CN117646021A - NtWAKL1 gene and application thereof in cultivation of high-fusarium-resistance plants - Google Patents

Abstract

The invention belongs to the field of genetic breeding of tobacco, relates to cultivation of high-resistance fusarium plants, and particularly relates to application of an NtWAKL1 gene in cultivation of high-resistance fusarium plants. Screening the sgRNA sequence of the gene editing target site according to the nucleotide sequence of the NtWAKL1 gene, and designing a sgRNA primer pair; obtaining a sequence of a target site through an annealing reaction, and obtaining a NtWAKL1-pORE-Cas9 vector through enzyme digestion and connection; the NtWAKL1-pORE-Cas9 vector is subjected to agrobacterium GV3101 mediated genetic transformation to obtain a gene editing strain. Through analysis, the gene plays a role in identifying cell wall polysaccharide degradation products as invasion signals and regulating and controlling the expression of plant and pathogen interaction genes in response to invasion of fusarium. The improvement of the resistance of the infected strain to fusarium can be realized by knocking out the gene and silencing the function of the gene through gene editing.

Description

NtWAKL1 gene and application thereof in cultivation of high-fusarium-resistance plants

Technical Field

The invention belongs to the field of genetic breeding of tobacco, relates to cultivation of high-resistance fusarium plants, and particularly relates to application of an NtWAKL1 gene in cultivation of high-resistance fusarium plants.

Background

Tobacco is an important economic crop in China. The method has strong adaptability, can thrive under various regions and ecological conditions, is an important raw material for the cigarette industry, and has high economic value. In addition, the research value is high, and in plant research, tobacco is adopted as research material in many pioneering researches, such as photoperiod, plant nutrition, photosynthesis, light respiration, organic metabolism, transgene, plant response to pathogen and the like. In agricultural research, since tobacco has many similar biological characteristics, secondary metabolic pathways and the like as solanaceae crops, a large number of researchers use tobacco crops to study pattern plants for crop growth and development, stress response, disease and pest resistance and new gene function analysis, and also pattern plants for researching plant genetics, molecular biology and cell biology. The tobacco in vitro culture technology is simple and easy to implement, the redifferentiation and genetic transformation technology is simple, the agrobacterium-mediated tobacco genetic transformation can obtain transgenic plants within 2-3 months, and the transgenic tobacco can stably express exogenous genes, so that a plurality of researchers verify the gene functions of other plants by using the tobacco.

The plant receptor-like kinase (RLK) gene is a gene identified from plant cells by molecular biology means and homologous to animal cell receptor kinase (receptor protein kinase, RPK), and is called a receptor-like kinase because most of its encoded products have not been confirmed to have a receptor function in plant cells, and their natural ligand numbers have not been found, wherein a small part of the ligands of the receptor-like kinase have been found, such as CLV1, SRK, etc., and thus these receptor-like kinases may also be called plant receptor kinases (plant receptor kinase, PRK). Typical receptor-like kinases generally consist of an extracellular domain, a transmembrane domain, and an intracellular domain having kinase activity. The various environmental signals and extracellular signal molecules generated by the organism play a role in regulating the growth and development of the organism. In addition to the fact that some small molecules (such as steroid hormones) can directly penetrate the cell membrane into the cell, most extracellular signal molecules can only be converted into intracellular signals through a signal conversion system on the membrane after being recognized by the receptors on the plasma membrane, and the receptors on the plasma membrane are key components of the signal conversion pathway. Depending on the mechanism of signal transduction and the characteristics of the receptor molecule, transmembrane transduction of extracellular signals can be achieved by G-protein coupled receptors, ion channel receptors and receptors with enzymatic activity. Publication No. CN110295185A discloses a method for improving the resistance of citrus to canker based on the overexpression of CsWAKL08, and the patent improves the resistance of citrus to canker by constructing an overexpression CsWAKL08 gene. However, homologous genes in different plants function differently.

