO.10 and SEQ ID NO.12.Then using the genetic fragment as template, extend that (genetic fragment both ends add in Nde I and BamH I by PCR amplification Enzyme cutting segment), and the genetic fragment is inserted into pET28a plasmids using Nde I and BamH I restriction enzyme sites, finally will The carrier that connection obtains is transferred in e. coli bl21 (DE3), and structure includes the recombination bacillus coli gene work of the ketoreductase Journey bacterial strain is denoted as bacterial strain 4#, bacterial strain 5# and bacterial strain 6# respectively.

The primer sequence of bacterial strain 4#PCR amplification extension designs is as follows：

Forward primer F2：GGAATTCCATATGACGGATCGTCTGAAAGG(SEQ ID NO.15)

Reverse primer R2：CGCGGATCCTTACTGGGCGGTATAGCCG(SEQ ID NO.16)

The primer sequence of bacterial strain 5#PCR amplification extension designs is as follows：

Forward primer F3：GGAATTCCATATGGCTTCCGTTTCCATTCC(SEQ ID NO.17)

Reverse primer R3：CGCGGATCCTCACTTGGTAACGGTGGGGTC(SEQ ID NO.18)

The primer sequence of bacterial strain 6#PCR amplification extension designs is as follows：

Forward primer F4：GGAATTCCATATGTCGTCACAGGTTCCATC(SEQ ID NO.19)

Reverse primer R4：CGCGGATCCTCAGAATTTCGCCGTATTCG(SEQ ID NO.20)

Embodiment 3：The structure of co-expression gene engineering bacteria

Reference《Molecular Cloning-A laboratory Mannual》(third edition, 2001) carries out following The experiments such as digestion, connection or the preparation of competent cell, conversion.

Following primers F 5 and R5 are designed, using the genetic fragment of SEQ ID NO.1 cyclohexanone monooxygenases as template, is passed through PCR amplification extends the cyclohexanone monooxygenase genetic fragment (segment both ends add Nde I and BamH I internally-cut enzyme segments)；And profit The gene is inserted into pET-21a plasmids with Nde I and BamH I restriction enzyme sites, carrier after connection is transferred to large intestine bar In bacterium Trans-T1, structure obtains recombinant plasmid, is named as pETC.Bacterium colony PCR verifications, extraction recombination are carried out with primer T7/R3 Plasmid is sequenced, and obtains the errorless recombinant plasmid pETC of result.

Forward primer F5：GGCCATATGAATAATTTTGTTTAACTTTAAGAAGGAGATATAATGAGTACCAAGATGG ATTTTG(SEQ ID NO.21)

Reverse primer R5：CGCGGATCCTTACGCATTAGCCTGCTGTTTGG(SEQ ID NO.22)

Primers F 6 and R6 are designed, then using the dehydrogenation of isopropanol enzyme gene segment of SEQ ID NO.7 as template, is expanded by PCR Increase and extend the dehydrogenation of isopropanol enzyme gene segment (segment both ends add BamH I and Xho I internally-cut enzyme segments)；And utilize BamH I Gene is inserted into corresponding pETC plasmids with Xho I restriction enzyme sites, carrier after connection is transferred to Escherichia coli Trans- In T1, structure obtains recombinant plasmid, is named as pETCK-01.Bacterium colony PCR verifications, extraction recombination are carried out with primers F 6/T7term Plasmid is sequenced, and obtains the errorless recombinant plasmid pETCK-01 of result.It is golden to full formula by the recombinant plasmid transformed obtained is built The expression competent cell of Bioisystech Co., Ltd, Escherichia coli BL21 (DE3) are obtained containing two genes Co-expression gene engineered strain, be denoted as bacterial strain 7#.

Forward primer F6：CGCGGATCCAAGCTTAATAATTTTGTTTAACTTTAAGAAGGAGATATAATGACGGATC GTCTGAAAGGC(SEQ ID NO.23)

Reverse primer R6：CCGCTCGAGTTACTGGGCGGTATAGCCGCC(SEQ ID NO.24)

Embodiment 4：The preparation of genetic engineering bacterium

By above-mentioned recombination bacillus coli engineering strain, bacterial strain 1#, bacterial strain 2#, bacterial strain 3#, bacterial strain 4#, bacterial strain 5#, Bacterial strain 6# and bacterial strain 7# is inoculated into respectively in the 3-5ml liquid LB Tube propagation bases containing corresponding resistant, and shaking table activates at 37 DEG C 12 hours, the culture obtained after activation is transferred by the inoculum concentration of 0.5%-5% (V/V) in fermentation medium, 25-40 DEG C Fermented and cultured 1-3h adds the isopropyl-beta D-thio galactopyranoside (IPTG) of final concentration of 0.05-2g/L, juxtaposition The induced expression 2-24h at 15-35 DEG C, centrifugation, filtering or ultrafiltration obtain bacterium mud, are placed in -80 DEG C and freeze.

Embodiment 5：The preparation of enzyme solution

Bacterial strain 1#, bacterial strain 2#, bacterial strain 3#, bacterial strain 4#, bacterial strain 5#, bacterial strain 6# and bacterium that 10-20g fermentations obtain are weighed respectively The bacterium mud of strain 7#, the clasmatosis buffer solution for being suspended in 100-200ml (contain in 10mmol/L, pH7.4Tris-HCl buffer solution The MgCl of 5mmol/L₂) in, with the power of 100-650W, ultrasonication is carried out in ice-water bath, crushes 4-20s, is spaced 4- 60s, ultrasonic whole process 20-60min, ultrasonication is three times repeatedly.Supernatant is collected by centrifugation under cryogenic conditions and obtains corresponding bacterium The enzyme solution of strain, is placed in -20 DEG C and freezes.

Embodiment 6：The preparation of enzyme powder

The enzyme of 10-50ml bacterial strains 1#, bacterial strain 2#, bacterial strain 3#, bacterial strain 4#, bacterial strain 5#, bacterial strain 6# and bacterial strain 7# are measured respectively Liquid is put into drying basin, is placed in -20 DEG C of refrigerators and is carried out prefreezing, cooling time 24-48h.Then it is dry sample to be placed in freezing It is lyophilized in dry machine, the condenser temperature of freeze drier is -50 DEG C, drying chamber pressure 100Pa, and freeze-drying for 24 hours, obtains enzyme Solid powder, be placed in 4 DEG C it is stored refrigerated.

Embodiment 7：The method (one kettle way) of enzymatic clarification esomeprazole

51g compounds B is dissolved in 70g toluene and 20g aqueous isopropanols, adds 20.4g sodium hydroxides and 10g water groups Into solution, 50 DEG C of heat preservation 5-10min terminate after adding in 41.4g compound A, insulation reaction 2-3h, use ice until solution is clarified Acetic acid tune pH value is 7.5-8.

In above-mentioned reaction solution, the mixed solution of 75g bacterial strain 2#, 75g bacterial strain 6# and 420g phosphate buffer solutions is added in (50mM, pH9.0) adds in 0.5g tetrabutylammonium bromide (TBAB), 0.05g Oxidative Coenzyme II (NADP⁺), it is protected under oxygen pressurize 30 ± 2 DEG C of reactions of temperature, reaction 30h terminate, and it is 99% that high performance liquid chromatography monitoring reaction conversion ratio, which is 98.6%, ee values,.

