CN117535436B - Sequence combination for rapidly detecting rice bacterial leaf spot bacteria based on CRISPR/Cas12a-RPA and application - Google Patents

Sequence combination for rapidly detecting rice bacterial leaf spot bacteria based on CRISPR/Cas12a-RPA and application Download PDF

Info

Publication number
CN117535436B
CN117535436B CN202410014372.3A CN202410014372A CN117535436B CN 117535436 B CN117535436 B CN 117535436B CN 202410014372 A CN202410014372 A CN 202410014372A CN 117535436 B CN117535436 B CN 117535436B
Authority
CN
China
Prior art keywords
rpa
detection
rice bacterial
reaction
bacterial leaf
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202410014372.3A
Other languages
Chinese (zh)
Other versions
CN117535436A (en
Inventor
赵辉
张海敏
杜晓希
胡帅
张金鑫
纪长绵
夏启玉
郭安平
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sanya Research Institute Chinese Academy Of Tropical Agricultural Sciences
Original Assignee
Sanya Research Institute Chinese Academy Of Tropical Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sanya Research Institute Chinese Academy Of Tropical Agricultural Sciences filed Critical Sanya Research Institute Chinese Academy Of Tropical Agricultural Sciences
Priority to CN202410014372.3A priority Critical patent/CN117535436B/en
Publication of CN117535436A publication Critical patent/CN117535436A/en
Application granted granted Critical
Publication of CN117535436B publication Critical patent/CN117535436B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/64—Xanthomonas
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides a sequence combination and application for rapidly detecting rice bacterial leaf spot bacteria based on CRISPR/Cas12a-RPA, belongs to the technical field of pathogenic microorganism detection, provides a sequence combination of a specific crRNA sequence and an RPA primer pair for detecting rice bacterial leaf spot bacteria, and also provides a detection kit, a detection method and application for rapidly detecting rice bacterial leaf spot bacteria based on CRISPR/Cas12 a-RPA. The detection method combines the RPA amplification method with the CRISPR/Cas12a detection method to detect rice bacterial strip spot bacteria, and realizes visual detection through a blue light gel cutting instrument and a lateral flow chromatography test strip; the detection method has good specificity and sensitivity, can detect the nucleic acid of the rice bacterial leaf spot bacteria in the field and the field rapidly only by a simple instrument.

