CN117659149A - Application of rice OsNAC25 gene or protein encoded by rice OsNAC25 gene in improving drought tolerance of rice - Google Patents

Abstract

The invention belongs to the technical field of rice genetic engineering, and particularly relates to application of a rice OsNAC25 gene or a protein encoded by the gene in improving rice drought tolerance. The transgenic rice can enhance drought tolerance by over-expressing the OsNAC25 gene in the rice, so that the OsNAC25 gene or the encoded protein thereof can enhance the drought tolerance of the rice, and has potential for production.

Description

Application of rice OsNAC25 gene or protein encoded by rice OsNAC25 gene in improving drought tolerance of rice

Technical Field

The invention belongs to the technical field of rice genetic engineering, and particularly relates to application of a rice OsNAC25 gene or a protein encoded by the gene in improving rice drought tolerance.

Background

NAC transcription factor in regulating abiotic stress Ohnishi T et al transformed soybean NAC type transcription factor GmNAC20 into rice genome by Agrobacterium transformation, transgenic rice plants expressing GmNAC20 showed enhanced salinity and cold stress tolerance by upregulating abiotic stress response genes. In addition to playing a role in plant adaptation to abiotic stress, osNAC6 integrates signals from abiotic and biotic stresses. Arabidopsis NAC gene ATAF1 plays an important role in responding to salt stress, and can be used for improving the salt tolerance of rice. OsNAP is a member of the NAC transcription factor family, and functions as a transcriptional activator, and in mediating abiotic stress responses in rice. Abiotic stress response NAC transcription factor SlNAC11 is involved in drought and salt response in tomato, and compared to WT plants, slNAC11-RNAi plants are less tolerant to drought and salt stress. The expression of the potato StNAC053 gene is induced by salt stress and drought stress, and the over-expression material can enhance the tolerance of arabidopsis to salt stress and drought stress treatment by up-regulating the stress related genes. The StNAC1 gene heterologously expresses Nicotiana benthamiana to obtain the overexpression of StNAC1, the expression of the StNAC1 gene is obviously induced under the stress of salt, the germination rate and the green leaf rate of seeds are improved, the accumulation amount of ROS and the proline amount are reduced, the salt tolerance of transgenic plants is improved, and the StNAC1 gene plays a role in regulating the plants under the stress of salt. The NAC57 transcription factor responds to salt stress in time and space, and the overexpressing material of the NAC57 gene improves the salt tolerance of transgenic Arabidopsis by preventing ROS accumulation. Stress is an important factor affecting plant growth, and research on the action mechanism and molecular mechanism of stress can guide our crop production in the theoretical layer. At present, how to improve the drought resistance of rice is still the main work of research in the field of plant molecules, wherein the most effective method is to culture varieties with excellent properties through molecular genetic means. However, the detailed molecular mechanism of OsNAC25 transcription factor for improving rice drought tolerance is not clear, and reports about OsNAC25 for improving rice drought tolerance are not reported.

Disclosure of Invention

The invention provides application of a rice NAC family transcription factor OsNAC25. In particular to application of the rice OsNAC25 gene or the coded protein thereof in improving drought tolerance of rice. The nucleotide sequence of the rice OsNAC25 protein coding gene OsNAC25 is shown as SEQ ID NO. 1. OsNAC25 is expressed in the wild type middle flower 11, and the drought tolerance of the T3 generation plant of the transgenic plant is obviously enhanced compared with the corresponding index of the wild type plant, while the drought tolerance of the T3 generation plant of the OsNAC25 gene CRISPR editing plant is consistent with the corresponding index of the wild type plant. Therefore, the rice OsNAC25 protein coding gene OsNAC25 is a potential target point which can be used as a target point for improving rice drought tolerance in genetic engineering, and has important application value.

The specific technical scheme is as follows:

the invention provides application of a rice OsNAC25 gene or a protein coded by the gene in improving drought tolerance of rice.

The invention also provides application of the rice OsNAC25 gene or the coded protein thereof in improving drought tolerance of rice.

The nucleotide sequence of the CDs region of the OsNAC25 gene is shown as SEQ ID NO.2, and the amino acid sequence of the protein encoded by the OsNAC25 gene is shown as SEQ ID NO. 3.

The invention also provides a method for improving drought tolerance of rice, and the method is used for over-expressing or over-expressing the OsNAC25 gene in rice crops. The nucleotide sequence of the CDs region of the OsNAC25 gene is shown as SEQ ID NO. 2.

Specifically, the method comprises the following steps:

(1) Constructing an OsNAC25 over-expression or over-expression vector;

(2) Introducing the OsNAC25 over-expression or over-expression vector constructed in the step (1) into a rice cell, over-expressing or over-expressing the OsNAC25 with a CDs region nucleotide sequence shown as SEQ ID NO.1, and culturing to obtain a transgenic plant.