Embodiment 8：The method (one kettle way) of enzymatic clarification esomeprazole

51g compounds B is dissolved in 50g toluene and 30g aqueous isopropanols, adds 20.4g sodium hydroxides and 20g water groups Into solution, 70 DEG C of heat preservation 5-10min terminate, use is dilute after adding in 41.4g compound A, insulation reaction 1-2h until solution is clarified Hydrochloric acid tune pH value is 7.5-8.

In above-mentioned reaction solution, the mixing for adding in 150g bacterial strain 7# and 240g phosphate buffer solutions (50mM, pH8.0) is molten Liquid adds in 2g tetrabutylammonium bromide (TBAB), is continuously passed through under oxygen and keeps the temperature 25 ± 2 DEG C of reactions, and reaction 40h terminates, efficient liquid It is 99% that phase chromatography monitoring reaction conversion ratio, which is 99.4%, ee values,.

Embodiment 9：The method (one kettle way) of enzymatic clarification esomeprazole

51g compounds B is dissolved in 50g toluene and 30g aqueous isopropanols, adds 20.4g sodium hydroxides and 20g water groups Into solution, 70 DEG C of heat preservation 5-10min terminate, use is dilute after adding in 41.4g compound A, insulation reaction 1-2h until solution is clarified Hydrochloric acid tune pH value is 7.5-8.

In above-mentioned reaction solution, the enzyme solution of 280g bacterial strains 3# and the enzyme solution of 280g bacterial strains 5# are sequentially added, adds in 0.2g also Originality codehydrogenase Ⅱ (NADPH) is continuously passed through under air and keeps the temperature 25 ± 2 DEG C of reactions, and reaction 55h terminates, high performance liquid chromatography monitoring Reaction conversion ratio is that 97.5%, ee values are 99%.

Embodiment 10：The method (one kettle way) of enzymatic clarification esomeprazole

51g compounds B is dissolved in 70g toluene and 20g aqueous isopropanols, adds 20.4g sodium hydroxides and 10g water groups Into solution, 50 DEG C of heat preservation 5-10min terminate after adding in 41.4g compound A, insulation reaction 2-3h, use ice until solution is clarified Acetic acid tune pH value is 7.5-8

In above-mentioned reaction solution, the enzyme solution of 280g bacterial strains 3# and the enzyme solution of 280g bacterial strains 5# are sequentially added, adds in 0.1g also Originality codehydrogenase Ⅱ (NADPH) is continuously passed through under air and keeps the temperature 25 ± 2 DEG C of reactions, and reaction 62h terminates, high performance liquid chromatography monitoring Reaction conversion ratio is 97.5%, and product ee values are that ee values are 99%.

Embodiment 11：The method (one kettle way) of enzymatic clarification esomeprazole

51g compounds B is dissolved in 70g toluene and 10g aqueous isopropanols, adds 20.4g sodium hydroxides and 10g water groups Into solution, 50 DEG C of heat preservation 5-10min terminate, use is dilute after adding in 41.4g compound A, insulation reaction 2-3h until solution is clarified Phosphoric acid tune pH value is 7.5-8.

In above-mentioned reaction solution, sequentially add the enzyme powder of 3g bacterial strains 2# and the enzyme powder and 450gTris-HCl of 3g bacterial strains 4# is delayed Solution (20mM, pH7.5) is rushed, adds in 1g TBAB and 0.05g NADP⁺, continuously it is passed through under oxygen and keeps the temperature 25 ± 2 DEG C of reactions, instead 36h is answered to terminate, it is 99% that high performance liquid chromatography monitoring reaction conversion ratio, which is 98.5%, ee values,.

Embodiment 12：The method (one kettle way) of enzymatic clarification esomeprazole

51g compounds B is dissolved in 200g toluene, adds the solution of 20.4g sodium hydroxides and 10g water composition, 50 DEG C 5-10min is kept the temperature until solution clarification, terminates after adding in 41.4g compound A, insulation reaction 2-3h, be with hydrochloric acid tune pH value 7.5-8。

In above-mentioned reaction solution, sequentially add the enzyme solution of 280g bacterial strains 1#, the enzyme solution of 280g bacterial strains 5#, 20g isopropanols and 0.1g Reducing Coenzyme II (NADPH) is continuously passed through under air and keeps the temperature 25 ± 2 DEG C of reactions, and reaction 60h terminates, high-efficient liquid phase color Spectrum monitoring reaction conversion ratio is 98.6%, and product ee values are 99%.

Embodiment 13：The method (one kettle way) of enzymatic clarification esomeprazole

51g compounds B is dissolved in 200g toluene, adds the solution of 20.4g sodium hydroxides and 10g water composition, 50 DEG C 5-10min is kept the temperature until solution clarification, terminates after adding in 41.4g compound A, insulation reaction 2-3h, be with hydrochloric acid tune pH value 7.5-8。

In above-mentioned reaction solution, sequentially add the enzyme solution of 280g bacterial strains 1#, the enzyme solution of 280g bacterial strains 5#, 20g isopropanols and 1g Reducing Coenzyme II (NADPH) is continuously passed through under air and keeps the temperature 25 ± 2 DEG C of reactions, and reaction 55h terminates, high performance liquid chromatography It is 98.1% to monitor reaction conversion ratio, and product ee values are 99%.

Embodiment 14：The method (one kettle way) of enzymatic clarification esomeprazole

51g compounds B is dissolved in 200g toluene and 20g aqueous isopropanols, adds 20.4g sodium hydroxides and 20g water The solution of composition, 55 DEG C of heat preservation 5-10min terminate after adding in 41.4g compound A, insulation reaction 2-3h until solution clarification, use Glacial acetic acid tune pH value is 7.5-8

In above-mentioned reaction solution, the bacterium mud of 150g bacterial strains 7# and 240g phosphate buffer solutions (50mM, pH8.0) are added in Mixed solution adds in 2g tetrabutylammonium bromide (TBAB), is continuously passed through under air and keeps the temperature 25 ± 2 DEG C of reactions, and reaction 40h terminates, High performance liquid chromatography monitoring reaction conversion ratio is 98.9%, and product ee values are 99%.

Embodiment 15：The method (one kettle way) of enzymatic clarification esomeprazole

51g compounds B is dissolved in 70g toluene and 10g aqueous isopropanols, adds 20.4g sodium hydroxides and 10g water groups Into solution, 50 DEG C of heat preservation 5-10min terminate, use is dilute after adding in 41.4g compound A, insulation reaction 2-3h until solution is clarified Phosphoric acid tune pH value is 7.5-8.

In above-mentioned reaction solution, enzyme powder, the 3g KRED-127 enzyme powders (source of 3g bacterial strains 2# are sequentially added：Suzhou Chinese enzyme life Object Technology Co., Ltd.) and 450g Tris-HCl buffer solutions (20mM, pH7.5), add in 1g TBAB and 0.05g NADP⁺, Continuous be passed through under oxygen keeps the temperature 20 ± 2 DEG C of reactions, and reaction 48h terminates, and high performance liquid chromatography monitoring reaction conversion ratio is 98.7%, Ee values are 99%.

Embodiment 16：The method (one kettle way) of enzymatic clarification esomeprazole

51g compounds B is dissolved in 70g dichloromethane and 10g aqueous isopropanols, adds 20.4g sodium hydroxides and 10g The solution of water composition, 45 DEG C of heat preservation 5-10min terminate until solution clarification after adding in 41.4g compound A, insulation reaction 2-3h, It is 7.5-8 with phosphoric acid,diluted tune pH value.