Description

Sequence combination for rapidly detecting rice bacterial leaf spot bacteria based on CRISPR/Cas12a-RPA and application
Technical Field
The invention belongs to the technical field of pathogenic microorganism detection, and particularly relates to a sequence combination for rapidly detecting rice bacterial leaf spot bacteria based on CRISPR/Cas12a-RPA and application thereof, in particular to a sequence combination, a detection kit, a detection method and application for rapidly detecting rice bacterial leaf spot bacteria based on CRISPR/Cas12 a-RPA.
Background
Bacterial leaf streak of rice is a bacterial disease caused by xanthomonas oryzae, and seriously damages the yield of rice. Bacterial leaf streaks of rice are distributed in tropical and subtropical regions of asia, western and eastern africa; in China, the method is mainly distributed in China, south China and southwest areas. Bacterial leaf streaks of rice have been reported many times in south China, which result in 10% -20% loss of rice yield, sometimes even up to 40% loss, even in the absence of harvest, and seriously threaten the safety of rice production. Before obvious symptoms appear, the rice infected with the bacterial leaf spot germ of the rice in early stage is difficult to carry out physical diagnosis through non-expert knowledge, so that the outbreak of the bacterial leaf spot disease of the rice causes massive death of rice crops. Therefore, the disease is detected in the rice seed bacteria stage or the rice seedling stage by a molecular technology, and the method has important significance for increasing the income of farmers in rice production.
At present, the method for detecting the bacterial leaf spot of rice mainly comprises a traditional detection method, a molecular detection technology developed in recent years and the like. The traditional detection method mainly comprises phage detection method, seedling growth observation method, pathogenicity determination, direct separation method, serological detection technology and the like; the molecular detection technology developed in recent years mainly comprises the following steps: common PCR, digital PCR, fluorescent quantitative PCR, and the like. The traditional detection method is long in time consumption, inconvenient to detect and needs special technicians to detect. At present, national standard for detecting rice bacterial leaf streak in China is based on detection of iron-containing cell receptor genes by utilizing PCR technology.
CRISPR/Cas (clustered regularly interspaced short palindromic repeats/CRISPR-related) is a naturally occurring adaptive immune system in prokaryotes such as bacteria and archaea, which has been widely used for the diagnosis of various infectious microorganisms, including viruses and bacteria, as Cas proteins with different activities are continuously discovered. In addition, the system can be used for detecting microRNAs (miRNAs), single Nucleotide Polymorphisms (SNPs), DNA methylation and the like. Cas12a enzymes in class II CRISPR proteins, in addition to having specific targeting, also exhibit the ability to cleave non-specifically from neighboring nucleic acids, have been widely used in conjunction with isothermal amplification techniques for the diagnosis of various microorganisms. The method can be used for rapidly detecting and diagnosing the rice bacterial leaf spot in the field due to strong specificity, high sensitivity, convenience and rapidness.
Disclosure of Invention
Aiming at the problems, the invention provides a sequence combination and application for rapidly detecting rice bacterial leaf spot bacteria based on CRISPR/Cas12a-RPA, in particular to a sequence combination, a detection kit, a detection method and application for rapidly detecting rice bacterial leaf spot bacteria based on CRISPR/Cas12a technology combined with RPA technology, which have the characteristics of good specificity, high sensitivity, simplicity, rapidness, low sample requirement, high efficiency and the like, can realize the requirement of rapid detection in fields, improve the detection efficiency and provide a new choice for the detection method of rice bacterial leaf spot bacteria.
In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:
a sequence combination for rapidly detecting rice bacterial leaf spot bacteria based on CRISPR/Cas12a-RPA comprises the following steps ofavrRxo1The gene is designed into an RPA primer pair sequence, a crRNA sequence and a ssDNA probe sequence;
wherein, the RPA primer pair sequence is:
the sequence of the forward primer RPA-avrRxo1-F2 is as follows: 5'-CCGACCGGTTTGAAGGCGGACTTCGCTCTC-3' (SEQ ID NO: 1);
the sequence of the reverse primer RPA-avrRxO1-R2 is as follows: 5'-CCTGTCTATCACGTACATTCTATTGCTCCG-3' (SEQ ID NO: 2);
the crRNA sequence is: UAAUUUCUACUAAGUGUAGAUGCUGCAAAACUCCCACCAAAGAA (SEQ ID NO: 3);
the ssDNA probe sequence is used for detecting the rice bacterial leaf spot bacteria by a fluorescent quantitative PCR instrument, is used for detecting the visible fluorescent detection or is used for detecting the lateral flow chromatography test paper strip.
Furthermore, the ssDNA probe sequence of the rice bacterial leaf spot germ for detection by a fluorescent quantitative PCR instrument is ssDNA-reporter-FAM or ssDNA-reporter-CY5;
wherein ssDNA-reporter-FAM is: 5'-FAM-TTATT-BHQ1-3';
ssDNA-reporter-CY5 is: 5'-CY5-TGTCTTATcccccATAAGACA-BHQ1-3';
the ssDNA probe sequence for visual fluorescence detection of rice bacterial leaf spot germ is ssDNA-reporter-FAM-2, and specifically comprises the following steps: 5'-FAM-TGTCTTATcccccATAAGACA-BHQ1-3';
the ssDNA probe sequence for detecting the rice bacterial leaf spot by the lateral flow chromatography test strip is FB-reporter, and specifically comprises the following steps: 5 '-FAM-TTTTTTTTTTT-Biotin-3'.
A detection kit for rapidly detecting rice bacterial leaf streak bacteria comprises an RPA primer pair sequence, a crRNA sequence and a ssDNA probe sequence.
Further, the kit also comprises Rehydration Buffer, mgOAC, enzyme dry powder, lbCAs12a and ddH 2 O；
The enzyme dry powder is used for RPA reaction.
Further, the kit comprises eight rows of PCR reaction tubes with a plurality of independent units, wherein the PCR reaction tubes contain enzyme dry powder;
the kit includes a reaction system for performing an RPA amplification reaction and a system for performing a CRISPR/Cas12a reaction.
Further, the total volume of the reaction system for performing the RPA amplification reaction was 50. Mu.L, and the reaction system included: forward primer RPA-avrRxo1-F1, reverse primer RPA-avrRxo1-R1, Rehydration buffer、ddH 2 O and template DNA are mixed evenly and then are rapidly put into a PCR reaction tube containing freeze-dried enzyme powder, and MgOAC is added after the freeze-dried enzyme powder is dissolved; the template DNA is obtained by extracting a sample to be detected;
specific reaction systems for carrying out RPA amplification reactions are: 2.4. Mu.L of forward primer RPA-avrRxO1-F1 at a concentration of 10. Mu.M, 2.4. Mu.L of reverse primer RPA-avrRxO1-R1 at a concentration of 10. Mu.M, 29.5. Mu.L of Rehydration buffer, 11.2. Mu.L of ddH 2 O and 2 mu L of template DNA are mixed uniformly and then are rapidly put into a PCR reaction tube containing freeze-dried enzyme powder, and 2.5 mu L of MgOAC is added after the freeze-dried enzyme powder is dissolved;
the total volume of the system used to perform the CRISPR/Cas12a reaction was 20 μl; the system for performing the CRISPR/Cas12a reaction is a reaction system for performing RPA/Cas12a fluorescence detection, a reaction system for performing RPA/Cas12a visual fluorescence detection, or a reaction system for performing RPA/Cas12a-LFA reaction; the system is selected from any one of the following:
the system for performing RPA/Cas12a fluorescence detection comprises: SF buffer, crRNA, RNase inhibitor, ssDNA-reporter-CY5 or ssDNA-reporter-FAM, lbCAs12a, RPA amplification product and DEPC treated water; the method specifically comprises the following steps: 2. Mu.L of SF buffer (Tris-OAC, mgOAC, BSA and DTT), 1. Mu.L of crRNA (10. Mu.M), 1. Mu.L of RNase inhibitor (40U/. Mu.L), 2. Mu.L of ssDNA-reporter-CY5 (10. Mu.M) or 2. Mu.L of ssDNA-reporter-FAM (10. Mu.M), 1. Mu.L of LbCAs12a (1. Mu.M), 2. Mu.L of RPA amplification product, 11. Mu.L of DEPC treated water;
Alternatively, the system for performing RPA/Cas12a visualization fluorescence detection comprises: SF buffer, crRNA, RNase inhibitor, ssDNA-reporter-FAM-2, lbCAs12a, RPA amplification product and DEPC treated water; the method specifically comprises the following steps: 2. Mu.L of SF buffer (Tris-OAC, mgOAC, BSA and DTT), 1. Mu.L of crRNA (10. Mu.M), 1. Mu.L of RNase inhibitor (40U/. Mu.L), 2. Mu.L of ssDNA-reporter-FAM-2 (10. Mu.M), 1. Mu.L of LbCAs12a (1. Mu.M), 2. Mu.L of RPA amplification product, 11. Mu.L of DEPC treated water;
still alternatively, the system for performing an RPA/Cas12a-LFA reaction (i.e., a lateral flow chromatography strip detection reaction) comprises: comprising the following steps: SF buffer, RNase inhibitor, FB-reporter, lbCas a, RPA amplification product and DEPC treated water; the method specifically comprises the following steps: 2. Mu.L of SF buffer (Tris-OAC, mgOAC, BSA and DTT), 1. Mu.L of crRNA (10. Mu.M), 1. Mu.L of RNase inhibitor (40U/. Mu.L), 2.5. Mu.L of FB-reporter (100 nM), 1. Mu.L of LbCAs12a (1. Mu.M), 2. Mu.L of RPA amplification product, 10.5. Mu.L of DEPC treated water.