The most economical and effective mode for preventing and treating fusarium root rot is to select and select disease-resistant varieties. The existing breeding modes of disease-resistant varieties mainly include a backcross method, a round selection method, heterosis breeding and the like, or new germplasm is created through physicochemical mutagenesis, transgenosis and the like, so that a disease-resistant mechanism is analyzed, and new strains with good resistance and excellent properties are screened out. These methods generally have large workload of screening and identification, long process, long breeding period, and about five to ten years are needed to obtain new lines with target traits meeting the requirements. The transformation of resistance genes into tobacco can result in strains with increased resistance in a relatively short period of time, but this approach cannot be applied to breeding practices because the tobacco industry is strictly prohibited from using transgenic tobacco. The application carries out intensive research on the influence of WAKL1 gene in tobacco on fusarium root rot.

Disclosure of Invention

The invention provides application of an NtWAKL1 gene in cultivation of high-resistance fusarium plants, and solves the breeding problem of the high-resistance fusarium plants.

The technical scheme of the invention is realized as follows:

in one aspect, the application claims the use of the ntWAKL1 gene for the cultivation of plants with high resistance to Fusarium.

Further, the protein sequence encoded by the NtWAKL1 gene has more than 90% similarity with the amino acid sequence shown in SEQ ID No.2, and the protein structure thereof comprises a Signal peptide (Signal peptide) composed of 26 AA connected in sequence, a WAK binding domain (gub_wak_bind), a transmembrane region (Transmembrane region, TM), and a protein kinase domain (Pkinase).

Preferably, the amino acid sequence of the protein is shown as SEQ ID No. 2.

Further, the nucleotide sequence of the NtWAKL1 gene has more than 90% similarity with the nucleotide sequence shown in SEQ ID No. 1.

Preferably, the nucleotide sequence of the NtWAKL1 gene is shown in SEQ ID No. 1.

Preferably, the plant is tobacco.

The application comprises the following steps:

(1) Screening the sgRNA sequence of the gene editing target site according to the nucleotide sequence of the NtWAKL1 gene, and designing a sgRNA primer pair;

(2) Obtaining a sequence of a target site through annealing reaction, and inserting the sequence of the target site into a CRISPR/Cas9 carrier pORE-Cas9 through enzyme digestion and connection to obtain a NtWAKL1-pORE-Cas9 carrier;

(3) The NtWAKL1-pORE-Cas9 vector is transformed by agrobacterium GV3101 to obtain a gene editing strain, i.e. a high fusarium resistant plant.

The sgRNA sequence in the step (1) is shown as SEQ ID No. 3.

The sequence of the sgRNA primer pair is shown as SEQ ID No.3 and SEQ ID No. 4.

The annealing reaction system in the step (2) is as follows: annealing buffer for DNA Oligos (5×) 4 μl; 4. Mu.L of each of the upstream and downstream primers; nuclease-free water, 12. Mu.L.

The reaction procedure is as follows: the temperature was reduced by 0.1℃every 8s for 5min at 95℃until the temperature was reduced to 25 ℃.

The invention has the following beneficial effects:

1、NtWAKL1the gene has the functions of identifying cell wall polysaccharide degradation products as invasion signals and regulating and controlling the expression of plant and pathogen interaction genes in response to invasion of fusarium, and is editedNtWAKL1The gene is knocked out, so that the resistance of the infected strain to fusarium can be improved. The gene has important application value in disease-resistant breeding of tobacco.

2. The CRISPR/Cas 9-based gene editing technology adopted in the patent can accurately edit and introduce the specific genes and target sites of the tobacco genome into the mutation comprising deletion, insertion and the like. The technology has high knockout efficiency, good specificity, low cost and convenient operation, the introduced gene mutation is heritable, the basic research and germplasm innovation process related to the gene function can be accelerated, and the technology has been widely applied in the aspects of character improvement, gene regulation, resistance breeding, germplasm innovation, construction of high-flux mutant libraries and the like of a plurality of species. After the variant strain with improved resistance is obtained by a CRISPR/Cas 9-based gene editing means, 2-3 generations of screening can be adopted to select homozygous strains with exogenous fragments removed and stable inheritance of variation formed by gene editing, and the strains have no exogenous gene fragments, no safety risk and ecological risk of transgenic crops and have good application prospects.