In above-mentioned reaction solution, sequentially add the enzyme powder of 3g bacterial strains 2#, the enzyme powder of 2g bacterial strains 4# and 450gTris-HCl and delay Solution (20mM, pH7.5) is rushed, adds in 1g TBAB and 0.05g NADP⁺, continuously it is passed through under oxygen and keeps the temperature 20 ± 2 DEG C of reactions, instead 48h is answered to terminate, it is 99% that high performance liquid chromatography monitoring reaction conversion ratio, which is 80.7%, ee values,.

Embodiment 17：The method (one kettle way) of enzymatic clarification esomeprazole

51g compounds B is dissolved in 200g toluene, adds the solution of 20.4g sodium hydroxides and 20g water composition, 55 DEG C 5-10min is kept the temperature until solution clarification, terminates after adding in 41.4g compound A, insulation reaction 2-3h, be with glacial acetic acid tune pH value 7.5-8

In above-mentioned reaction solution, add in 20g aqueous isopropanols, 240g phosphate buffer solutions (50mM,

PH8.0), 2g tetrabutylammonium bromide (TBAB), 0.05g NADP⁺, 3g bacterial strains 2# enzyme powder and 3g

ES-KRED-104 enzyme powders (source：Still section's biological medicine Shanghai Co., Ltd), 25 ± 2 DEG C are kept the temperature under oxygen pressurize Reaction, reaction 38h terminate, and high performance liquid chromatography monitoring reaction conversion ratio is 98.5%, and product ee values are 99%.

Embodiment 18：The method (one kettle way) of enzymatic clarification esomeprazole

51g compounds B is dissolved in 200g ethyl acetate, adds the solution of 20.4g sodium hydroxides and 10g water composition, 50 DEG C of heat preservation 5-10min terminate, with phosphoric acid tune pH value until solution clarification after adding in 41.4g compound A, insulation reaction 2-3h For 7.5-8.

In above-mentioned reaction solution, 20g isopropanols, 75g bacterial strain 2#, 75g bacterial strain 6# and 420g phosphate buffer solutions are added in The mixed solution of (50mM, pH9.0) adds in 0.5g tetrabutylammonium bromide (TBAB), 0.05g Oxidative Coenzyme II (NADP⁺), oxygen 30 ± 2 DEG C of reactions are kept the temperature under gas pressurize, reaction 36h terminates, and high performance liquid chromatography monitoring reaction conversion ratio is for 76.6%, ee values 99%.

SEQUENCE LISTING

<110>Zhejiang Jingxin Pharmaceutical Co., Ltd, Shanghai Jingxin Biological Medical Co., Ltd.