Preferably, the vector is pCAMBIA1300.

When the recipient plant is transformed, an agrobacterium-mediated transformation method can be adopted, and the agrobacterium genetic engineering bacteria can be an agrobacterium EHA105 strain. And (2) transferring the OsNAC25 over-expression or over-expression vector into agrobacterium genetic engineering bacteria to infect rice cells.

The recipient plant is rice. The variety of the rice may be japonica rice Nipponbare (Nipponbare) or medium flower 11 (ZH 11), but is not limited to Nipponbare or medium flower 11.

Preferably, the source of agrobacterium-infected cells is rice seed-induced callus. In addition to rice seed-induced callus, tissue sample-induced callus obtained from rice plants, or other means of growing plants after transgenesis, are also contemplated.

The invention has the beneficial effects that:

compared with wild plants, the transgenic rice has the advantage that the drought tolerance is enhanced by over-expressing or over-expressing the OsNAC25 gene; the OsNAC25 gene is knocked out from rice, and the rice drought tolerance is consistent with that of a wild type, so that the OsNAC25 gene can improve the rice drought tolerance and has the potential of production and application.

Drawings

FIG. 1OsNAC25 transgene and knockout mutant construction and identification. (A) is schematic diagram of knockout vector and over-expression vector; (B) quantitative qPCR results for the over-expressed strain; (C) knockout vector sequencing.

FIG. 2OsNAC25 transgenic material shows phenotype differences under drought stress, (A) is a plant phenotype photograph, and (B) is a plant survival statistical result. Wherein, p < 0.01, p < 0.05.

FIG. 3 shows the SOD level difference of OsNAC25 under drought stress, (A) lower SOD level, (B) upper SOD level. Wherein, p < 0.01, p < 0.05.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the technical solutions in the embodiments of the present invention will be clearly and completely described in the following in conjunction with the embodiments of the present invention, and it is apparent that the described embodiments are some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