The detection kit for rapidly detecting the rice bacterial leaf spot pathogens is applied to detection of the rice bacterial leaf spot pathogens in the field.
A detection method for rapidly detecting rice bacterial leaf streak bacteria comprises the following steps:
1) Extracting genome DNA of a suspected rice bacterial leaf spot pathogen sample;
2) Taking genome DNA as template DNA, and performing RPA amplification reaction by using the detection kit to obtain an RPA amplification product;
3) By using the detection kit, the RPA amplification product is taken to perform CRISPR/Cas12a reaction, and then fluorescence detection (namely RPA/Cas12a fluorescence detection or RPA/Cas12a visualized fluorescence detection) or lateral flow chromatography test strip detection (namely RPA/Cas12a-LFA reaction) is performed.
Further, in the step 1), the method for extracting the genome DNA of the suspected sample of the rice bacterial leaf scald disease comprises the steps of taking the suspected sample of the rice bacterial leaf scald disease, cutting the suspected sample into fine fragments, putting the fine fragments into a clean 1.5 mL sterile centrifuge tube, adding NaOH solution with the concentration of 0.5mol/L, mashing the leaves by a sterilized grinding rod, standing for 1min at room temperature, and diluting 50 times by using TE Buffer (Tris-EDTA) to obtain the genome DNA of the suspected sample of the rice bacterial leaf scald disease;
in step 2), the total volume of the reaction system for carrying out the RPA amplification reaction was 50. Mu.L, and the specific reaction system was 2.4. Mu.L of forward primer RPA-avrRxo1-F1 at a concentration of 10. Mu.M, 2.4. Mu.L of reverse primer RPA-avrRxo1-R1 at a concentration of 10. Mu.M, 29.5. Mu.L of Rehydration buffer, 11.2. Mu.L of ddH 2 O, 2 mu L template DNA, mixing, rapidly placing into PCR reaction tube containing lyophilized enzyme powder, dissolving lyophilized enzyme powder, and adding 2.5 mu L MgOAC, rapidly centrifugate to the bottom of the tube, RPA amplification reaction conditions were: amplifying for 10 min at 39 ℃;
in step 3), the total volume of the system used to perform the CRISPR/Cas12a reaction is 20 μl; the system for performing the CRISPR/Cas12a reaction is a reaction system for performing RPA/Cas12a fluorescence detection, a reaction system for performing RPA/Cas12a visual fluorescence detection, or a reaction system for performing RPA/Cas12a-LFA reaction; the system is specifically selected from any one of the following:
the system for performing RPA/Cas12a fluorescence detection comprises: SF buffer, crRNA, RNase inhibitor, ssDNA-reporter-CY5 or ssDNA-reporter-FAM, lbCAs12a, RPA amplification product and DEPC treated water; the method specifically comprises the following steps: 2. Mu.L of SF buffer (Tris-OAC, mgOAC, BSA and DTT), 1. Mu.L of crRNA (10. Mu.M), 1. Mu.L of RNase inhibitor (40U/. Mu.L), 2. Mu.L of ssDNA-reporter-CY5 (10. Mu.M) or 2. Mu.L of ssDNA-reporter-FAM (10. Mu.M), 1. Mu.L of LbCAs12a (1. Mu.M), 2. Mu.L of RPA amplification product, 11. Mu.L of DEPC treated water, and the reaction was performed in a real-time fluorescent quantitative PCR instrument at 37℃for 1 h;
Alternatively, the system for performing RPA/Cas12a visualization fluorescence detection comprises: SF buffer, crRNA, RNase inhibitor, ssDNA-reporter-FAM-2, lbCAs12a, RPA amplification product and DEPC treated water; the method specifically comprises the following steps: 2. Mu.L of SF buffer (Tris-OAC, mgOAC, BSA and DTT), 1. Mu.L of crRNA (10. Mu.M), 1. Mu.L of RNase inhibitor (40U/. Mu.L), 2. Mu.L of ssDNA-reporter-FAM-2 (10. Mu.M), 1. Mu.L of LbCAs12a (1. Mu.M), 2. Mu.L of RPA amplification product, 11. Mu.L of DEPC treated water; the reaction conditions are as follows: reacting for 5min at 37 ℃, and observing a fluorescence result by a 470 nm blue light gel cutting instrument;
still alternatively, the system for performing an RPA/Cas12a-LFA reaction (i.e., a lateral flow chromatography strip detection reaction) comprises: SF buffer, RNase inhibitor, FB-reporter, lbCas a, RPA amplification product and DEPC treated water; the method specifically comprises the following steps: 2. Mu.L of SF buffer (Tris-OAC, mgOAC, BSA and DTT), 1. Mu.L of crRNA (10. Mu.M), 1. Mu.L of RNase inhibitor (40U/. Mu.L), 2.5. Mu.L of FB-reporter (100 nM), 1. Mu.L of LbCAs12a (1. Mu.M), 2. Mu.L of RPA amplification product, 10.5. Mu.L of DEPC treated water, reacted at 37℃for 20min, and made up to 50. Mu.L with DEPC treated water, mixed well, dropped into the binding pad end of the test strip, and the color of the detection line (T line) and control line (C line) on the test strip was observed.
The detection method for rapidly detecting the rice bacterial leaf spot bacteria is applied to the aspect of rice bacterial leaf spot bacteria detection.
The sequence combination and application for rapidly detecting rice bacterial strip spot bacteria based on CRISPR/Cas12a-RPA have the beneficial effects that:
the invention detects rice bacterial strip spot bacteria by combining an RPA amplification method with a CRISPR/Cas12a detection method, realizes fluorescence detection by RPA/Cas12a fluorescence detection, or realizes visual detection by a blue light gel cutting instrument and a lateral flow chromatography test strip; the detection method is simple and quick, has good specificity and sensitivity, can detect only by simple instruments, does not need expensive instruments and equipment, has the advantage of quick detection, is more beneficial to popularization and application of molecular detection technology of rice bacterial leaf spot in farmlands, and can effectively monitor, prevent and control the rice bacterial leaf spot;
according to the invention, a specific RPA primer is designed by screening specific gene targets, cas12a cutting reaction is carried out after amplification, and the aim of efficiently and visually detecting rice bacterial leaf spot bacteria is achieved by coupling two-stage amplification; the isothermal amplification technology and the CRISPR/Cas12a detection technology are combined, so that the method can be better suitable for the field rapid detection technology of invasive pests such as rice bacterial leaf spot pathogens, and compared with the single isothermal amplification technology, the method can further shorten the detection time, further improve the detection accuracy, and visualize the result, thereby completing more detection samples in a limited time, providing references for taking better prevention and control measures, protecting the local ecological environment and developing agricultural economy, being beneficial to popularization and application of the molecular detection technology of rice bacterial leaf spot pathogens among farmlands, and being capable of effectively monitoring, preventing and controlling the rice bacterial leaf spot pathogens.
Drawings
FIG. 1 is a schematic diagram of a detection operation flow for detecting rice bacterial leaf spot bacteria based on RPA/Cas12 a;
FIG. 2 is a spacer sequence alignment of LbCAs12a-avrRxo1 crRNA sequences of example 1 of the present invention; wherein PAM (protospacer adjacent motif): TTTN, protospace: a spacer sequence;
FIG. 3 is a specific gene of Cas12a fluorescence detection system in example 2 of the present invention against rice bacterial leaf spotavrRxo1A crRNA detection efficiency result graph of the gene; lbCAs12a-avrRxo1 is according toavrRxo1The crRNA, lbCAs12a-avrRxo1-BC, is genetically engineered as ddH 2 O is used as a blank control; the fluorescence ratio is the ratio of the fluorescence intensity detected by the enzyme label instrument at intervals of 5 minutes to the fluorescence intensity detected at intervals of 0 minutes;
FIG. 4 is a graph showing the result of agarose gel electrophoresis of the RPA primer in example 2 of the present invention; m represents DL600;1 represents RPA-avrRxo1-F1/R1;2 represents a negative control of RPA-avrRxo1-F1/R1; 3 represents RPA-avrRxo1-F2/R2;4 represents a negative control of RPA-avrRxo1-F2/R2; 5 represents RPA-avrRxo1-F3/R3;6 represents a negative control of RPA-avrRxo1-F3/R3; negative controls were all ddH 2 O as a control;
FIG. 5 is a graph of the optimized results of RPA/Cas12a reaction time in example 3 of the present invention; wherein, the A graph is an optimized result graph of RPA reaction time; panel B is a graph of optimized results of the reaction time of the visual fluorescence detection of Cas12 a; BC is taken as ddH 2 O served as a blank;
FIG. 6 is the result of a sensitivity analysis of the RPA Cas12a fluorescence detection reaction in example 5 of the present invention; wherein A isavrRxo1Sensitivity analysis result diagram of RPA/Cas12a fluorescence detection reaction of gene, and B diagram isavrRxo1Sensitivity analysis result diagram of PCR detection reaction of gene, C diagram isavrRxo1Sensitivity analysis result diagram of RPA/Cas12a visualized fluorescence detection reaction of gene; 1-9 in panels A, B and C represent respectively: 20 ng/. Mu.L, 10 ng/. Mu.L, 1 ng/. Mu.L, 100 pg/. Mu.L, 10 pg/. Mu.L, 1 pg/. Mu.L, 100 fg/. Mu.L, 10 fg/. Mu.L, 1 fg/. Mu.L of a standard genomic DNA dilution of Pyricularia oryzae, BC representing a blank; error bars represent three measurements of signal strengthStandard error; P<0.0001；/> P<0.001；/> P<0.01；/> P<0.05；