<120>A kind of method of enzymatic clarification esomeprazole

<130> 142

<160> 24

<170> PatentIn version 3.5

<210> 1

<211> 1632

<212> DNA

<213>Artificial sequence

<400> 1

atgagtacca agatggattt tgatgcaatt gtgatcggtg ccggctttgg cggcctgtat 60

gccgttaaaa aactgcgcga tgaactggaa ctgaaagtta aagcctttga taaagcaacg 120

gatgtgggcg ggacctggta ttggaatcgc tatccgggcg cactgacgga tacggaaacc 180

catctgtatt gctattcttg ggataaagaa atgctacaga gtttagaaat caaaaagaaa 240

tatgtgcagg gcccagatgt tcgcaaatac ttacagcagg ttgcagaaaa acatgatctg 300

aaaaaatctt atcagtttaa taccgccgtg acgagtgctc attataacga ggcggatgcc 360

ctgtgggaag tgacaaccga atatggcgat aaatataccg cacgctttct gattaccgcc 420

gtgggtctgc tgtctgcacc taattggcct aatatcaaag gcatcaatca gtttaaaggt 480

gaactgcatc atacgtcacg ctggccggat gatgtgagca tcgaaggcaa gagagtgggt 540

gtgatcggta cgggtagtac gggcgttcag gttattacag cagttgctcc attagccaaa 600

catctgaccg tgtttcagcg tagtccacag tatagtgttc cgatcggcaa tgatccactg 660

agcgaagaag atgttaagaa gattaaagat aattatgata aaatctggga tggtgtgaaa 720

aatagcgcct tagcctatgg tgtgaatgag tctacagttc cagccatgag cgtgagtgca 780

gaagaacgta aagccgtgtt tgaaaaggca tggcagacgg gtggcgggat gcgctttatg 840

tttgaaacct ttggggacat aattaccaat atggaagcta atatcgaagc acagaatttt 900

atcaaaggca aaattgcccg catcgttaaa gatcctgcca ttgcacagaa actgatgcct 960

caggatctgt atgcttgtcg cccgctgtgc gattcaggct attataatac ctttaatcgc 1020

gaaaatgttc gtctggaaga tgttaaagct aatccgatcg tggaaatcac cgaaaatggc 1080

gttaaactgg aaaatggcga ttttgtggaa ttagatatgc tgatttgcgc gaccggcttt 1140

gatgcgggcg atggctctta caagcgcatc gacatacagg ggaaaaatgg cttagccatc 1200

aaagattatt ggaaagaagg tcctagtagc tatatgggcg ttgcggttaa caactatccg 1260

aatatgttta tggtttttgg tccgaatggt ccactggcca atactcctcc tatcatcgaa 1320

tctcaggttg agtggatttc agtgtttatc cagtataccg ttgaaaacaa tgttgaatct 1380

atcgaagccg ataaagaagc ggaagaacag tggacccaga cctgcgccaa tattgccgaa 1440

aaaaccctgt ttcctaaagc caaatgtcgc atctttggtg ccaatattcc gggcaagaaa 1500

aacacggtgt atctgtacct cggcggtctg aaagaatatc gtagcgtttt agctaattgc 1560

aaaaatcatg cgtatgtggg ctttgatatt cagttacagc gctcagatac caaacagcag 1620

gctaatgcgt aa 1632

<210> 2

<211> 543

<212> PRT

<213>Artificial sequence

<400> 2

Met Ser Thr Lys Met Asp Phe Asp Ala Ile Val Ile Gly Ala Gly Phe

1 5 10 15

Gly Gly Leu Tyr Ala Val Lys Lys Leu Arg Asp Glu Leu Glu Leu Lys

20 25 30

Val Lys Ala Phe Asp Lys Ala Thr Asp Val Gly Gly Thr Trp Tyr Trp

35 40 45

Asn Arg Tyr Pro Gly Ala Leu Thr Asp Thr Glu Thr His Leu Tyr Cys

50 55 60

Tyr Ser Trp Asp Lys Glu Met Leu Gln Ser Leu Glu Ile Lys Lys Lys

65 70 75 80

Tyr Val Gln Gly Pro Asp Val Arg Lys Tyr Leu Gln Gln Val Ala Glu

85 90 95

Lys His Asp Leu Lys Lys Ser Tyr Gln Phe Asn Thr Ala Val Thr Ser

100 105 110

Ala His Tyr Asn Glu Ala Asp Ala Leu Trp Glu Val Thr Thr Glu Tyr

115 120 125

Gly Asp Lys Tyr Thr Ala Arg Phe Leu Ile Thr Ala Val Gly Leu Leu

130 135 140

Ser Ala Pro Asn Trp Pro Asn Ile Lys Gly Ile Asn Gln Phe Lys Gly

145 150 155 160

Glu Leu His His Thr Ser Arg Trp Pro Asp Asp Val Ser Ile Glu Gly

165 170 175

Lys Arg Val Gly Val Ile Gly Thr Gly Ser Thr Gly Val Gln Val Ile

180 185 190

Thr Ala Val Ala Pro Leu Ala Lys His Leu Thr Val Phe Gln Arg Ser

195 200 205

Pro Gln Tyr Ser Val Pro Ile Gly Asn Asp Pro Leu Ser Glu Glu Asp

210 215 220

Val Lys Lys Ile Lys Asp Asn Tyr Asp Lys Ile Trp Asp Gly Val Lys

225 230 235 240

Asn Ser Ala Leu Ala Tyr Gly Val Asn Glu Ser Thr Val Pro Ala Met

245 250 255

Ser Val Ser Ala Glu Glu Arg Lys Ala Val Phe Glu Lys Ala Trp Gln

260 265 270

Thr Gly Gly Gly Met Arg Phe Met Phe Glu Thr Phe Gly Asp Ile Ile

275 280 285

Thr Asn Met Glu Ala Asn Ile Glu Ala Gln Asn Phe Ile Lys Gly Lys

290 295 300

Ile Ala Arg Ile Val Lys Asp Pro Ala Ile Ala Gln Lys Leu Met Pro

305 310 315 320

Gln Asp Leu Tyr Ala Cys Arg Pro Leu Cys Asp Ser Gly Tyr Tyr Asn

325 330 335

Thr Phe Asn Arg Glu Asn Val Arg Leu Glu Asp Val Lys Ala Asn Pro

340 345 350

Ile Val Glu Ile Thr Glu Asn Gly Val Lys Leu Glu Asn Gly Asp Phe

355 360 365

Val Glu Leu Asp Met Leu Ile Cys Ala Thr Gly Phe Asp Ala Gly Asp

370 375 380

Gly Ser Tyr Lys Arg Ile Asp Ile Gln Gly Lys Asn Gly Leu Ala Ile

385 390 395 400

Lys Asp Tyr Trp Lys Glu Gly Pro Ser Ser Tyr Met Gly Val Ala Val

405 410 415

Asn Asn Tyr Pro Asn Met Phe Met Val Phe Gly Pro Asn Gly Pro Leu

420 425 430

Ala Asn Thr Pro Pro Ile Ile Glu Ser Gln Val Glu Trp Ile Ser Val

435 440 445

Phe Ile Gln Tyr Thr Val Glu Asn Asn Val Glu Ser Ile Glu Ala Asp

450 455 460

Lys Glu Ala Glu Glu Gln Trp Thr Gln Thr Cys Ala Asn Ile Ala Glu

465 470 475 480

Lys Thr Leu Phe Pro Lys Ala Lys Cys Arg Ile Phe Gly Ala Asn Ile

485 490 495

Pro Gly Lys Lys Asn Thr Val Tyr Leu Tyr Leu Gly Gly Leu Lys Glu

500 505 510

Tyr Arg Ser Val Leu Ala Asn Cys Lys Asn His Ala Tyr Val Gly Phe

515 520 525

Asp Ile Gln Leu Gln Arg Ser Asp Thr Lys Gln Gln Ala Asn Ala

530 535 540

<210> 3

<211> 1632

<212> DNA

<213>Artificial sequence

<400> 3

atgagtacca agatggattt tgatgcaatt gtgatcggtg ccggctttgg cggcctgtat 60

gccgttaaaa aactgcgcga tgaactggaa ctgaaagtta aagcctttga taaagcaacg 120

gatgtgggcg ggacctggta ttggaatcgc tatccgggcg cactgacgga tacggaaacc 180

catctgtatt gctattcttg ggataaagaa atgctacaga gtttagaaat caaaaagaaa 240

tatgtgcagg gcccagatgt tcgcaaatac ttacagcagg ttgcagaaaa acatgatctg 300

aaaaaatctt atcagtttaa taccgccgtg acgagtgctc attataacga ggcggatgcc 360

ctgtgggaag tgacaaccga atatggcgat aaatataccg cacgctttct gattaccgcc 420

gtgggtctgc tgtctgcacc taattggcct aatatcaaag gcatcaatca gtttaaaggt 480