Example 1

CRISPR/Cas9 knockout vector construction

According to the genomic sequence of OsNAC25 (Os 07g 0246901) provided by the RAP-DB (RAPDB-Rice Gene database) website (the nucleotide sequence of the OsNAC25 gene is shown as SEQ ID NO. 1: tgcaatgaaacaacaacaaaaagagctataacattacagtcacaatagagaacaatataatcaatagccattgttcaattaaaaatggttgcatacttgtcttggttcatcatgtacctcactccaacccaacaaactcacaaacatattgcccacaacgatcagtaccactaggttgcttgtggcatttcgtaaagtaatgcatgtaattcattatcatacttgttcctctgatcataaatattgaagaagaatagttagaaatgttgtcatatacttgtccgttatttcatttgggtgcaaggcacaacacatgatatttggtttggtgtatttggacccagcttgctcaatccatagaggggggctagttaggacatatttcatgcacaagaatggaaaataaattaaaatggactgaaagccccctcccaattggaaaaaatgtatcagtctgtataaaggctggctttttaaaaatgtgcaatgtttggagcagtcatcaacgcctatcaatttctctctctcctagatccattccccttccctcattcatcatctcttccatcacattgaaatgttgcgcacttaggccaaggccttttaaatccccaagtaagatcatgactcaactaggcctgttagaccagtctctttcatcaacactgtaccactcctttagactagctcatttacctgctatcattactttagattatgctctaccttgtttgaaatagacagctctttactaggccttgttgcggaactatttgctcatttttacgtaatgaatgccgtagcttcaaaaattcaatgatttgttgatgcatgctcactctttttatgtgggtagacctagtatgcacaatagtatttggtgtatgctacttccctatcatcattaaaaaaggttatcctatacttgttatgattggaatgcttaaatttatatatgttggtcccaacctatcttagtaaggcaggccgtatgtgaaaaattcttttcacaggctagcctactttacatagctgcctgagtaaatggtttattacatgcggttggaccggccgcgtgtgcaaatatccattttatagacgctcacaggcggtcttgttggccaacatgtgaaaaccaccttttgctgcctatggaaatggaatatgtagtagtgactaagctctacaattcatgagcccaatattcaaatgcatagaagcccaacaatcaattgccacaaactgtcttcatcaaaatttatagcgtcacagctcttgcatccatgtaggacaacctgtcatctttttagaaccccttgttgccgtagtccaccaatataatgctgaacttcatgccctacctctaagacaacaatatgagaagattgcacataccagctatatcttcaaaataacattttacatattacaccgttatttttcacctcatgataagcatgagagagggaatatgtggacatgatctaagtcattaataacgacccaccattaaagtttgagaatgcaaatctcagtttaatttgaaatgaaaattcagccatgagtggcatgtattaatagtattgaattttttgtatcactttcctcaatttgacgttggtgtccactaattttaggagtacacacatgtttgtgttcaatgggttcaattaactctcatcattcattcttgtaaaattgaatgtctagaaaatctaacattcaatggattatccgtaaagttgtgtcaggatcctgatacatgggtgtctgataatccctccattgtgctccagcagatgccatgctcatatggtaagtcttaattttctagtttaagtacctaaccattaatttccatattctaaatgttcatatagttgtgtcaaattactaacatttgtaatgatggcctaacttaatctgtcatatttttagtggatttccaaaggtgttctaggaagtcgtgtcaaattactgacattgcaacaatgatggatcaacttaattagattatattatatttttttatggattctaaaaggtgttctctagcaagtatagccacatgccatatttaaaaataaaatactactttcgtttatatttttaaaacttaattatctgtcttatttaaagtttatttccccagattatttaatctgcagtgcttttctcatacagtttgaaattaattaaggtacttatggctaaaatccgaaactctgcgcacaatcaatcatgtgataattccttgtttgtaaagtttgtgcatatagatgcatgttgtgttcataaaaactatatatagacttacttcataaatctatctacgatgaattttaaggagatcatgtctacagttaaattgacaatgttatatataggacggcgctatgtagcgctagaagctacatagcgtgactcaggataattcccacgaccggttttccctcgttcccccttcattcctggccccatggctcgtctcagtaaaaaaaatattcccacaattgttttttcagttccaatagtggaccgtgtttttatccagacactcgtggtgtgactcctcccttacagagatgtgagattgacgagtgggcttaacctttagaatgttaattaagaagttaatgaaataaattaaaagtgagagatatacttaacacgttaacagggcccatccattacagaaacctaattaaaatctttaacgaatatttttctctccatttcatgaaagcagttggcccatgggaaaacttgtctttaataaacattatatctccatttctttcttatataataaatatgccacaagtgaccagcaaccaattatcaattttttgcagcacactccagcagaaatgcattcttgcagtaccctccaacaaggagcacaaacattaggtgtcttatagcaaaatttgcctttagatgtaatgtgggaatttctagtttttctgattaatgagagaatttatatcttgtttatgttttagattaatatgtatggattctagtagacctttccatctgtatatataaagatgcagcccaagttttacagttctgtcaaaaagatctatactactggaccattttttatggtgtgatctctatagtacctaaccttaaccaaatgaatgcttactatagggtgaaaagattagattggtacacaatatgtataatatgtctgtagccttttttacccaatacaaattttcaacaataactatatatgacaattagtgcaaggtaagaataataacaaaataaaatattactaatgaaaatggtaagaataaaaaaagagactaggacaaactgttgcaaattttctatcaatattacgaaatattattatcttaatacccaaaaaacattaaatagataaactttaatttagggacaacaatgcaaaaattagaaggaaaattcctttttttttcatgtctacccctccatgttaggattcttcacaacacaaaccttgtggtcccaccccaattaaactcatattctccaacacaagccccctatctttttactaggaaacaaaccccaaaaagctatctaacaatccaaataaggacacaaataaacatgcttgcaagcaacattcacacacctttaatttcagcctcaataagcatccacagttttcctagtcagcatggttgttcacatctggtcatagttatctctagcccccataaaagaccaaataggaagtgaggtagagtgaaattaaccggttgtatgagcttccaagaatggaaaagcacagaactgaacaaaacatggcattgggattctcatcccatcaacacaaacctcaatgctatctcaccagccatatcttggagatagagggagtgtgtgagggccagaaacttgcaaagggagaaagtgaggttgaatctccgtcacgtcactcacagttgcccatccatctgataaaggggtgtcccctgggctctataaatattgtccctctttgcctccatcaacatcactgcagtgcctttgagctttcgttctctagagtgtctagggtgaatcttgagcgagtgagcgagcgatctctgtgttgtgtagtttgtgagctagggtgatggctaacaccggacttagcatccccatggtgaatggtgccacaatccacctcctccctggtttccggttccgtccaactgacgatgagctagtcatcaaatacctctacccccgtgcttttcatgtgccactgccctgtgcgatcatcaccgatgttgacatccatcatcacaacccctgggacatcgtcccaggttaattttgatatgcacttctttgcttctatgaaaattattaccacatccgtctgcatatatctctgatttgactgattaattgcatgtgtgtcctgacgatatttattctcttgttttgtttatcatttttttcgtttgttcgttggcaacgatctgatgatgaagtggcggagagggagaaagggaagcacttcttcacaagaaaggaggtcaagtaccctggtagccgccgtagcaaccgtgttgctggtaatggcttctggagagcagcaggctcggaggtgcccatctattacaaaccagaaggtgctgctaacgacatgctagttgggatgaggcggactctagtgttccactacggaaagtcacgatctgcagagcgcactgaatgggccatgcatgagtttcagcttgctggtgctggtctccttcctcaccctatgatgaggcatgcaaccagcaatggttcagagccaccctgtggctgccttgaagcgacaatcgctaaggtgagatgctacgtccaaaaattttactgttccatttatcatgattccatctaaatgcctgttgaattaaattgctcaattatttggataggttggattatgagttttagctttagggaatggggaaaatatgatgacttagtatacgtgatgatatactataactcttgtgttgatttattaaataagggaagggtagttgttttcgatcttaggactaagggtacgtgacgcttgatatagggttcatttattgttgccatgcaagatgcgcgggatctagaagtgattcaaattttgtcgtgacaaggaatctagaggtggtgggcctgctgatttgaatttgtcatagcctcacatggttttccttatgtattactaggatgtaatgatgattaattgattttgccgtgaagcgagatctagcggttacaagatctactagtgattcaaatatattgagaaaaaaaggggtttgctgtctacttgcattttcagtagggaacctctttattgaacaccacgtgtcatgatacacttgatactgggatatttggatttgtacatctggttttaatttgatcattgccacaagatttatataagtgacatgtcaacagtttacttctcaaattagttgcaacattcaaactggacatgaagttatcacacatctttctaattcagtccccatatgatttgtcacagtaagaggcttataaactagtttactataatggtcaattcatctattctctttgttgtatatgttgtatataccatggttgcaccttaagtagatccactaacagacaaaatggtgtctattttacagaaaagtgatggtctctctgcaactcttcgtgccaagcgtgattctgcccctcttatgagaatcatggtagaacccgatagctcatgggtgatctgctgcatctacaagaagaggcagcgtgccccgcctgttgttatccctcctgtcattggcgatgtaggggaagctatcatccctcatgctattggcgatgcaagggaaggccaacttcacttcattgacttcctggggcagccagctcgcaatgatccatcctcgccccatagctgcaccattgacccctcctctttggaggaagggagtgatgagtctgccggtgatggtgaagataaggatggtgatggcatgaatgaagcaaattgatcgagtgtgaaggaagtgaactgagtctcaagaataaaaactgcaagtatggcgctccattccatggaagacctgcatgcatcctatatatgtgcttttatgttcaagttggagaactatgtgtgttgtctttaagttggagtactctaagctattcgatctggagattatgctgtttttaataaaagtttgaagtgtatctgtcctgtttaattagtttcaagaaagccaagcgtgtttgggttctaggatgaacaaagtcgtccaagatgcaagaagttctagagaggtagctacatttctggaaattgttgcatcttcctttcttcaatatatatatattgtcctatttcataatgtcattctagccagctatctatattctatatatccatttccgttgccatactttattcactatgttgcatcgagtgagctgcattgctctgtactacatgttacttgatatgtgttgttcataaacacacacattaataatgatcagattgtgaaaaatcaattctacggtccttgaggaggtaccatgagataccaaaaatttagtgtaaaatttggtatctcatggtacctcatagtatctatgtaccaagaggtaccaaatttacaatagaaaaagtggtacctcatggtacctccttaaggaccgtaaaattgctcattgtgaaatgcatgtccagaattcacttaccaagtgttcggaaacaaattcacttaccacgtatctgggcttgaggtgatagttggacatgggaggtaacagagttgtcatccatatcatgtatttatttatagtgaagcaagcattgattcatgctgtgcaaattagtcgcagtgagagcattttctatatattttgtggcctatgtgaattaggagtaatatatattaagttggaacacctatgtgttataccgaatttgaatgatatatcaatatagatgaacgaataataataaaaattaatgacaagtgtgaattttgtggcatagcttcagcgttaagtccctaaatttagaggtaagttagtgtactagtaccgtcacttcttaaggtgctccaagtttttctctgaccgtacattagactaaggtccaactgtggacacagtctcttacattccaaaagtaataaggacagggataatattcattattaggaacacaattaataaggtaagtggagtaatttataaaatgatattaaatatttatgctgtactaatttacaaatacaccatggtaattatatgtttaccctgaatgcaaatttttaatggcatttcaatcacgatcaaatggaaaatgcaaaatttcaaatctgatatgagaatacaaaaatatatagacattgcgaaaaactaatgtgcaactcttaatttaaatatagagtgaaaagtttgcgatgtgctgctgtttgaaatatatttacgtgtgatttcacacattaaatttaagcattaatgggcatccagatcttcatatcaatatagataggctaccaaagttatagtccttaatttcctgcgtgcatgattaaggttgggaagggtaaataataggtgctaatatttccttattctgttgtgatatatcaattgaaaggagcaaatatttttttattggaaaatgtatacaataaccaagtgctagaccaattgtaagttggagtacggtaaaactgctctgaacccaatggttggtggcttggtgcagctagtggtggtagcagaggttaaatgcttggaaaggttgatgatggcttggttgaagatggagttggccgctgatctaggtgaacagcacagcagtgaccaaccctagacgagggaaagatggatgttcgtcgggcactaggtgaggtttggagaggcggtgatagcggcaccagccaggctgagtaaggatgcgacacatttatgacagccccactaggaggagaggtgccggcaaagctggttgatcaatttgatgaagctgcacacatgcacttttgaaggagaggtagggccttaggggtgcctacatgcgcagttggatcttgacgtcactagaccaccggcttccactagccgcttcacggtgcacaaaccatgttgcctagcaccctgccaccacacacatggtctggagcactgcaattgttggtacctggcggctactgcttgaaacccaaggtcacactatccagtgcatgcactcacatccgcttccctctgccacctaggcatactttacagtcaacgccctactaggctcaccaccacgcatctccttaatataatgtggaacaatggaaaagatgaataaactaacatacattgtttgaggacatggatgccgccgtctccttctctgcttcttttggtgccgttgtagatgtgcatgtcctgaatgtgagtatacctacttgataccataggtgaaactggcgataaacgagcggatgatgccataggtgccactcgcactgccctagaaccacactatgggtcctctctagcatttgcttaggatcagtggtggtatggtttatgaaggagtttgaggaagtggagagttcttcgcctgtccacaggctgagctctccttattttattgcactcatagacttgggggtgatcccaatcaggacattatgctgctcccgatcatggtgaaccaacaagcatgacagaaaaggatggacaatgcgccccttgtgacttggtcttggttgttaatcaagaggatcaaccaacaagaaaaacaatatcctacataacataggcatggcatcaaggagacagcaaccctggccccatcgatcttcgcgatggccacagcatgctgtggaggaagcaccgggaaggagggagagcaaggaggtggtgctcgattaaaggttaaaaaggatggaggagagtgacagatctagtcagttagggcttctataagtttttatactcctcagtttataggtatatatatgtatatgtatttttccttcttagtgaaatgaagtgcaactctcatgcgttttctaaaaagataattacagttataggcttgattatttaaaattgtggatggttattttcaatcacatggggggacaagtgctaaaacggtgtcactagtatacggatcactgccctgagcgccgatggcaataaataaattgtagaagcaacaattaagtaagtatcaaatagttaactgcatatctttgggtggcaaataattaattttatagttaatccacgcagagatatggtccactcattattcacaacaattaattttgttactttctgtcatctttgtgatggatttagaactcatcatacatgcattactggtaatttggaaagatctatttgaaaattttgatggttcaaagaatatatgcataaacttagccttagccttgcagcggccggctccaactttacgtagatggtgctctcatatagctcaaaataaaattgggaatacagaaaggcatagtctagcttttgaactcacattttcctgcaccccctatctttattctagaaacttaataaggccaaaataaaaaaaagcttgccagttgccaacaaggttcacacacttttaatcccagccttagtaggcgcccatagttttcctagtcagcactattgtgctcatctcattgctgttatcttctcccaaataaacacaaaaaagaaagcgagagagagagagcttctcaaaaggaattgaaaagcacaaaacaacagaatatataactgacattgggattctcaccccctcatcaaccctggccatctttatttcttcctctttttggactttgtgtgttactgcatggattcatgtgttgcaacaccctggatgctatctcaccatctgcagcctggagatagagaaagaggaagtgatcgtagagttgagtctctgtcacaacattcacagttgcacatacaggtggcaataatcatgagttggaaacacccctcttgggtaaataaataagagctcctccctccctccaccttcatcacaatagcatcattcaatctttaattcatttgagagttgagagtgagcggaatatatttgtattctacgattgaggagaatggccagccctggagtttgcatcaacttggtgaatggtacatcgacgcgcctccccaccaatgctgatctagtagtccactacctgcaccgtcgcgccattcaggaaccggtgccctgtgacttcatcaccaacgtcgacattctccagcacaacccctgggacatcgtccctggtaaatatttttttgacccacacaggcttactcccattagatatattaatccaaaactttgc), a target site containing NGG (PAM) with higher specificity and low off-target effect is selected through a CRISPRdirect (https:// crispr. Finally, determining a target site sequence (ACATCGGTGATGATCGCACAGGG) positioned on an intron of the OsNAC25 gene as an editing target point, designing a primer OsNAC25-Cas1F/R, and constructing a single-site knockout carrier. Vectors and methods for use are described in references (MAX L, ZHANG QY, ZHU QL, et al 2015.A Robust CRISPR/Cas9 System for Convenient, high-Efficiency Multiplex Genome Editing in Monocot and Dicot plants. Molecular plant,8 (8): 1274-1284.DOI: 10.1016/j.molp.2015.04.007.).