FIG. 7 is the result of a specific assay for the RPA/Cas12a fluorescence detection reaction in example 5 of the present invention; wherein A isavrRxo1Specific analysis result diagram of RPA/Cas12a fluorescence detection reaction of gene, and B diagram isavrRxo1Specific analysis result diagram of the RPA/Cas12a visualized fluorescence detection reaction of the gene; BC in panels A and B is taken as ddH 2 O is a blank;
FIG. 8 is a sample field test result of the fluorescence detection reaction of RPA/Cas12a in example 6 of the present invention; wherein, A is based on 16 field samples avrRxo1A PCR amplification reaction result diagram of the gene; panel B is a graph of the results of visual fluorescence detection of rice bacterial leaf streaks based on RPA/Cas12a for 16 field samples; in the A and B, N is the DNA of healthy leaves as negative control, and P is the DNA of rice bacterial leaf streak germ as positive control;
FIG. 9 is a graph of the result of the RPA/Cas12a-LFA detection reaction in examples 4-6 of the present invention; wherein, the graph A is a preliminary establishment result graph of the LFA detection reaction of the RPA/Cas12a in the embodiment 4 of the invention; FIG. B is a diagram of example 5 of the present inventionavrRxo1Sensitivity analysis result diagram of RPA/Cas12a-LFA detection reaction of gene; 1-9 in the B diagram represent respectively: 20 g/. Mu.L, 10 ng/. Mu.L, 1 ng/. Mu.L, 100 pg/. Mu.L, 10 pg/. Mu.L, 1 pg/. Mu.L, 100 fg/. Mu.L, 10 fg/. Mu.L, 1 fg/. Mu.L of a standard genomic DNA dilution of Pyricularia oryzae, BC representing a blank; FIG. C is the one of embodiment 5 of the present inventionavrRxo1A specific analysis result graph of the RPA/Cas12a-LFA detection reaction of the gene; BC in panel C represents blank control; panel D is a graph of the results of the detection of bacterial leaf spot of rice based on RPA/Cas12a-LFA for 16 field samples in example 6 of the present invention; n in panel D is negative control with healthy leaf DNA; p is the positive control with DNA of rice bacterial leaf spot germ.
Detailed Description
The following description of the technical solution in the embodiments of the present invention is clear and complete. In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention, but the present invention may be practiced in other ways other than those described herein, and persons skilled in the art will readily appreciate that the present invention is not limited to the specific embodiments disclosed below.
In addition, the specific techniques or conditions are not noted in the examples and are carried out according to the techniques or conditions described in the literature in this field or according to the product specifications. The reagents used were not manufacturer-identified and were all conventional commercially available products.
The detection operation flow diagram for detecting rice bacterial leaf spot bacteria based on CRISPR/Cas12a provided by the invention is shown in figure 1: firstly, a suspected sample is collected, crude extraction of DNA is carried out, then a target sequence is amplified through an RPA amplification technology, then a CRISPR/Cas12a reaction is carried out, a ssDNA probe is subjected to nonspecific cleavage, and finally a result is read through a fluorescent quantitative PCR instrument, a test paper strip and a blue light lamp.
Example 1 target conservation analysis and primer design of specific genes
According to the invention, the specific genes of the rice bacterial leaf scald germs are searched on the NCBI website (https:// www.ncbi.nlm.nih.gov /), and the specific genes of the rice bacterial leaf scald germs are screened through homology analysis and BLAST on the NCBI website:avrRxo1and (3) a gene.
The crRNA sequence consists of two parts, namely a direct repeated sequence and a spacer sequence. Will beavrRxo1The gene sequence is targeted on a CRISPOR (http:// crispor.tefor.net /) website, and in order to ensure the high efficiency of the work of the crRNA sequence, a spacing sequence with high score is selected to design the crRNA. The interval sequence is as follows: GCUGCAAAACUCCCACCAAAGAA. To ensure that most regions of pathogenic bacteria can be detected, 15 strains typical of different regions were selected for alignment of spacer sequences by DNAMAN software, the spacer sequences of the individual strains being identical (as shown in FIG. 2). Sending to the biological company to synthesize crRNA sequence: UAAUUUCUACUAAGUGUAGAUGCUGCAAAACUCCCACCAAAGAA (SEQ ID NO: 3). Design by Primer 5.0 softwareavrRxo1RPA and PCR primers for a gene comprising PAM sequences. Specifically designed RPA primers and PCR primers are shown in the following table:
TABLE 1 PCR primer and RPA primer lists designed in this example
Thus, the primer pairs were RPA-avrRxO1-F1/R1, RPA-avrRxO1-F2/R2, and RPA-avrRxO1-F3/R3.
Wherein, RPA-avrRxO1-F1, RPA-avrRxO1-F2 (SEQ ID NO: 1) and RPA-avrRxO1-F3 are forward primers, and RPA-avrRxO1-R1, RPA-avrRxO1-R2 (SEQ ID NO: 2) and RPA-avrRxO1-R3 are reverse primers.
Example 2 validation of crRNA sequence and RPA amplification reaction
S1, method for rapidly extracting DNA of rice bacterial leaf spot germ
Taking a rice bacterial leaf spot sample, shearing a leaf midrib region (about 0.5 cm multiplied by 2 cm) of a leaf to be detected by scissors, shearing into fine fragments, placing into a clean 1.5 mL sterile centrifuge tube, adding 500 mu L of 0.5M NaOH solution, mashing the leaf by a sterilization grinding rod, standing for 1 min at room temperature, and diluting by 50 times by using TE buffer (Tris-EDTA) to obtain the rice bacterial leaf spot germ genome DNA template.
S2, validity verification of crRNA sequence
According toavrRxo1The primers of the genes are respectively designed to synthesize ssDNA probe sequences of rice bacterial leaf spot bacteria detected by a fluorescent quantitative PCR instrument (wherein the ssDNA probe sequences are ssDNA-reporter-FAM:5'-FAM-TTATT-BHQ 1-3'), and target sequences containing PAM sequences are amplified through PCR reaction to obtain PCR amplified products;
The PCR reaction system is as follows: 12.5. Mu.L of Green Master Mix enzyme, 1. Mu.L of each of the corresponding primer pairs (i.e., 1. Mu.L of forward primer and 1. Mu.L of reverse primer) and 1. Mu.L of genome DNA template of rice bacterial Pyricularia, using ddH 2 O was made up to 25. Mu.L.
The PCR reaction program was set as follows: pre-denaturation at 94℃for 3 min; denaturation at 94℃for 30 s, annealing at 58℃for 30 s, extension at 72℃for 45 s for a total of 35 cycles; finally, the mixture is extended for 10 min at 72 ℃ and stored at 4 ℃.
The CRISPR/Cas12a reaction is then performed. Wherein, the reaction system (20 mu L) of CRISPR/Cas12a reaction is as follows: mu.L of 10 XBuffer 2.1, 1. Mu.L of crRNA sequence (10. Mu.M), 1. Mu.L of RNase inhibitor (40U/. Mu.L), 2. Mu.L of ssDNA probe sequence (10. Mu.M), 1. Mu.L of LbCAs12a (1. Mu.M), 2. Mu.L of PCR product, 11. Mu.L of DEPC treated water were reacted on a microplate reader (λex: 485nm; λem: 535 nm), fluorescence values were detected every 5min, reacted for 1h at 37℃and each set of experiments was repeated three times, and mapped using GraphPad Prism 8.
By ddH 2 O asavrRxo1Blank control of crRNA of gene design to ensure that experiments were not contaminated.
The results are shown in FIG. 3, wherein the crRNA of LbCAs12a-avrRxo1 (i.e., based onavrRxo1The crRNA of gene design) can show a peak within about 5min, the fluorescence ratio reaches the highest within about 25 min, and the fluorescence ratio is about 5 at the highest, which indicates that the crRNA has activity. Thus, the first and second substrates are bonded together, Can be used in subsequent CRISPR/Cas12a experiments.
In FIG. 3, only the primer pair (RPA-avrRxo 1-F2/R2) with higher detection efficiency is selected for mapping; lbCAs12a-avrRxo1 represents a detection using RPA-avrRxo1-F2/R2 as a primer pairavrRxo1Efficiency results of the genes; lbCAs12a-avrRxo1-BC representingavrRxo1Efficiency results of the gene control.
S3, RPA amplification reaction
Taking the genome DNA template of the rice bacterial leaf spot germ obtained in the step S1 as an RPA template directly, and carrying out RPA amplification reaction by adopting each primer pair obtained in the embodiment 1 respectively to obtain corresponding RPA amplification products;
wherein, the RPA amplification reaction process is as follows:
the total volume of the RPA amplification reaction system is 50 mu L, and the reaction system is: 2.4 mu.L of forward primer (10. Mu.M), 2.4. Mu.L of reverse primer (10. Mu.M), 29.5. Mu. L Rehydration Buffer, 11.2. Mu.L of ddH 2 O, 2 mu L of rice bacterial leaf spot germ genome DNA template, mixing uniformly, rapidly putting into a PCR reaction tube containing enzyme dry powder, adding 2.5 mu L of MgOAC on a tube cover after dissolving the enzyme dry powder, and rapidly centrifuging to the tube bottom, wherein the reaction conditions are as follows: the reaction was carried out at 39℃for 20 min.