gaactgcatc atacgtcacg ctggccggat gatgtgagca tcgaaggcaa gagagtgggt 540

gtgatcggta cgggtagtac gggcgttcag gttattacag cagttgctcc attagccaaa 600

catctgaccg tgtttcagcg tagtccacag tatagtgttc cgatcggcaa tgatccactg 660

agcgaagaag atgttaagaa gattaaagat aattatgata aaatctggga tggtgtgaaa 720

aatagcgcct tagcctatgg tgtgaatgag tctacagttc cagccatgag cgtgagtgca 780

gaagaacgta aagccgtgtt tgaaaaggca tggcagacgg gtggcgggat gcgctttatg 840

tttgaaacct ttggggacat aattaccaat atggaagcta atatcgaagc acagaatttt 900

atcaaaggca aaattgcccg catcgttaaa gatcctgcca ttgcacagaa actgatgcct 960

caggatctgt atgcttgtcg cccgctgtgc gattcaggct attataatac ctttaatcgc 1020

gaaaatgttc gtctggaaga tgttaaagct aatccgatcg tggaaatcac cgaaaatggc 1080

gttaaactgg aaaatggcga ttttgtggaa ttagatatgc tgatttgcgc gaccggcttt 1140

gatgcgggcg atggcaacta caagcgcatc gacatacagg ggaaaaatgg cttagccatc 1200

aaagattatt ggaaagaagg tcctagtagc tatatgggcg ttgcggttaa caactatccg 1260

aatatgttta tggtttttgg tccgaatggt ccactggcca attctcctcc tatcatcgaa 1320

tctcaggttg agtggatttc agtgtttatc cagtataccg ttgaaaacaa tgttgaatct 1380

atcgaagccg ataaagaagc ggaagaacag tggacccaga cctgcgccaa tattgccgaa 1440

aaaaccctgt ttcctaaagc caaatgtcgc atctttggtg ccaatattcc gggcaagaaa 1500

aacacggtgt atctgtacct cggcggtctg aaagaatatc gtagcgtttt agctaattgc 1560

aaaaatcatg cgtatgtggg ctttgatatt cagttacagc gctcagatac caaacagcag 1620

gctaatgcgt aa 1632

<210> 4

<211> 543

<212> PRT

<213>Artificial sequence

<400> 4

Met Ser Thr Lys Met Asp Phe Asp Ala Ile Val Ile Gly Ala Gly Phe

1 5 10 15

Gly Gly Leu Tyr Ala Val Lys Lys Leu Arg Asp Glu Leu Glu Leu Lys

20 25 30

Val Lys Ala Phe Asp Lys Ala Thr Asp Val Gly Gly Thr Trp Tyr Trp

35 40 45

Asn Arg Tyr Pro Gly Ala Leu Thr Asp Thr Glu Thr His Leu Tyr Cys

50 55 60

Tyr Ser Trp Asp Lys Glu Met Leu Gln Ser Leu Glu Ile Lys Lys Lys

65 70 75 80

Tyr Val Gln Gly Pro Asp Val Arg Lys Tyr Leu Gln Gln Val Ala Glu

85 90 95

Lys His Asp Leu Lys Lys Ser Tyr Gln Phe Asn Thr Ala Val Thr Ser

100 105 110

Ala His Tyr Asn Glu Ala Asp Ala Leu Trp Glu Val Thr Thr Glu Tyr

115 120 125

Gly Asp Lys Tyr Thr Ala Arg Phe Leu Ile Thr Ala Val Gly Leu Leu

130 135 140

Ser Ala Pro Asn Trp Pro Asn Ile Lys Gly Ile Asn Gln Phe Lys Gly

145 150 155 160

Glu Leu His His Thr Ser Arg Trp Pro Asp Asp Val Ser Ile Glu Gly

165 170 175

Lys Arg Val Gly Val Ile Gly Thr Gly Ser Thr Gly Val Gln Val Ile

180 185 190

Thr Ala Val Ala Pro Leu Ala Lys His Leu Thr Val Phe Gln Arg Ser

195 200 205

Pro Gln Tyr Ser Val Pro Ile Gly Asn Asp Pro Leu Ser Glu Glu Asp

210 215 220

Val Lys Lys Ile Lys Asp Asn Tyr Asp Lys Ile Trp Asp Gly Val Lys

225 230 235 240

Asn Ser Ala Leu Ala Tyr Gly Val Asn Glu Ser Thr Val Pro Ala Met

245 250 255

Ser Val Ser Ala Glu Glu Arg Lys Ala Val Phe Glu Lys Ala Trp Gln

260 265 270

Thr Gly Gly Gly Met Arg Phe Met Phe Glu Thr Phe Gly Asp Ile Ile

275 280 285

Thr Asn Met Glu Ala Asn Ile Glu Ala Gln Asn Phe Ile Lys Gly Lys

290 295 300

Ile Ala Arg Ile Val Lys Asp Pro Ala Ile Ala Gln Lys Leu Met Pro

305 310 315 320

Gln Asp Leu Tyr Ala Cys Arg Pro Leu Cys Asp Ser Gly Tyr Tyr Asn

325 330 335

Thr Phe Asn Arg Glu Asn Val Arg Leu Glu Asp Val Lys Ala Asn Pro

340 345 350

Ile Val Glu Ile Thr Glu Asn Gly Val Lys Leu Glu Asn Gly Asp Phe

355 360 365

Val Glu Leu Asp Met Leu Ile Cys Ala Thr Gly Phe Asp Ala Gly Asp

370 375 380

Gly Asn Tyr Lys Arg Ile Asp Ile Gln Gly Lys Asn Gly Leu Ala Ile

385 390 395 400

Lys Asp Tyr Trp Lys Glu Gly Pro Ser Ser Tyr Met Gly Val Ala Val

405 410 415

Asn Asn Tyr Pro Asn Met Phe Met Val Phe Gly Pro Asn Gly Pro Leu

420 425 430

Ala Asn Ser Pro Pro Ile Ile Glu Ser Gln Val Glu Trp Ile Ser Val

435 440 445

Phe Ile Gln Tyr Thr Val Glu Asn Asn Val Glu Ser Ile Glu Ala Asp

450 455 460

Lys Glu Ala Glu Glu Gln Trp Thr Gln Thr Cys Ala Asn Ile Ala Glu

465 470 475 480

Lys Thr Leu Phe Pro Lys Ala Lys Cys Arg Ile Phe Gly Ala Asn Ile

485 490 495

Pro Gly Lys Lys Asn Thr Val Tyr Leu Tyr Leu Gly Gly Leu Lys Glu

500 505 510

Tyr Arg Ser Val Leu Ala Asn Cys Lys Asn His Ala Tyr Val Gly Phe

515 520 525

Asp Ile Gln Leu Gln Arg Ser Asp Thr Lys Gln Gln Ala Asn Ala

530 535 540

<210> 5

<211> 1632

<212> DNA

<213>Artificial sequence

<400> 5

atgagtacca agatggattt tgatgcaatt gtgatcggtg ccggctttgg cggcctgtat 60

gccgttaaaa aactgcgcga tgaactggaa ctgaaagtta aagcctttga taaagcaacg 120

gatgtgggcg ggacctggta ttggaatcgc tatccgggcg cactgacgga tacggaaacc 180

catctgtatt gctattcttg ggataaagaa atgctacaga gtttagaaat caaaaagaaa 240

tatgtgcagg gcccagatgt tcgcaaatac ttacagcagg ttgcagaaaa acatgatctg 300

aaaaaatctt atcagtttaa taccgccgtg acgagtgctc attataacga ggcggatgcc 360

ctgtgggaag tgacaaccga atatggcgat aaatataccg cacgctttct gattaccgcc 420

gtgggtctgc tgtctgcacc taattggcct aatatcaaag gcatcaatca gtttaaaggt 480

gaactgcatc atacgtcacg ctggccggat gatgtgagca tcgaaggcaa gagagtgggt 540

gtgatcggta cgggtagtac gggcgttcag gttattacag cagttgctcc attagccaaa 600

catctgaccg tgtttcagcg tagtccacag tatagtgttc cgatcggcaa tgatccactg 660

agcgaagaag atgttaagaa gattaaagat aattatgata aaatctggga tggtgtgaaa 720

aatagcgcct tagcctatgg tgtgaatgag tctacagttc cagccatgag cgtgagtgca 780

gaagaacgta aagccgtgtt tgaaaaggca tggcagacgg gtggcgggat gcgctttatg 840

tttgaaacct ttggggacat aattaccaat atggaagcta atatcgaagc acagaatttt 900

atcaaaggca aaattgcccg catcgttaaa gatcctgcca ttgcacagaa actgatgcct 960

caggatctgt atgcttgtcg cccgctgtgc gattcaggct attataatac ctttaatcgc 1020

gaaaatgttc gtctggaaga tgttaaagct aatccgatcg tggaaatcac cgaaaatggc 1080

gttaaactgg aaaatggcga ttttgtggaa ttagatatgc tgatttgcgc gaccggcttt 1140