3. Of the present applicationNtWAKL1The gene codes PRRs signal receptor protein, and can identify cell wall polysaccharide degradation products as invasion signals in response to invasion of fusarium, regulate and control plants and pathogensInteraction of expression of genes. The improvement of the resistance of the infected strain to fusarium can be realized by knocking out the gene and silencing the function of the gene through gene editing. The target gene NtWAKL1 and the target site thereof provide technical support for the directional improvement of tobacco resistance; the material with improved resistance created by the method can also be used as an important germplasm resource for breeding. In addition, after editing the WAKL gene, it was observed that flower development was affected to some extent, including: 1) The filaments are shortened, the growth is exposed, uncontrolled self-pollination is avoided, and the breeding hybridization is facilitated; 2) The color is changed, the color of the mutant is changed from dark to light, and the color of the mutant is changed from dark to light; 3) The appearance of the corolla also has certain variation, and the characteristics suggest that the WAKL gene plays a role in regulating and controlling the development of the corolla, the flower type, the flower color, the stigma, the filament and the corolla, has potential application value in the breeding of ornamental plants in gardening, and can be used for creating new germplasm and new varieties with different flower colors.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are required in the embodiments or the prior art description will be briefly introduced below, it being obvious that the drawings in the following description are only some embodiments of the present invention,it will be apparent to those skilled in the art that the present invention is not limited to the above-described embodiments Obtaining other figures from these figures。

FIG. 1 is a schematic diagram of the secondary structure and domain of the NtWAKL1 gene.

FIG. 2 is a diagram showing PCR electrophoresis verification of transgenic positive plants.

FIG. 3 is a flow chart of the creation of a gene editing positive line.

FIG. 4 is a diagram showing the comparison of the protein encoded by the edited gene sequence with the protein encoded by the original gene sequence after gene editing.

FIG. 5 is a diagram showing specific sequences, editing types and ratios of target sites in a strain with a high editing ratio; wherein 2D is a type of two base deletion; 1D is a single base deletion type; 3D is a type of 3 base deletion; 1I is the type of single base insertion, WT is the control where no editing has occurred.

FIG. 6 is a workflow diagram of overall gene editing.

FIG. 7 is a graph showing the results of the identification of resistance by the in vitro leaf blade and Fusarium seed cake inoculation method.

FIG. 8 is a graph showing the results of identifying resistance by the method of using potted tobacco seedlings and inoculated wheat grains with bacteria. The result shows that the resistance of the gene editing strain to fusarium is improved, and the growth conditions of leaves, stems and roots are better than those of a control after inoculation.

FIG. 9 is a diagram showing changes in the stigma and the silk of the flower type flower color of the gene editing strain. The observation shows that the stigma of part of the gene editing strain is longer than that of the filigree, wherein a is the inflorescence of the mutant strain with the stigma longer than that of the filigree and the flower color obviously deepened; b is inflorescence of mutant strain with color becoming light and stigma longer than that of filigree; c is an inflorescence chart with obvious change of the flower type; d is a control chart of flower buds with different colors; e is a mutant and control filament length control. f-h is the corolla of a mutant strain in which the corolla shape is mutated.

Detailed Description

The technical solutions of the present invention will be clearly and completely described in conjunction with the embodiments of the present invention, and it is apparent that the described embodiments are only some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without any inventive effort, are intended to be within the scope of the invention.

Examples

1. Gene sequence analysis

The cell wall related kinase (WAKL) sequence is shown as SEQ ID No.1, belonging to a very unique group of plant receptor protein kinases. They are important regulators in plants in response to pathogenic invasion and are widely involved in plant growth, development and response to external stress.