After the RPA amplification reaction is finished, 5 mu L of RPA amplification product and 1 mu L of 6×loading buffer are evenly mixed, added into a sample adding hole, 2% agarose gel is used, the voltage is set to 120V, the agarose gel is taken out after electrophoresis for 30min, and the result of the agarose gel electrophoresis experiment measurement is obtained after the RPA-avrRxo1-F1/R1, RPA-avrRxo1-F2/R2, RPA-avrRxo1-F3/R3 and the corresponding negative control amplification are photographed and stored in a gel electrophoresis imaging system. As shown in FIG. 4, only when the reaction was performed using the RPA-avrRxo1-F2/R2 primer, rice bacterial leaf streak bacteria could be specifically detected, the target product was 290 bp, and the negative control did not produce any impurity band. The corresponding negative controls of RPA-avrRxo1-F1/R1 and RPA-avrRxo1-F3/R3 all generate a hetero-band, which proves that the specificity of the two pairs of primers is poor. Thus, the primer pair RPA-avrRxo1-F2/R2 was selected for subsequent experiments.
Wherein the figureIn 4, M represents DL600;1 represents RPA-avrRxo1-F1/R1;2 represents a negative control of RPA-avrRxo1-F1/R1; 3 represents RPA-avrRxo1-F2/R2;4 represents a negative control of RPA-avrRxo1-F2/R2; 5 represents RPA-avrRxo1-F3/R3;6 represents a negative control of RPA-avrRxo1-F3/R3; negative controls were all ddH 2 O served as a control to ensure that the experiment was not contaminated.
Example 3 optimization of the reaction time for RPA/Cas12a fluorescence detection
1. Optimization of RPA reaction time
In the RPA amplification reaction process, the method in the step S3 of example 2 is adopted, the temperature is kept at 39 ℃, and the RPA amplification reaction time is respectively adjusted to 5min, 10 min, 15min and 20min, so that RPA amplification products with different reaction times are obtained.
And adding RPA amplification products with different reaction times into a CRISPR/Cas12a reaction system to perform a cleavage reaction.
Wherein, the CRISPR/Cas12a reaction system is: 2. Mu.L of SF buffer (Tris-OAC, mgOAC, BSA and DTT), 1. Mu.L of crRNA (10. Mu.M), 1. Mu.L of RNase inhibitor (40U/. Mu.L), 2. Mu.L of ssDNA-reporter-CY5 (10. Mu.M, ssDNA-reporter-CY 5: 5'-CY5-TGTCTTATcccccATAAGACA-BHQ 1-3'), 1. Mu.L of LbCAs12a (1. Mu.M), 2. Mu.L of RPA amplification product, 11. Mu.L of DEPC treated water were reacted in a real-time fluorescent quantitative PCR instrument at 37℃for 1 hour.
The results are shown in panel a of fig. 5, which can cause CRISPR/Cas12a detection reaction when RPA is reacted for 5 min; when the RPA reaction is about 10min, the fluorescence signal intensity of the Cas12a reaction can almost reach the maximum value, namely, the RPA reaction is more than 10min, the maximum signal intensity value of the real-time fluorescence detection is not greatly changed. Therefore, in order to improve the detection efficiency, the RPA reaction time is not required to be prolonged any more, and the RPA reaction time is set to be 10min in the subsequent experiment.
2. Optimization of Cas12a reaction time
And adding an RPA amplification product obtained when the RPA is used for reacting for 10min into a CRISPR/Cas12a reaction system, keeping the temperature of 37 ℃ unchanged in the incubation time, and setting the cutting reaction time of the Cas12a to be 5min, 10min, 15 min and 20 min respectively.
Wherein, the CRISPR/Cas12a reaction system is: 2. Mu.L of SF buffer (Tris-OAC, mgOAC, BSA and DTT), 1. Mu.L of crRNA (10. Mu.M), 1. Mu.L of RNase inhibitor (40U/. Mu.L), 2. Mu.L of ssDNA-reporter-FAM-2 (10. Mu.M, ssDNA-reporter-FAM-2: 5'-FAM-TGTCTTATcccccATAAGACA-BHQ 1-3'), 1. Mu.L of LbCAs12a (1. Mu.M), 2. Mu.L of RPA amplification product, 11. Mu.L of DEPC treated water. Fluorescence results were observed by a blue light cut gum machine (470 nm). As shown in panel B of fig. 5, almost saturated fluorescence can be achieved when the Cas12a cleavage reaction is 5 min. Therefore, if the Cas12a cleavage reaction result is observed with naked eyes later, the Cas12a reaction time can be set to 5 min.
Finally, combining the optimized CRISPR/Cas12a reaction system with the optimized RPA system to establish an optimal RPA/Cas12a reaction system.
Example 4 establishment of a method for Rapid detection of Rice bacterial Gray leaf curl based on CRISPR/Cas12a-RPA
1) Collecting a rice bacterial leaf spot germ sample, shearing a leaf midrib region (about 0.5cm multiplied by 2 cm) of a leaf to be detected by scissors, shearing into fine fragments, placing into a clean 1.5mL sterile centrifuge tube, adding 500 mu L of 0.5mol/L NaOH solution, mashing the leaf by a sterilization grinding rod, standing for 1min at room temperature, diluting by 50 times by using a TE buffer (Tris-EDTA), and obtaining the rice bacterial leaf spot germ genome DNA template which is directly used as an RPA template. And with ddH 2 O served as a blank.
2) Taking an RPA template and adopting a primer pair RPA-avrRxO1-F2/R2 to carry out RPA amplification reaction;
wherein, the RPA amplification reaction process is as follows:
the total volume of the RPA reaction system was 50. Mu.L, and the reaction system was: 2.4. Mu.L of RPA-avrRxO1-F2 (10. Mu.M), 2.4. Mu.L of RPA-avrRxO1-R2 (10. Mu.M), 29.5. Mu.L of Rehydration Buffer, 11.2. Mu.L of ddH 2 O, 2 mu L of rice bacterial leaf spot germ genome DNA template, mixing uniformly, rapidly putting into a PCR reaction tube containing enzyme dry powder, adding 2.5 mu L of MgOAC on a tube cover after dissolving the enzyme dry powder, and rapidly centrifuging to the tube bottom, wherein the reaction conditions are as follows: and reacting at 39 ℃ for 10min to obtain an RPA amplification product.
3) Three different detection methods
A. First detection method-RPA/Cas 12a fluorescence detection
The ssDNA probe sequence ssDNA-reporter-CY5 of the rice bacterial strip pathogenic bacteria for fluorescence detection is designed and synthesized according to the primer pair RPA-avrRxo1-F2/R2, and specifically comprises the following steps: 5'-CY5-TGTCTTATcccccATAAGACA-BHQ1-3';
and taking the RPA amplification product for RPA/Cas12a fluorescence detection.
The total volume of the reaction system for RPA/Cas12a fluorescence detection is 20 μL, and the reaction system is: 2 mu L of SF buffer (Tris-OAC, mgOAC, BSA and DTT), 1 mu L of crRNA (10 mu M), 1 mu L of RNase inhibitor (40U/mu L), 2 mu L of ssDNA-reporter-CY5 (10 mu M), 1 mu L of LbCAs12a (1 mu M), 2 mu L of RPA amplification product and 11 mu L of DEPC treated water are placed on a fluorescence quantitative PCR instrument for reaction, the procedure is set to 65 ℃ for 1h, and fluorescence is collected once every 1min in the reaction process, so that a fluorescence detection result of rice bacterial leaf spot bacteria is obtained.
Alternatively, 2. Mu.L of ssDNA-reporter-FAM (10. Mu.M) can be used for carrying out RPA/Cas12a fluorescence detection instead of 2. Mu.L of ssDNA-reporter-CY5 (10. Mu.M), and other technological processes and parameters are completely consistent; wherein ssDNA-reporter-FAM is: 5'-FAM-TTATT-BHQ1-3'.
B. Second detection method-RPA/Cas 12a visual fluorescence detection
According to the design of a primer pair RPA-avrRxo1-F2/R2, a ssDNA probe sequence ssDNA-reporter-FAM-2 of rice bacterial strip spot bacteria for visual fluorescence detection is synthesized, specifically: 5'-FAM-TGTCTTATcccccATAAGACA-BHQ1-3';
and taking the RPA amplification product for RPA/Cas12a visual fluorescence detection.
The total volume of the reaction system for the RPA/Cas12a visual fluorescence detection is 20 μl, and the reaction system is: 2 mu L of SF buffer (Tris-OAC, mgOAC, BSA and DTT), 1 mu L of crRNA (10 mu M), 1 mu L of RNase inhibitor (40U/. Mu.L), 2 mu L of ssDNA-reporter-FAM-2 (10 mu M), 1 mu L of LbCAs12a (1 mu M), 2 mu L of RPA amplification product and 11 mu L of DEPC treated water are reacted for 5min at 37 ℃, and after the reaction is finished, the visualized fluorescence detection result of rice bacterial strip spot bacteria is obtained by observing the mixture by using a blue light gel cutting instrument.
C. The third detection method, RPA/Cas12a-LFA detection reaction (i.e. lateral flow chromatography test strip detection)
According to the primer pair RPA-avrRxo1-F2/R2, a ssDNA probe sequence FB-reporter for detecting rice bacterial strip spot bacteria by a lateral flow chromatography test strip is designed and synthesized, and specifically comprises the following steps: 5'-FAM-TTTTTTTTT-Biotin-3';
And taking the RPA amplification product to perform an RPA/Cas12a-LFA detection reaction (namely, a lateral flow chromatography test strip detection).
The total volume of the reaction system for the detection of the lateral flow chromatography test strip is 20 mu L, and the reaction system is as follows: 2. Mu.L of SF buffer (Tris-OAC, mgOAC, BSA and DTT), 1. Mu.L of crRNA (10. Mu.M), 1. Mu.L of RNase inhibitor (40U/. Mu.L), 2.5. Mu.L of FB-reporter (100 nm), 1. Mu.L of LbCAs12a (1. Mu.M), 2. Mu.L of RPA amplification product, 10.5. Mu.L of DEPC treated water, after the reaction is completed, the DEPC treated water is made up to 50. Mu.L, the obtained product is dropped into the test strip binding pad end, and whether or not a red band appears at the control line can be observed, as shown in A diagram in FIG. 9, the left side is a sample detection result, the right side is a blank control, no red band is observed at the control line in the sample detection result in this example, and the detection result is that the sample is rice bacterial strip pathogenic bacteria.