gatgcgggcg atggcaacta caagcgcatc gacatacagg ggaaaaatgg cttagccatc 1200

aaagattatt ggaaagaagg tcctagtagc tatatgggcg ttgcggttaa caactatccg 1260

aatatgttta tggtttttgg tccgaatggt ccactggcca atactcctcc tatcatcgaa 1320

tctcaggttg agtggatttc agtgtttatc cagtataccg ttgaaaacaa tgttgaatct 1380

atcgaagccg ataaagaagc ggaagaacag tggacccaga cctgcgccaa tattgccgaa 1440

aaaaccctgt ttcctaaagc caaatgtcgc atctttggtg ccaatattcc gggcaagaaa 1500

aacacggtgt atctgtacct cggcggtctg aaagaatatc gtagcgtttt agctaattgc 1560

aaaaatcatg cgtatgtggg ctttgatatt cagttacagc gctcagatac caaacagcag 1620

gctaatgcgt aa 1632

<210> 6

<211> 543

<212> PRT

<213>Artificial sequence

<400> 6

Met Ser Thr Lys Met Asp Phe Asp Ala Ile Val Ile Gly Ala Gly Phe

1 5 10 15

Gly Gly Leu Tyr Ala Val Lys Lys Leu Arg Asp Glu Leu Glu Leu Lys

20 25 30

Val Lys Ala Phe Asp Lys Ala Thr Asp Val Gly Gly Thr Trp Tyr Trp

35 40 45

Asn Arg Tyr Pro Gly Ala Leu Thr Asp Thr Glu Thr His Leu Tyr Cys

50 55 60

Tyr Ser Trp Asp Lys Glu Met Leu Gln Ser Leu Glu Ile Lys Lys Lys

65 70 75 80

Tyr Val Gln Gly Pro Asp Val Arg Lys Tyr Leu Gln Gln Val Ala Glu

85 90 95

Lys His Asp Leu Lys Lys Ser Tyr Gln Phe Asn Thr Ala Val Thr Ser

100 105 110

Ala His Tyr Asn Glu Ala Asp Ala Leu Trp Glu Val Thr Thr Glu Tyr

115 120 125

Gly Asp Lys Tyr Thr Ala Arg Phe Leu Ile Thr Ala Val Gly Leu Leu

130 135 140

Ser Ala Pro Asn Trp Pro Asn Ile Lys Gly Ile Asn Gln Phe Lys Gly

145 150 155 160

Glu Leu His His Thr Ser Arg Trp Pro Asp Asp Val Ser Ile Glu Gly

165 170 175

Lys Arg Val Gly Val Ile Gly Thr Gly Ser Thr Gly Val Gln Val Ile

180 185 190

Thr Ala Val Ala Pro Leu Ala Lys His Leu Thr Val Phe Gln Arg Ser

195 200 205

Pro Gln Tyr Ser Val Pro Ile Gly Asn Asp Pro Leu Ser Glu Glu Asp

210 215 220

Val Lys Lys Ile Lys Asp Asn Tyr Asp Lys Ile Trp Asp Gly Val Lys

225 230 235 240

Asn Ser Ala Leu Ala Tyr Gly Val Asn Glu Ser Thr Val Pro Ala Met

245 250 255

Ser Val Ser Ala Glu Glu Arg Lys Ala Val Phe Glu Lys Ala Trp Gln

260 265 270

Thr Gly Gly Gly Met Arg Phe Met Phe Glu Thr Phe Gly Asp Ile Ile

275 280 285

Thr Asn Met Glu Ala Asn Ile Glu Ala Gln Asn Phe Ile Lys Gly Lys

290 295 300

Ile Ala Arg Ile Val Lys Asp Pro Ala Ile Ala Gln Lys Leu Met Pro

305 310 315 320

Gln Asp Leu Tyr Ala Cys Arg Pro Leu Cys Asp Ser Gly Tyr Tyr Asn

325 330 335

Thr Phe Asn Arg Glu Asn Val Arg Leu Glu Asp Val Lys Ala Asn Pro

340 345 350

Ile Val Glu Ile Thr Glu Asn Gly Val Lys Leu Glu Asn Gly Asp Phe

355 360 365

Val Glu Leu Asp Met Leu Ile Cys Ala Thr Gly Phe Asp Ala Gly Asp

370 375 380

Gly Asn Tyr Lys Arg Ile Asp Ile Gln Gly Lys Asn Gly Leu Ala Ile

385 390 395 400

Lys Asp Tyr Trp Lys Glu Gly Pro Ser Ser Tyr Met Gly Val Ala Val

405 410 415

Asn Asn Tyr Pro Asn Met Phe Met Val Phe Gly Pro Asn Gly Pro Leu

420 425 430

Ala Asn Thr Pro Pro Ile Ile Glu Ser Gln Val Glu Trp Ile Ser Val

435 440 445

Phe Ile Gln Tyr Thr Val Glu Asn Asn Val Glu Ser Ile Glu Ala Asp

450 455 460

Lys Glu Ala Glu Glu Gln Trp Thr Gln Thr Cys Ala Asn Ile Ala Glu

465 470 475 480

Lys Thr Leu Phe Pro Lys Ala Lys Cys Arg Ile Phe Gly Ala Asn Ile

485 490 495

Pro Gly Lys Lys Asn Thr Val Tyr Leu Tyr Leu Gly Gly Leu Lys Glu

500 505 510

Tyr Arg Ser Val Leu Ala Asn Cys Lys Asn His Ala Tyr Val Gly Phe

515 520 525

Asp Ile Gln Leu Gln Arg Ser Asp Thr Lys Gln Gln Ala Asn Ala

530 535 540

<210> 7

<211> 759

<212> DNA

<213>Artificial sequence

<400> 7

atgacggatc gtctgaaagg caaagttgcc atcgtgaccg gtggcacgct gggcatcggc 60

ctggccattg ccgataaatt tgtggaagaa ggcgccaaag tggttattac aggtcgtcat 120

gcagatgtgg gcgaaaaagc cgccaaatct atcggcggca ccgatgttat tcgctttgtg 180

cagcatgatg cgtcagatga agcgggttgg acgaaactgt ttgatacaac ggaagaagcc 240

tttggtccag tgacaacggt tgtgaataac gccggtatct ttgtgtacaa gtcagtggaa 300

gatacgacga cagaagaatg gcgcaaactg ctgagtgtta acctggatgg cgtgtttttc 360

ggtacacgtt taggtatcca gcgcatgaaa aataagggct taggtgcgag tatcatcaat 420

atgtcctcaa tcgaaggctt agtgggcgat cctacgggtg gtgcttataa tgcctctaaa 480

ggtgcagttc gcattatgtc taaatcagct gcactggatt gcgctctgaa agattatgat 540

gttcgcgtta ataccgttca tccgggctat atcaaaacac cattagttga tgatctggaa 600

ggtgccgaag aaatgatgtc tcagcgtacc aaaaccccta tgggtcatat cggtgaacct 660

aatgatattg cttggatctg cgtgtatctg gcgtcagatg aatctaaatt tgcaacaggc 720

gcggaatttg tggttgatgg cggctatacc gcccagtaa 759

<210> 8

<211> 252

<212> PRT

<213>Artificial sequence

<400> 8

Met Thr Asp Arg Leu Lys Gly Lys Val Ala Ile Val Thr Gly Gly Thr

1 5 10 15

Leu Gly Ile Gly Leu Ala Ile Ala Asp Lys Phe Val Glu Glu Gly Ala

20 25 30

Lys Val Val Ile Thr Gly Arg His Ala Asp Val Gly Glu Lys Ala Ala

35 40 45

Lys Ser Ile Gly Gly Thr Asp Val Ile Arg Phe Val Gln His Asp Ala

50 55 60

Ser Asp Glu Ala Gly Trp Thr Lys Leu Phe Asp Thr Thr Glu Glu Ala

65 70 75 80

Phe Gly Pro Val Thr Thr Val Val Asn Asn Ala Gly Ile Phe Val Tyr

85 90 95

Lys Ser Val Glu Asp Thr Thr Thr Glu Glu Trp Arg Lys Leu Leu Ser

100 105 110

Val Asn Leu Asp Gly Val Phe Phe Gly Thr Arg Leu Gly Ile Gln Arg

115 120 125

Met Lys Asn Lys Gly Leu Gly Ala Ser Ile Ile Asn Met Ser Ser Ile

130 135 140

Glu Gly Leu Val Gly Asp Pro Thr Gly Gly Ala Tyr Asn Ala Ser Lys

145 150 155 160

Gly Ala Val Arg Ile Met Ser Lys Ser Ala Ala Leu Asp Cys Ala Leu

165 170 175

Lys Asp Tyr Asp Val Arg Val Asn Thr Val His Pro Gly Tyr Ile Lys

180 185 190

Thr Pro Leu Val Asp Asp Leu Glu Gly Ala Glu Glu Met Met Ser Gln

195 200 205

Arg Thr Lys Thr Pro Met Gly His Ile Gly Glu Pro Asn Asp Ile Ala

210 215 220

Trp Ile Cys Val Tyr Leu Ala Ser Asp Glu Ser Lys Phe Ala Thr Gly