The amino acid sequence of the gene is shown as SEQ ID No.2, and comprises 26 AA Signal peptides (WA)A K binding domain (GUB_WAK_bind), a transmembrane domain (Transmembrane region, TM), and a protein kinase domain (Pkinase). In subsequent gene editing of tobacco (CRISPR/Cas 9), the target site sequence on WAKL isCTTCATCTAGTGCAAAGCC or CAGCAAACTTCACAAACTCG。

2. Construction of NtWAKL1 Gene editing vector

1. And selecting proper gene editing target sites and designing sgRNA according to gene sequences by using an online tool CRISPR direct (http:// CRISPR. Dbcls. Jp /), sequence Scan for CRISPR (http:// CRISPR. Dfci. Harvard. Edu/SSC /), CRISPR MultiTargeter (http:// www.multicrispr.net /), and the like.

Table 1.NtWAKL1Primers used in construction of Gene knockout vector

2. Gene editing vector construction

(1) And obtaining the target DNA double strand by means of annealing reaction.

The reaction system is as follows: annealing buffer for DNA Oligos (5×) 4 μl; 4. Mu.L of each of the upstream and downstream primers; nuclease-free water, 12. Mu.L. The reaction procedure is: the temperature was reduced by 0.1℃every 8s for 5min at 95℃until the temperature was reduced to 25 ℃.

(2) And (5) enzyme cutting and connecting.

Cleavage was performed using NEB BsaI enzyme, according to the instructions, using a 50. Mu.L system. And (3) connecting the annealed product to a Bsa I digested CRISPR/Cas9 vector pORE-Cas9 by using T4 ligase to obtain the NtWAKL1-pORE-Cas9 recombinant vector.

(3) Transformation DH5 alpha and verification

100. Mu.L of DH 5. Alpha. Competent cells were obtained, and the above-described ligated fragments were transferred into DH 5. Alpha. According to the procedure described. The colony PCR method is used, the F primer of the U26 gene and the R primer of the target gene are used as upstream and downstream primers, after the successful bacterial colony of the segment insertion is screened, the bacterial colony is propagated, and glycerol with proper concentration is added for long-term storage at-80 ℃.

3. Transformation of GV3101 and genetic transformation of tobacco

(1) Selecting successfully inserted bacteria selected in the second step, amplifying and extracting plasmids, transforming and shaking according to the specification of GV3101 competent cells, and screening positive transformants by a PCR mode; and detecting positive bacterial liquid, and carrying out sequencing verification.

(2) Genetic transformation of tobacco.

The bacterial liquid with correct sequencing is propagated and cultured by using a YEB culture medium containing antibiotics, the bacterial liquid is collected by centrifugation at 5000rpm, bacterial cells are resuspended by using an MS liquid culture medium without hormone, and the OD value is adjusted to 0.6-0.8 for dip dyeing the leaves.

Genetic transformation process: cutting tobacco aseptic seedling into 0.5-1 cm square leaf discs, soaking in the prepared bacterial liquid for 10min, and slightly stirring. After soaking, taking out the leaf disc, sucking the leaf surface bacterial liquid with sterile filter paper, placing on MS co-culture medium, placing under the dark condition at 25 ℃ and culturing for 2-3 days. Afterwards, the leaf discs were transferred to a differentiation medium containing kanamycin and placed at 25 ℃ to induce differentiation.

(3) Screening of Gene editing lines.

After the regenerated plants are obtained, positive plants are screened through PCR detection; and screening the strains of which the target gene loci are truly edited by a hi-tom sequencing method.