Example 5 sensitivity and specificity analysis of detection methods for RPA/Cas12a
1. Extraction of DNA: genomic DNA of rice bacterial Pyricularia was extracted with the Guangzhou Meiger Biotechnology Co.Ltd HiPure Bacterial DNA Kit bacterial genomic DNA extraction kit.
The method comprises the following steps:
(1) Taking 2mL of rice bacterial leaf spot bacteria liquid cultured overnight in an oscillating way, transferring the rice bacterial leaf spot bacteria liquid into a 2mL sterile centrifuge tube, centrifuging the rice bacterial leaf spot bacteria liquid at 10000r/min for 1min to collect bacteria, and pouring out the residual culture medium as much as possible.
(2) 220. Mu.L of Buffer STE Plus, 10. Mu.L of RNaseA and 30. Mu.L of Lysozyme are added to the precipitated bacteria, the bacteria are thoroughly resuspended by vortexing, and left standing at room temperature for 10-15 min, then 10. Mu.L of protease K and 250. Mu.L of Buffer DL are added to the resulting bacterial resuspension, the mixture is vortexed, and water-bath at 70 ℃ for 10 min.
(3) Adding 250 μl of absolute ethanol into the lysate, and mixing with vortex for 15s, if flocculent precipitate appears, sucking with a pipette for several times to break up the precipitate as much as possible to obtain mixed solution (including precipitate).
(4) HiPure DNA Mini Columnl is put into a 2mL collecting pipe, and then the mixed solution (including sediment) obtained in the step (3) is transferred into a column (namely a DNA binding column), and is centrifuged for 1min at 10000 r/min; if the column is blocked, the centrifugation speed is increased to 13000 r/min, and the column is centrifuged for 3 min.
(5) The effluent was discarded, the column was packed in a recovery header, 500. Mu.L of Buffer GW1 (diluted with ethanol) was added to the column, and the column was centrifuged at 10000r/min for 1 min.
(6) The filtrate was discarded, the column was packed in a recovery header, 650. Mu.L Buffer GW2 (diluted with ethanol) was added to the column, and the column was centrifuged at 10000 r/min for 1 min.
(7) Pouring out the effluent, loading the column into a recovery header, centrifuging for 2 min at 10000 r/min, loading the column into a new 1.5mL sterile centrifuge tube, adding 30-100 mu L of Buffer AE preheated to 70 ℃ to the center of the column membrane, standing for 3min, and centrifuging for 1 min at 10000 r/min.
(8) The DNA binding column was discarded. The concentration and quality of the extracted standard genome DNA of the rice bacterial leaf spot germ are measured by an ultra-micro spectrophotometer.
2. Sensitivity analysis of detection methods for RPA/Cas12a
Standard genomic DNA of Pyricularia oryzae was diluted to 20 ng/. Mu.L, 10 ng/. Mu.L, 1 ng/. Mu.L, 100 pg/. Mu.L, 10 pg/. Mu.L, 1 pg/. Mu.L, 100 fg/. Mu.L, 10 fg/. Mu.L, 1 fg/. Mu.L and expressed as ddH 2 O is used as a blank control, and the RPA/Cas12a fluorescence detection reaction, the RPA/Cas12a visual fluorescence detection reaction and the RPA/Cas12a-LFA detection reaction are respectively carried out according to the method in the embodiment 4, so that the sensitivity evaluation is realized, and the test is repeated for 3 times. PCR experiments were also performed using the avrRxo1-F/R primers, and the sensitivity differences between the two were compared.
The results are shown in FIG. 6 and FIG. 9, where A in FIG. 6 is avrRxo1Sensitivity analysis result diagram of RPA/Cas12a fluorescence detection reaction of gene, and B diagram isavrRxo1Sensitivity analysis result diagram of PCR detection reaction of gene, C diagram isavrRxo1Sensitivity analysis result diagram of RPA/Cas12a visualized fluorescence detection reaction of gene; FIG. 9, panel B, isavrRxo1Sensitivity analysis result diagram of RPA/Cas12a-LFA detection reaction of gene; fig. 6, a, B, and C, and fig. 9, 1-9 in B, respectively, represent: a standard genomic DNA dilution of 20 g/. Mu.L, 10 ng/. Mu.L, 1 ng/. Mu.L, 100 pg/. Mu.L, 10 pg/. Mu.L, 1 pg/. Mu.L, 100 fg/. Mu.L, 10 fg/. Mu.L, 1 fg/. Mu.L of Pyricularia oryzae and BC represents a blank. Error bars represent standard errors of the signal strength of the three measurements; P<0.0001；/> P<0.001；/> P<0.01；/>P<0.05。
as can be seen from the results of the fluorescent quantitative PCR apparatus shown in the graphs B of FIGS. 6 and 9, the lower limit of detection of rice bacterial leaf spot by the RPA/Cas12a fluorescent detection reaction is 10 fg/. Mu.L, while the sensitivity of the PCR amplification reaction is only 1 pg/. Mu.L, and the sensitivity of the RPA/Cas12a fluorescent detection reaction is 100 times higher than that of the PCR reaction; the observation result of the blue light gel cutting instrument shows that the lower limit of the detection of the rice bacterial strip spot germ by the RPA/Cas12a visual fluorescence detection reaction is 1 fg/mu L, which is 1000 times higher than the PCR sensitivity; the lower limit of the detection of the rice bacterial leaf spot germ by the RPA/Cas12a-LFA is 1 pg/mu L, which is consistent with the sensitivity of the PCR reaction.
The sensitivity of the RPA/Cas12a detection method of the invention is obviously better than or equal to that of PCR reaction.
3. Specific analysis of detection methods for RPA/Cas12a
Bacterial suspensions (OD) using other closely related strains of the genus Xanthomonas 600 =0.8) (see table 2 for strain details) and using suspensions of these strains as templates for RPA amplification with ddH 2 O is a blank control, and as an experimental strain, standard genomic DNA (abbreviated as Xoc) of rice bacterial leaf spot bacteria was used to evaluate the specificity by performing an RPA/Cas12a fluorescence detection reaction, an RPA/Cas12a visual fluorescence detection reaction and an RPA/Cas12a-LFA detection reaction, respectively, as in example 4.
The results are shown in FIG. 7 and FIG. 9, where A in FIG. 7 isavrRxo1Specific analysis result diagram of RPA/Cas12a fluorescence detection reaction of gene, and B diagram isavrRxo1Specific analysis result diagram of the RPA/Cas12a visualized fluorescence detection reaction of the gene; FIG. 9, panel C, isavrRxo1A specific analysis result graph of the RPA/Cas12a-LFA detection reaction of the gene; BC in panels A and B of FIG. 7 and C of FIG. 9 represents a blank control, and the Xoo strain is the standard genomic DNA of bacterial leaf blight of rice isolated in a bulkhead laboratory.
As can be seen from the graph A of FIG. 7, when the bacterial strain of rice bacterial leaf spot is specifically detected by a fluorescence quantitative PCR instrument, a remarkable fluorescent signal is generated, and the near-edge strain has weak signal intensity and is relatively close to that of a blank control. As can be seen from fig. 7B, when the observation result is visualized by the blue light gel cutting instrument, only the rice bacterial strip spot bacteria can observe significant macroscopic fluorescence, and neither the near-edge strain nor the blank can generate macroscopic fluorescence. As can be seen from panel C of FIG. 9, when viewed through the test strip, only the rice bacterial strain of Pyricularia oryzae had no red band at the test line, and both the near strain and the blank had red bands at the control line. Therefore, the fluorescence detection reaction of the RPA/Cas12a and the detection reaction of the lateral flow test strip have stronger specificity.
Table 2 list of related strains of the genus Xanthomonas used in the specificity analysis
Example 6 field sample testing
16 samples with suspected symptoms are collected from different paddy fields around three-city, hainan province, surface disinfection and DNA crude extraction are respectively carried out on the collected leaves, RPA/Cas12a visual fluorescence detection and test strip analysis are respectively carried out according to the method in the example 4, and PCR amplification experiments and comparative verification are carried out by using avrRxo1-F/R primers.
The results are shown in FIG. 8 and FIG. 9, panel A in FIG. 8 being based on 16 field samplesavrRxo1A PCR amplification reaction result diagram of the gene; panel B is a graph of the results of visual fluorescence detection of rice bacterial leaf streaks based on RPA/Cas12a for 16 field samples; panel D of FIG. 9 is a graph of the results of 16 field samples based on RPA/Cas12a-LFA detection of rice bacterial leaf streak; n in panels A and B of FIG. 8 and D of FIG. 9 is negative control with healthy leaf DNA; p is the positive control with DNA of rice bacterial leaf spot germ.
As can be seen from FIG. 8A, 5 samples (samples No. 3, 6, 7, 10 and 13) showed positive amplification of rice bacterial leaf streak bacteria, and the remaining samples were all negative. As can be seen from the A diagram of FIG. 8 and the D diagram of FIG. 9, the RPA/Cas12a fluorescence detection visualizes the detection reaction and the RPA/Cas12a-LFA detection reaction, and the 16 sample detection results are compared withavrRxo1Gene PCR detection result protectionAnd remain completely consistent.
Other parts not described in detail are prior art. Although the foregoing embodiments have been described in some, but not all, embodiments of the invention, those skilled in the art may, in light of the present disclosure, obtain additional embodiments without undue experimentation, and are within the scope of the invention.