225 230 235 240

Ala Glu Phe Val Val Asp Gly Gly Tyr Thr Ala Gln

245 250

<210> 9

<211> 858

<212> DNA

<213>Artificial sequence

<400> 9

atggcttccg tttccattcc tcttcgagcg ctgtcaagcg gttataacat ccctgccatt 60

ggtcttggcg tgtaccagag tgcagacgcc gaaaccattg tctacgaggc cctcaaaaag 120

ggttacagac tggtggacac tgcccaggag tatggcaatg aagctgccac ttgtcggggt 180

atttccaagt tcctgaagga gactggaact aaccgacgag aggtctttta caccaccaag 240

ctggacgacg ccactggagg atatgagggc accatgcagc tggctgaggc tcgcctagct 300

gaggctcgaa agggcggtat tgattacatt gatctgcttc tgatccatgc tcctttctcc 360

aagtctccct acaccgagac ccgactggct gcttggaagg ctcttaccga gctggttgac 420

ggaggagcca ttcgaagcat tggagtgtcc aactacggag ttaagcatct gaaggagttc 480

tgggacgctg atgtcaagta caagcctgtt ctgaaccagg ttgagtcttc tccctggaac 540

gtgcgacaag atatccacga cttttgcaag tctcacaatg tcattgtcga acaatactct 600

cctctgtgtc gaggcaatcg atttaaggag cccggtgttc tcaagctggc tgacaagtac 660

aagaagactc ctgcccagat tctcattcga tggagtctgg ataagggaat gcttcccatt 720

cccaagaccg acaacgtgga ccgtctgagt cctaacctcg acgtctttga tttcaatctg 780

actccccaag aggtcgagga ccttcaggat ctcaactcgt atacttgtta cgagtgggac 840

cccaccgtta ccaagtga 858

<210> 10

<211> 285

<212> PRT

<213>Artificial sequence

<400> 10

Met Ala Ser Val Ser Ile Pro Leu Arg Ala Leu Ser Ser Gly Tyr Asn

1 5 10 15

Ile Pro Ala Ile Gly Leu Gly Val Tyr Gln Ser Ala Asp Ala Glu Thr

20 25 30

Ile Val Tyr Glu Ala Leu Lys Lys Gly Tyr Arg Leu Val Asp Thr Ala

35 40 45

Gln Glu Tyr Gly Asn Glu Ala Ala Thr Cys Arg Gly Ile Ser Lys Phe

50 55 60

Leu Lys Glu Thr Gly Thr Asn Arg Arg Glu Val Phe Tyr Thr Thr Lys

65 70 75 80

Leu Asp Asp Ala Thr Gly Gly Tyr Glu Gly Thr Met Gln Leu Ala Glu

85 90 95

Ala Arg Leu Ala Glu Ala Arg Lys Gly Gly Ile Asp Tyr Ile Asp Leu

100 105 110

Leu Leu Ile His Ala Pro Phe Ser Lys Ser Pro Tyr Thr Glu Thr Arg

115 120 125

Leu Ala Ala Trp Lys Ala Leu Thr Glu Leu Val Asp Gly Gly Ala Ile

130 135 140

Arg Ser Ile Gly Val Ser Asn Tyr Gly Val Lys His Leu Lys Glu Phe

145 150 155 160

Trp Asp Ala Asp Val Lys Tyr Lys Pro Val Leu Asn Gln Val Glu Ser

165 170 175

Ser Pro Trp Asn Val Arg Gln Asp Ile His Asp Phe Cys Lys Ser His

180 185 190

Asn Val Ile Val Glu Gln Tyr Ser Pro Leu Cys Arg Gly Asn Arg Phe

195 200 205

Lys Glu Pro Gly Val Leu Lys Leu Ala Asp Lys Tyr Lys Lys Thr Pro

210 215 220

Ala Gln Ile Leu Ile Arg Trp Ser Leu Asp Lys Gly Met Leu Pro Ile

225 230 235 240

Pro Lys Thr Asp Asn Val Asp Arg Leu Ser Pro Asn Leu Asp Val Phe

245 250 255

Asp Phe Asn Leu Thr Pro Gln Glu Val Glu Asp Leu Gln Asp Leu Asn

260 265 270

Ser Tyr Thr Cys Tyr Glu Trp Asp Pro Thr Val Thr Lys

275 280 285

<210> 11

<211> 840

<212> DNA

<213>Artificial sequence

<400> 11

atgtcgtcac aggttccatc cgccgaggcc cagaccgtga tttcctttca tgacggtcac 60

accatgcccc agatcgggct gggcgtgtgg gaaacgccgc cggatgagac ggccgaggtc 120

gtgaaggaag ccgtgaagct cggttaccgg tctgtcgata cggcgcgtct gtacaagaac 180

gaggaaggtg tcggcaaagg tctggaagac catccggaaa tcttcctgac gaccaagctc 240

tggaatgacg agcagggcta tgacagcacc ctgcgggcgt atgaagaaag cgcgcgcctg 300

ctgcgtcgtc cggtgctgga cctgtatctg atccactggc cgatgccggc tcaggggcag 360

tatgtcgaga cgtggaaggc actcgtcgag ctgaagaaat ccggtcgtgt gaagtccatc 420

ggcgtgtcca atttcgagtc ggagcatctg gagcggatca tggatgccac gggtgtcgtg 480

ccggtcgtca accagatcga gctgcatccc gatttccagc agcgcgccct gcgggaattc 540

cacgagaagc acaacatccg caccgagtcc tggcgcccgc tgggcaaggg gcgcgtcctg 600

agcgatgagc ggatcgggaa gatcgctgaa aagcacagcc ggactccggc gcaggtcgtg 660

atccgctggc atcttcagaa tggactgatc gtcattccga aatcggtcaa tcccaagcgt 720

ctggctgaaa atctggatgt gttcggcttc gtgctggatg cggatgacat gcaggccatc 780

gaacagatgg accgcaagga tggccggatg ggcgctgatc cgaatacggc gaaattctga 840

<210> 12

<211> 279

<212> PRT

<213>Artificial sequence

<400> 12

Met Ser Ser Gln Val Pro Ser Ala Glu Ala Gln Thr Val Ile Ser Phe

1 5 10 15

His Asp Gly His Thr Met Pro Gln Ile Gly Leu Gly Val Trp Glu Thr

20 25 30

Pro Pro Asp Glu Thr Ala Glu Val Val Lys Glu Ala Val Lys Leu Gly

35 40 45

Tyr Arg Ser Val Asp Thr Ala Arg Leu Tyr Lys Asn Glu Glu Gly Val

50 55 60

Gly Lys Gly Leu Glu Asp His Pro Glu Ile Phe Leu Thr Thr Lys Leu

65 70 75 80

Trp Asn Asp Glu Gln Gly Tyr Asp Ser Thr Leu Arg Ala Tyr Glu Glu

85 90 95

Ser Ala Arg Leu Leu Arg Arg Pro Val Leu Asp Leu Tyr Leu Ile His

100 105 110

Trp Pro Met Pro Ala Gln Gly Gln Tyr Val Glu Thr Trp Lys Ala Leu

115 120 125

Val Glu Leu Lys Lys Ser Gly Arg Val Lys Ser Ile Gly Val Ser Asn

130 135 140

Phe Glu Ser Glu His Leu Glu Arg Ile Met Asp Ala Thr Gly Val Val

145 150 155 160

Pro Val Val Asn Gln Ile Glu Leu His Pro Asp Phe Gln Gln Arg Ala

165 170 175

Leu Arg Glu Phe His Glu Lys His Asn Ile Arg Thr Glu Ser Trp Arg

180 185 190

Pro Leu Gly Lys Gly Arg Val Leu Ser Asp Glu Arg Ile Gly Lys Ile

195 200 205

Ala Glu Lys His Ser Arg Thr Pro Ala Gln Val Val Ile Arg Trp His

210 215 220

Leu Gln Asn Gly Leu Ile Val Ile Pro Lys Ser Val Asn Pro Lys Arg

225 230 235 240

Leu Ala Glu Asn Leu Asp Val Phe Gly Phe Val Leu Asp Ala Asp Asp

245 250 255

Met Gln Ala Ile Glu Gln Met Asp Arg Lys Asp Gly Arg Met Gly Ala

260 265 270

Asp Pro Asn Thr Ala Lys Phe

275

<210> 13

<211> 36

<212> DNA

<213>Artificial sequence

<400> 13

ggaattccat atgagtacca agatggattt tgatgc 36

<210> 14

<211> 32

<212> DNA

<213>Artificial sequence

<400> 14

cgcggatcct tacgcattag cctgctgttt gg 32

<210> 15

<211> 30

<212> DNA

<213>Artificial sequence

<400> 15

ggaattccat atgacggatc gtctgaaagg 30

<210> 16

<211> 28

<212> DNA

<213>Artificial sequence

<400> 16