4. Screening of Positive plants

By PCR, 55 transgenic positive plants were selected. The PCR electrophoretogram is shown in FIG. 2, 25 strains with successfully edited target sites (GCTTCATCTAGTGCAAAGCC) are further screened by Hi-Tom sequencing, 9 positive strains with allele sites editing proportion exceeding 90% are selected, 13 positive editing strains with allele sites editing proportion exceeding 80% are selected, and specific editing types and proportions are shown in FIG. 5. The editing ratio of the other target point is generally about 10%, so in the subsequent editing experiments, sgRNA taking GCTTCATCTAGTGCAAAGCC as the target point is adopted: ntWAKL1F, as listed in table 1, the sgRNA sequence is:GATTGCTTCATCTAGTGCAAAGCC。

sequencing analysis results show that the main types of gene editing include deletion mutations such as 1D, 2D, 3D, 4D, 7D (wherein D represents deleted bases, and the previous numbers refer to the number of deleted bases); type 1I (mutation type with one base inserted), the change of the encoded protein after editing the gene is shown in FIG. 4. In FIG. 4, the top WT row shows the normal gene sequence in Nicotiana tabacum and its triplet encoded amino acid sequence, with the target sites indicated in red underlined; the following-1, -2, -3, -4, -7, +1A and +1T show the editing type of deleting 1, 2, 3, 4, 7 bases or inserting a gene sequence of A or inserting a T base, respectively, and the change situation of the coded protein.

In the strain with higher editing proportion, the specific sequence, editing type and proportion of the target site are shown in figure 5, and as can be seen from figure 5, in the created strain, the types of gene editing are different, and the deletion editing type and the insertion editing type are mainly used; the editing ratio of different strains is also different, and the gene editing ratio is generally higher than 80% and can reach more than 90%.

6. Analysis of Gene expression level

From the analysis of transcriptome sequencing, the fpkm value was analyzed to determine WTNtWakl1As shown in Table 2, the expression level of WAKL gene was significantly increased in the normal strain after Fusarium inoculation, and the fpkm value was increased from 4.3 to 9.39; after editing WAKL gene, after inoculating fusarium, the fpkm value of NtWAKL1 gene in the mutant material is changed from 2.03 to 2.64, and the amplitude is far lower than that of a normal variety. .

TABLE 2 wild type wt and Gene editing plantsWaklFpkm values before and after Fusarium inoculation

3. Editing planting observation and disease resistance identification of offspring.

FIG. 6 is a working flow chart of gene editing, and after hardening and transplanting, the gene editing strain is observed and analyzed, and the result shows that the editing strain has no obvious difference from a control in plant properties such as plant height, leaves and the like. After bud emergence, bagging for selfing and collecting seeds; and after the second generation of the seed, bagging, selfing and collecting seeds are continued, and a gene editing strain without a transgenic tag is obtained in the T2 generation.

By applying different identification methods, the resistance of the strain to fusarium is analyzed, and the result shows that,wakl-28andwakl-7These multiple strains all showed increased resistance to fusarium. The specific results are as follows:

1. identification result of bacterial cake inoculation in vitro leaf method:

in vitro leaves of different strains are taken, and fusarium is inoculated in a bacterial cake method, and the identification result is shown in figure 7: at 10 to 2 weeks post inoculation, the leaves of the control clearly wilt yellow, with areas of chlorosis up to 80% -100%, while leaves of the gene-editing lines remain normal, or only slightly yellow (less than 20%).

2. Potted tobacco seedling, inoculation of the identification result of the wheat grain method with bacteria:

as shown in fig. 8, after the wheat grains with bacteria are inoculated, the stem base of the control turns yellow and slightly necrotic, the stem base of the gene editing strain can grow normally, and the color and the texture of the stem base are not obviously changed; the root system of the control tobacco plant is damaged, the color of the control tobacco plant turns yellow, the total volume of the root is reduced, and the lateral roots are reduced to different degrees; the root system of the gene editing strain is still normally white in color, and the development of lateral roots is not inhibited.