The primer sequences were as follows:

OsNAC25-Cas1F：AACACCGGACTTAGCATCCC

OsNAC25-Cas1R：ACCAGGGTACTTGACCTCCT

OsNAC25 overexpression vector construction

An OsNAC25 overexpression vector was constructed using the plant binary expression plasmid pCAMBIA 1300-UBI. Designing a primer OsNAC25-OX-F/R, and amplifying the full-length CDS sequence of the OsNAC25 gene by taking cDNA of Zhonghua 11 as a template (the nucleotide sequence is shown as SEQ ID NO. 2: atggctaacaccggacttagcatccccatggtgaatggtgccacaatccacctcctccctggtttccggttccgtccaactgacgatgagctagtcatcaaatacctctacccccgtgcttttcatgtgccactgccctgtgcgatcatcaccgatgttgacatccatcatcacaacccctgggacatcgtcccagtggcggagagggagaaagggaagcacttcttcacaagaaaggaggtcaagtaccctggtagccgccgtagcaaccgtgttgctggtaatggcttctggagagcagcaggctcggaggtgcccatctattacaaaccagaaggtgctgctaacgacatgctagttgggatgaggcggactctagtgttccactacggaaagtcacgatctgcagagcgcactgaatgggccatgcatgagtttcagcttgctggtgctggtctccttcctcaccctatgatgaggcatgcaaccagcaatggttcagagccaccctgtggctgccttgaagcgacaatcgctaagaaaagtgatggtctctctgcaactcttcgtgccaagcgtgattctgcccctcttatgagaatcatggtagaacccgatagctcatgggtgatctgctgcatctacaagaagaggcagcgtgccccgcctgttgttatccctcctgtcattggcgatgtaggggaagctatcatccctcatgctattggcgatgcaagggaaggccaacttcacttcattgacttcctggggcagccagctcgcaatgatccatcctcgccccatagctgcaccattgacccctcctctttggaggaagggagtgatgagtctgccggtgatggtgaagataaggatggtgatggcatgaatgaagcaaattga the amino acid sequence of the coded protein is shown in SEQ ID NO. 3: the mannglsidvngvolghllpgfrfrptddelvicylinkiyl prftplftvolvichdhdhdhdihhnpdighvhvhvhvhvpekkvkkkkkkkkkkkkvrrrsggfsggfwegfragtssevpicvpicvpicvrrttvksugertewhead samewhead microphphpmrhattschppcgcgclearkksdggldstrakdstraktsaphdtsaphdtsapvdvckivkvvvvvvvgekivickigdapkigdapkigdapqhdflfqhdqhdqsnssphssphschschschschschgstkgskgskgskdskdskdskddkdskdskdskdskdskdskdskdskdskdskdskdskdskdskdskdskdskdskdskdskdskdsgdmessgdmessgdssgdssssssssssssssgdssdsssdsssdsssdsssdsTgdkdsTkdstwdstwdsTkdsTkdsTdsTdsTdsfood A kind of electronic device. Simultaneously, the pCAMBIA1300-UBI vector is digested with KpnI and BamHI, and the linearized fragment is obtained after recovery, and the full-length CDS of OsNAC25 and the linearized vector are connected by using T4 ligase. And (3) enzyme digestion and sequencing verification to obtain a correct over-expression vector: pCAMBIA1300-UBI-OsNAC25. And transforming the pCAMBIA1300-UBI-OsNAC25 into agrobacterium tumefaciens EHA105 to be competent, so as to obtain pCAMBIA1300-UBI-OsNAC25 agrobacterium tumefaciens bacterial liquid.