cgcggatcct tactgggcgg tatagccg 28

<210> 17

<211> 30

<212> DNA

<213>Artificial sequence

<400> 17

ggaattccat atggcttccg tttccattcc 30

<210> 18

<211> 30

<212> DNA

<213>Artificial sequence

<400> 18

cgcggatcct cacttggtaa cggtggggtc 30

<210> 19

<211> 30

<212> DNA

<213>Artificial sequence

<400> 19

ggaattccat atgtcgtcac aggttccatc 30

<210> 20

<211> 29

<212> DNA

<213>Artificial sequence

<400> 20

cgcggatcct cagaatttcg ccgtattcg 29

<210> 21

<211> 64

<212> DNA

<213>Artificial sequence

<400> 21

ggccatatga ataattttgt ttaactttaa gaaggagata taatgagtac caagatggat 60

tttg 64

<210> 22

<211> 32

<212> DNA

<213>Artificial sequence

<400> 22

cgcggatcct tacgcattag cctgctgttt gg 32

<210> 23

<211> 67

<212> DNA

<213>Artificial sequence

<400> 23

gcggatccaa cttaataatt ttgtttaact ttaagaagga gatataatga cggatcgtct 60

gaaaggc 67

<210> 24

<211> 30

<212> DNA

<213>Artificial sequence

<400> 24

ccgctcgagt tactgggcgg tatagccgcc 30

Claims (10)

1. A kind of 1. method of enzymatic clarification esomeprazole, which is characterized in that it includes the following steps：

   (1) by 2- sulfydryl -5- methoxybenzimidazols and 2- chloromethyls -3,5- dimethyl -4-methoxypyridine hydrochloride in alkali In the presence of reacted in solvent, material pH value is adjusted after reaction to 6-9；

   (2) material, monooxygenase, helper component and aqueous phase solvent are mixed, is reacted with oxidant, generation Esso is beautiful Draw azoles, you can.
2. 2. the method as described in claim 1, which is characterized in that in step (1), the solvent includes benzene, toluene, alcohol, ether, halogen For one or more in hydrocarbon, ester and dimethyl sulfoxide；The alcohol is better selected from methanol, ethyl alcohol, propyl alcohol, isopropanol and butanol, The halogenated hydrocarbons is better selected from dichloromethane, chloroform and carbon tetrachloride, and the ether is better selected from ether, methyl tertbutyl Ether, tetrahydrofuran and 2- methyltetrahydrofurans, the ester are better selected from ethyl acetate and isopropyl acetate.
3. 3. method as claimed in claim 2, which is characterized in that in step (1), the solvent further includes water；

   Alternatively, the solvent for toluene, isopropyl alcohol and water, toluene, isopropyl alcohol and water mass ratio be preferably (5-20)：(1- 3)：(1-2) is more preferably (5-7)：(1-3)：(1-2).
4. 4. such as claim 1-3 any one of them methods, which is characterized in that the mass ratio of the solvent and reaction raw materials exists 2.5:1 hereinafter, it is preferred that 1.1:Less than 1.
5. 5. the method as described in claim 1, which is characterized in that in step (1), the temperature of the reaction is 40-75 DEG C, preferably Ground is 48-72 DEG C；

   And/or in step (1), the time of the reaction is 1-3h, preferably 2-3h；

   And/or in step (1), the material pH value is 7.5-8.
6. 6. the method as described in claim 1, which is characterized in that in step (2), the monooxygenase is cyclohexanone list oxygenation Enzyme；The amino acid sequence of the cyclohexanone monooxygenase is preferably SEQ ID NO.2, SEQ ID NO.4 or SEQ ID NO.6；More preferably, the nucleotides sequence of the cyclohexanone monooxygenase is classified as SEQ ID NO.1, SEQ ID NO.3 or SEQ ID NO.5；

   And/or in step (2), the helper component includes at least reduced coenzyme；Alternatively, the helper component includes at least Oxidized coenzyme, dehydrogenase and dehydrogenase correspond to substrate；The mass ratio of the reduced coenzyme and total solvent is preferably 0.1- 1.5g/kg；And/or the mass ratio of the oxidized coenzyme and total solvent is preferably 0.08-0.12g/kg.
7. 7. method as claimed in claim 6, which is characterized in that the reduced coenzyme is NADPH and/or NADH；

   And/or the oxidized coenzyme is NADP⁺And/or NAD⁺；

   And/or the dehydrogenase is ketoreductase, preferably dehydrogenation of isopropanol enzyme.
8. 8. the method for claim 7, which is characterized in that the amino acid sequence of the ketoreductase for SEQ ID NO.8, SEQ ID NO.10 or SEQ ID NO.12；Preferably, the nucleotides sequence of the ketoreductase is classified as SEQ ID NO.7, SEQ ID NO.9 or SEQ ID NO.11；

   Alternatively, the ketoreductase is ES-KRED-104 or KRED-127.
9. 9. the method as described in claim 1, which is characterized in that in step (2), the aqueous phase solvent is phosphate buffer solution And/or Tris-HCl buffer solutions；

   And/or the pH value of the aqueous phase solvent is 7-10, preferably 8-9；

   And/or the mass ratio of solvent described in the aqueous phase solvent and step (1) is (1-5.6):1.
10. 10. the method as described in claim 1, which is characterized in that in step (2), add in phase transfer catalyst, the phase transfer Catalyst is benzyltriethylammoinium chloride, tetrabutylammonium bromide, tetrabutylammonium chloride, 4-butyl ammonium hydrogen sulfate, tricaprylmethyl Ammonium chloride, dodecyl trimethyl ammonium chloride, tetradecyl trimethyl ammonium chloride, methyltriphenylphosphonium bromide, ethyl triphenyl One or several kinds in bromide phosphine, tetraphenylphosphonibromide bromide and benzyl triphenyl phosphonium chloride phosphine；The phase transfer catalyst and total molten The mass ratio of agent is preferably (0.5-6) g/kg, is more preferably (0.9-6) g/kg；

    And/or in step (2), the oxidant is oxygen；

    And/or in step (2), the temperature of the reaction is 10-40 DEG C, and preferably 18-32 DEG C, be more preferably 23-32 DEG C.