3. Phenotypic outcome on inflorescences and flowers of the gene-editing lines:

the flower colors, flower patterns, stigma and filaments of different gene editing strains have different degrees of variation. It was observed that the stigma of a partially genetically edited strain was longer than the filament resulting in stigma exposure. The hybridization offspring beyond the parent can be produced by hybridization breeding, the stigma is exposed, uncontrolled self-pollination in the hybridization seed production can be reduced, and the quality and purity of pollination seed production can be guaranteed. The flower color of part of the plant line is changed, and part of the flower shape is also changed obviously, so that the plant line has ornamental value compared with the inflorescence of common tobacco. The variation of the flowers of the mutant line is shown in FIG. 9, wherein a is the inflorescence of the mutant with stigmas longer than the filaments and with colors obviously deeper than those of the control; b is inflorescence of a strain with column heads longer than filaments and obviously lighter colors; c is an inflorescence chart with obvious change of the flower type; d is a control chart of flower buds with different colors; e is a filament length control graph. f-h is a corolla shape map of the corolla shape variant strain. The result shows that NtWAKL1 plays a certain regulating role in the flower development process of tobacco.

From the above results it is inferred that,NtWAKL1the gene plays roles in sensing pathogen invasion, regulating and controlling signal transduction, regulating plant growth to cope with pathogen invasion and maintaining relative normal growth in response to fusarium invasion. By editingNtWAKL1The gene can improve the resistance of the infected strain to fusarium. The gene has important application value in disease-resistant breeding of tobacco. In addition, the observation results of the corolla shape, the flower color, the flower silk and the flower silk show that the WAKL1 gene can play a certain role in regulating and controlling the corolla shape, the flower color, the flower silk and the flower silk in the development process, and the obvious changes on the appearance can be used as screening marks and have potential application values in ornamental plant breeding.

The foregoing description of the preferred embodiments of the invention is not intended to be limiting, but rather is intended to cover all modifications, equivalents, alternatives, and improvements that fall within the spirit and scope of the invention.

Claims (10)

1.NtWAKL1The application of the gene in cultivating plants with high fusarium resistance.

2. The use according to claim 1, characterized in that: the saidNtWAKL1The sequence of the protein coded by the gene has more than 90 percent of similarity with the amino acid sequence shown in SEQ ID No. 2.

3. The use according to claim 2, characterized in that: the structure of the protein comprises a signal peptide, a WAK binding domain, a transmembrane region and a protein kinase domain which are connected in sequence.

4. A use according to claim 3, characterized in that: the nucleotide sequence of the NtWAKL1 gene has more than 90% similarity with the nucleotide sequence shown in SEQ ID No. 1.

5. The use according to any one of claims 1-4, wherein: the plant is tobacco.

6. The use according to claim 5, characterized by the steps of:

(1) Screening the sgRNA sequence of the gene editing target site according to the nucleotide sequence of the NtWAKL1 gene, and designing a sgRNA primer pair;

(2) Obtaining a sequence of a target site through annealing reaction, and inserting the sequence of the target site into a CRISPR/Cas9 carrier pORE-Cas9 through enzyme digestion and connection to obtain a NtWAKL1-pORE-Cas9 carrier;

(3) The NtWAKL1-pORE-Cas9 vector is transformed by agrobacterium GV 3101-mediated transformation to obtain a gene editing strain, namely a high fusarium resistant plant.

7. The use according to claim 6, characterized in that: the sgRNA sequence in the step (1) is shown as SEQ ID No. 3.

8. The use according to claim 7, characterized in that: the sequence of the sgRNA primer pair is shown as SEQ ID No.3 and SEQ ID No. 4.

9. The use according to any one of claims 6 to 8, wherein the annealing reaction in step (2) is carried out in a system comprising: annealing buffer for DNA Oligos (5×) 4 μl; 4. Mu.L of each of the upstream and downstream primers; nuclease-free water, 12. Mu.L.

10. The use according to claim 8, wherein the reaction procedure is: the temperature was reduced by 0.1℃every 8s for 5min at 95℃until the temperature was reduced to 25 ℃.