Claims (9)

1. A sequence combination for rapid detection of rice bacterial leaf spot bacteria (Xanthomonas pv. Oryzicola) based on CRISPR/Cas12a-RPA, comprising the following stepsavrRxo1The gene is designed into an RPA primer pair sequence, a crRNA sequence and a ssDNA probe sequence;
wherein, the RPA primer pair sequence is:
the sequence of the forward primer RPA-avrRxo1-F2 is shown as SEQ ID NO:1 is shown in the specification;
the sequence of the reverse primer RPA-avrRxo1-R2 is shown as SEQ ID NO:2 is shown in the figure;
the crRNA sequence is shown as SEQ ID NO:3 is shown in the figure;
the ssDNA probe sequence is a ssDNA probe sequence for fluorescent quantitative PCR detection of rice bacterial leaf spot bacteria, a ssDNA probe sequence for visual fluorescent detection of rice bacterial leaf spot bacteria or a ssDNA probe sequence for lateral flow chromatography test strip detection of rice bacterial leaf spot bacteria;
the ssDNA probe sequence for the fluorescent quantitative PCR detection of the rice bacterial leaf spot germ is ssDNA-reporter-FAM or ssDNA-reporter-CY5;
wherein ssDNA-reporter-FAM is: 5'-FAM-TTATT-BHQ1-3';
ssDNA-reporter-CY5 is: 5'-CY5-TGTCTTATcccccATAAGACA-BHQ1-3';
the ssDNA probe sequence for the visual fluorescence detection of the rice bacterial leaf spot germ is ssDNA-reporter-FAM-2, and the sequence is as follows: 5'-FAM-TGTCTTATcccccATAAGACA-BHQ1-3';
The ssDNA probe sequence for detecting the rice bacterial leaf spot by the lateral flow chromatography test strip is FB-reporter, and the sequence is: 5 '-FAM-TTTTTTTTTTT-Biotin-3'.
2. A test kit for rapid detection of rice bacterial leaf streak bacteria, comprising the RPA primer pair sequence, crRNA sequence and ssDNA probe sequence of claim 1.
3. The kit for rapid detection of rice bacterial leaf spot according to claim 2, wherein the kit further comprises Rehydration Buffer, mgOAC, dry enzyme powder, lbCAs12a enzyme and ddH 2 O；
The enzyme dry powder is used for RPA reaction.
4. A test kit for rapid detection of rice bacterial leaf spot according to claim 2 or 3, characterized in that the kit comprises a reaction system for performing RPA amplification reaction and a system for performing CRISPR/Cas12a reaction.
5. The kit for rapid detection of rice bacterial leaf spot according to claim 4, wherein the total volume of the reaction system for performing the RPA amplification reaction is 50. Mu.L, the reaction system comprising: forward primer RPA-avrRxo1-F1, reverse primer RPA-avrRxo1-R1, rehydration buffer, ddH 2 O and template DNA are mixed evenly and then are rapidly put into a PCR reaction tube containing freeze-dried enzyme powder, and MgOAC is added after the freeze-dried enzyme powder is dissolved;
the total volume of the system used to perform the CRISPR/Cas12a reaction was 20 μl:
the system comprises: SF buffer, crRNA, RNase inhibitor, ssDNA-reporter-CY5 or ssDNA-reporter-FAM, lbCAs12a, RPA amplification product and DEPC treated water;
alternatively, the system comprises: SF buffer, crRNA, RNase inhibitor, ssDNA-reporter-FAM-2, lbCAs12a, RPA amplification product and DEPC treated water;
alternatively, the system comprises: SF buffer, RNase inhibitor, FB-reporter, lbCas a, RPA amplification product and DEPC treated water.
6. Use of a detection kit for rapidly detecting rice bacterial leaf spot pathogens according to any one of claims 2-5 in detecting rice bacterial leaf spot pathogens in the field.
7. The detection method for rapidly detecting the rice bacterial strip spot bacteria is characterized by comprising the following steps of:
1) Extracting genome DNA of a suspected rice bacterial leaf spot pathogen sample;
2) Performing an RPA amplification reaction using the detection kit of any one of claims 2 to 5 with genomic DNA as a template DNA to obtain an RPA amplification product;
3) Using the detection kit of any one of claims 2-5, taking RPA amplification products for CRISPR/Cas12a reaction for fluorescence detection or lateral flow chromatography strip detection.
8. The method for rapidly detecting rice bacterial strip spot according to claim 7, wherein,
in the step 1), the method for extracting the genome DNA of the rice bacterial leaf scald disease suspected sample comprises the steps of taking the rice bacterial leaf scald disease suspected sample, shearing, adding NaOH solution, mashing, standing at room temperature, and diluting by using TE Buffer to obtain the genome DNA of the rice bacterial leaf scald disease suspected sample;
in step 2), the total volume of the reaction system for performing the RPA amplification reaction was 50. Mu.L, and the reaction system includes: forward primer RPA-avrRxo1-F1, reverse primer RPA-avrRxo1-R1, rehydration buffer, ddH 2 O and template DNA are mixed evenly and then are rapidly put into a PCR reaction tube containing freeze-dried enzyme powder, after the freeze-dried enzyme powder is dissolved, mgOAC is added finally, and the mixture is rapidly centrifuged to the bottom of the tube, and the RPA amplification reaction conditions are as follows: amplifying for 10 min at 39 ℃;
in step 3), the total volume of the system used to perform the CRISPR/Cas12a reaction is 20 μl:
the system comprises: SF buffer solution, crRNA, RNase inhibitor, ssDNA-reporter-CY5 or ssDNA-reporter-FAM, lbCAs12a, RPA amplification product and DEPC treated water, reacting for 1h at 37 ℃, and detecting by using a real-time fluorescence quantitative PCR instrument;
Alternatively, the system comprises: SF buffer, crRNA, RNase inhibitor, ssDNA-reporter-FAM-2, lbCAs12a, RPA amplification product and DEPC treated water under the following reaction conditions: reacting for 5min at 37 ℃, and observing a fluorescence result by a 470 nm blue light gel cutting instrument;
alternatively, the system comprises: SF buffer solution, RNase inhibitor, FB-reporter, lbCas a, RPA amplification product and DEPC treated water are reacted for 20min at 37 ℃, the DEPC treated water is used for supplementing to 50 mu L, and the mixture is uniformly mixed and detected by using a test strip.
9. The use of a detection method for rapidly detecting rice bacterial leaf spot according to claim 7 or 8 in rice bacterial leaf spot detection.
CN202410014372.3A 2024-01-05 2024-01-05 Sequence combination for rapidly detecting rice bacterial leaf spot bacteria based on CRISPR/Cas12a-RPA and application Active CN117535436B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202410014372.3A CN117535436B (en) 2024-01-05 2024-01-05 Sequence combination for rapidly detecting rice bacterial leaf spot bacteria based on CRISPR/Cas12a-RPA and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202410014372.3A CN117535436B (en) 2024-01-05 2024-01-05 Sequence combination for rapidly detecting rice bacterial leaf spot bacteria based on CRISPR/Cas12a-RPA and application