The primer sequences were as follows:

OsNAC25-OX-F：caggtcgactctagaggatccATGGCTAACACCGGACTTAGCA；

OsNAC25-OX-R：tccaagggcgaattgggtaccATTTGCTTCATTCATGCCATCA。

3. construction of OsNAC25 over-expression strain by agrobacterium transformation method

In order to obtain the knockout and over-expression material of the OsNAC25, an agrobacterium-mediated genetic transformation method is adopted, the OsNAC25 over-expression vector is transferred into a wild type medium flower 11 variety, and the OsNAC25 knockout vector is transferred into a wild type medium flower 11 (ZH 11) variety. The specific operation steps are as follows:

1) Rice callus culture: mature and full rice seeds, about 20 grams, are selected for husking. On an ultra clean bench, the solution was first washed twice with sterile water. Subsequently, the seeds were immersed in 75% alcohol, treated for 2 minutes, and then rinsed again with sterile water twice, and sterilized once after each operation. Next, the seeds were immersed in a sodium hypochlorite disinfectant, sealed, and placed in a shaker for 20 minutes. On an ultra clean bench, the seeds were rinsed with sterile water until no foam was present. To ensure sterility, the treated seeds were placed on sterile filter paper and surface moisture was blown dry in an ultra clean bench. The sterilized seeds were spread evenly on N6B5 medium with sterilized forceps, ensured to be carried out on an ultra clean bench, and the petri dishes were placed in a darkroom at 28℃for cultivation. To reduce the risk of seed contamination, it is important to avoid contamination of the bacteria into the culture medium. During the incubation process, ensuring that good sterile conditions are maintained, the status of the medium is checked and recorded, taking care to prevent contamination by bacteria.

2) Agrobacteria-infected callus: the plasmid containing the knockdown, over-expression and mCherry fusion tag is respectively transferred into agrobacterium, and then the cultured bacterial liquid is collected and centrifuged. The cells were resuspended with PHI suspension and the concentration was adjusted to an OD600 between 0.08 and 0.1. Subsequently, acetosyringone (As) was added in a proportion of 0.2% (v/v). Next, calli with good growth status were collected, placed in sterile culture flasks, approximately 40 ml of pre-formulated PHI Agrobacterium suspension was added, and then allowed to stand at room temperature for 20 minutes with shaking every 5 minutes. The suspension was poured off, the calli were placed on sterile paper and dried on an ultra clean bench. Finally, the calli were transferred to a petri dish with new sterile paper, sealed with a sealing film, and placed in a dark room environment at 19 ℃ for 3 days.

3) Resistant callus screening: transferring the co-cultured callus onto N6B5 screening medium containing 500mg/L cefotaxime, 400mg/L carbenicillin and 50mg/L hygromycin, and removing brown callus after about 10 days after screening, and retaining the resistant callus for preparation of subculture.

4) Differentiation and rooting: positive calli were migrated to differentiation medium containing 50mg/L hygromycin B and 250mg/L carbenicillin, operating on a sterile super clean bench. Subsequently, seedlings grown about 2cm on differentiation medium were transferred to rooting medium containing 50mg/L hygromycin B and 200mg/L carbenicillin.

5) Strengthening seedlings and transplanting: culturing for about two weeks, selecting young seedling with a height of about 10cm and developed root system, washing the culture medium with warm water, and transplanting to a greenhouse.

PCR detection of OsNAC25 over-expressed lines was performed with hygromycin primers (hygF/hygR). The results showed that 8 hygromycin identified positive in 17 randomly selected transgenic plants, initially indicating that the pCAMBIA1300-UBI-OsNAC25 overexpression vector had been successfully transferred into rice plants (FIG. 1).

The primer sequences were as follows:

hygF：5′-GTGCTTGACATTGGGGAGTT-3′；

hygR：5′-GATGTTGGCGACCTCGTATT-3′。

obtaining 28 OsNAC25 knockout transgenic lines by CRISPR/Cas9 technology, detecting 27 positive lines by amplifying hygromycin gene fragments (primer hygF/hygR), and performing knockout type detection by amplifying target fragments containing target sites by the primer Cr-OsNAC25-F/R after multiple generations of selfing planting to obtain two homozygous OsNAC25 knockout lines with transgenic background removed: 1 base (designated cr-OsNAC 25-10) was inserted, and the other was deleted by 14 bases (designated cr-OsNAC 25-16) (FIG. 1).

The sequence of the detection primer is as follows:

Cr-OsNAC25-F：5′-ACACATAGAAACAAGAAAGCCAGGC-3′；

Cr-OsNAC25-R：5′-CAAATCAACAAGCTCTGAGCAACA-3′。

example 2

Overexpression of OsNAC25 improves plant survival under severe drought stress

Through qPCR quantitative results, we found that OsNAC25 may be involved in regulating seedling stage plant development under drought stress, so that transgenic materials of ZH11 and OsNAC25 are subjected to seedling stage drought stress treatment. Early pre-experimental screening of PEG4000 concentration found that although PEG was able to inhibit the growth of the OsNAC25 transgenic material, there was no significant difference between the knockout and overexpressing strains. Then, the drought stress is directly not supplied to the plant water in the period of one heart of two leaves, the heavy drought stress treatment is carried out, and the plant starts to show the symptoms of leaf wilting and yellow from 24 hours until obvious phenotype difference appears between 48 hours of OsNAC25 over-expression material and knockout material. Knockout of the OsNAC25 material and ZH11 plants showed significantly poorer growth status and massive death than the over-expressed material of OsNAC25, whereas the over-expressed material of OsNAC25 (OE-OsNAC 25-2, OE-OsNAC 25-16) showed good growth status and only a small amount of plants died (see FIG. 2-A). The drought stress treated material was then rehydrated and the plants were waited for several days to recover, and the plant survival rates for OsNAC25 knockdown, over-expressed material and ZH11 were counted, with the plant survival rate for OsNAC25 over-expressed material being significantly higher than for ZH11 and knockdown material (as in fig. 2-B). The result shows that the over-expression of OsNAC25 can obviously improve the survival rate of plants under severe drought stress.

Example 3 Effect of drought stress on SOD content of OsNAC25 Material

Superoxide dismutase (SOD) is widely found in plant cells and is capable of catalyzing superoxide anions to undergo disproportionation to produce H ₂ O ₂ And O ₂ SOD content plays an important role in biological antioxidant process. Samples were taken at the time when the OsNAC25 drought stress treatment phenotype was most pronounced and SOD content was determined and the results are shown in figure 3. Firstly, the SOD content of the overground part, the SOD average content of CR-OsNAC25-10 strain is 19.119U/g, the SOD average content of CR-OsNAC25-16 strain is 19.74U/g, the SOD average content of ZH11 strain is 16.23U/g, the SOD average content of OE-OsNAC25-2 strain is 12.25U/g, and the SOD average content of OE-OsNAC25-16 strain is 12.01U/g. The SOD content of the underground root, the SOD average content of CR-OsNAC25-10 strain is 2.069U/g, the SOD average content of CR-OsNAC25-16 strain is 2.891U/g, the SOD average content of ZH11 strain is 3.673U/g, the SOD average content of OE-OsNAC25-2 strain is 1.091U/g, and the SOD average content of OE-OsNAC25-16 strain is 0.514U/g. Wherein the OE-OsNAC25-2 and OE-OsNAC25-16 strains have significantly reduced aboveground SOD levels as compared to ZH11 by 32.48% and 35.1%, respectively, and subsurface SOD levels as compared to ZH11 by 236.7% and 614.6%, respectively. And compared with ZH11, the CR-OsNAC25-10 and CR-OsNAC25-16 strains have the overground SOD content increased by 15.11% and 17.78%, respectively, and the underground SOD content decreased by 77.52% and 27.05% compared with ZH11, respectively.

Claims (9)

1. The application of the rice OsNAC25 gene or the OsNAC25 protein in improving the drought tolerance of rice is characterized in that the nucleotide sequence of the rice OsNAC25 gene is shown as SEQ ID NO.1 or SEQ ID NO. 2; the amino acid sequence of the OsNAC25 protein is shown as SEQ ID NO.3, and is obtained by encoding the rice OsNAC25 gene.

2. A method for improving drought tolerance of rice is characterized in that an OsNAC25 gene is overexpressed or overexpressed in rice crops, and the nucleotide sequence of the OsNAC25 gene is shown as SEQ ID NO.1 or SEQ ID NO. 2.

3. The method according to claim 2, comprising the steps of:

(1) Connecting an OsNAC25 gene with a plasmid to construct an overexpression or overexpression vector containing the OsNAC25 gene;

(2) Introducing the overexpression or the overexpression vector of the OsNAC25 gene constructed in the step (1) into the cells of rice, and culturing to obtain transgenic plants.

4. A method according to claim 3, wherein in step (1) the plasmid vector is a binary expression vector.

5.A method according to claim 3, wherein, after transferring the overexpression or overexpression vector of the OsNAC25 gene into agrobacterium genetic engineering bacteria in step (2), the rice cells are infected.

6. The method of claim 5, wherein the agrobacterium genetically engineered bacterium is agrobacterium EHA105 strain.

7. The method according to claim 6, wherein the rice infected with the agrobacterium in step (2) has a cell source of callus of rice seeds.

8. The application of the rice OsNAC25 gene or OsNAC25 protein in cultivating drought-tolerant plants is characterized in that the nucleotide sequence of the rice OsNAC25 gene is shown as SEQ ID NO.1 or SEQ ID NO. 2; the amino acid sequence of the OsNAC25 protein is shown as SEQ ID NO.3, and is obtained by encoding the rice OsNAC25 gene.

9. The use according to claim 8, wherein the plant is rice.