Publications (2)

Publication Number Publication Date
CN117535436A CN117535436A (en) 2024-02-09
CN117535436B true CN117535436B (en) 2024-04-16

Family

ID=89792276

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202410014372.3A Active CN117535436B (en) 2024-01-05 2024-01-05 Sequence combination for rapidly detecting rice bacterial leaf spot bacteria based on CRISPR/Cas12a-RPA and application

Country Status (1)

Country Link
CN (1) CN117535436B (en)

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000009698A2 (en) * 1998-08-14 2000-02-24 Kansas State University Research Foundation Compounds useful to affect resistance in plants and methods related thereto
CN102978215A (en) * 2012-12-06 2013-03-20 山东农业大学 Paddy bacterial leaf streak resistance-related gene OsDRxoc6
CN103882034A (en) * 2014-03-10 2014-06-25 张燕 Family gene jva2 of rice bacterial blight bacteria avrBs3/pthA
CN104862404A (en) * 2015-06-02 2015-08-26 云南农业大学 Multiple PCR (Polymerase Chain Reaction) detection kit, special primer and multiple PCR detection method for two kinds of seed-borne diseases on rice
CN105018486A (en) * 2015-08-05 2015-11-04 江西师范大学 HDA kit for detecting bacterial leaf streak pathogens of rice and detecting method
CN107338313A (en) * 2017-08-09 2017-11-10 安徽出入境检验检疫局检验检疫技术中心 A kind of method and kit that xanthomonas oryzae pv. oryzicola is detected using digital pcr
CN113151522A (en) * 2021-04-27 2021-07-23 中国检验检疫科学研究院 LFD-RPA technology-based rice bacterial leaf streak germ detection kit, primer probe composition and application thereof
CN113186315A (en) * 2021-05-20 2021-07-30 上海市农业技术推广服务中心 Primer pair and detection method for detecting bacterial leaf streak germs of rice
CN116656850A (en) * 2023-07-27 2023-08-29 中国热带农业科学院三亚研究院 Sequence combination for rapidly detecting rice bacterial leaf blight bacteria based on CRISPR/Cas12a-RPA and application thereof

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000009698A2 (en) * 1998-08-14 2000-02-24 Kansas State University Research Foundation Compounds useful to affect resistance in plants and methods related thereto
CN102978215A (en) * 2012-12-06 2013-03-20 山东农业大学 Paddy bacterial leaf streak resistance-related gene OsDRxoc6
CN103882034A (en) * 2014-03-10 2014-06-25 张燕 Family gene jva2 of rice bacterial blight bacteria avrBs3/pthA
CN104862404A (en) * 2015-06-02 2015-08-26 云南农业大学 Multiple PCR (Polymerase Chain Reaction) detection kit, special primer and multiple PCR detection method for two kinds of seed-borne diseases on rice
CN105018486A (en) * 2015-08-05 2015-11-04 江西师范大学 HDA kit for detecting bacterial leaf streak pathogens of rice and detecting method
CN107338313A (en) * 2017-08-09 2017-11-10 安徽出入境检验检疫局检验检疫技术中心 A kind of method and kit that xanthomonas oryzae pv. oryzicola is detected using digital pcr
CN113151522A (en) * 2021-04-27 2021-07-23 中国检验检疫科学研究院 LFD-RPA technology-based rice bacterial leaf streak germ detection kit, primer probe composition and application thereof
CN113186315A (en) * 2021-05-20 2021-07-30 上海市农业技术推广服务中心 Primer pair and detection method for detecting bacterial leaf streak germs of rice
CN116656850A (en) * 2023-07-27 2023-08-29 中国热带农业科学院三亚研究院 Sequence combination for rapidly detecting rice bacterial leaf blight bacteria based on CRISPR/Cas12a-RPA and application thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
RPA-Assisted Cas12a System for Detecting Pathogenic Xanthomonas oryzae, a Causative Agent for Bacterial Leaf Blight Disease in Rice;KittisakBuddhachat 等;Rice Science;20220731;第29卷(第4期);摘要、第341页右栏第1段一第350页右栏第3段、图1 *
水稻细菌性条斑病菌和白叶枯病菌的多重PCR检测体系开发;岳凯等;云南农业大学学报(自然科学);20160920;第31卷(第5期);773-778 *

Also Published As

Publication number Publication date
CN117535436A (en) 2024-02-09

Similar Documents

Publication Publication Date Title
Zhang et al. Evaluation of CRISPR/Cas12a-based DNA detection for fast pathogen diagnosis and GMO test in rice
Böhm et al. Real‐time quantitative PCR: DNA determination in isolated spores of the mycorrhizal fungus Glomus mosseae and monitoring of Phytophthora infestans and Phytophthora citricola in their respective host plants
Zhu et al. PAM-free loop-mediated isothermal amplification coupled with CRISPR/Cas12a cleavage (Cas-PfLAMP) for rapid detection of rice pathogens
CN116656850B (en) Sequence combination for rapidly detecting rice bacterial leaf blight bacteria based on CRISPR/Cas12a-RPA and application thereof
CN113249499B (en) Salmonella typhi detection kit, and preparation method and application thereof
CN113584167B (en) CrRNA, isothermal amplification primer and kit for detecting FLT3-F691L mutation
CN108220474A (en) A kind of LAMP detection primer of Fusarium graminearum and its application
CN108676910A (en) A kind of LAMP detection primer of fusarium prolifertum and its application
CN114196766B (en) Molecular marker, primer pair, kit and method for specifically identifying rice ralstonia solanacearum Xoo
Sarkes et al. Detection of Xanthomonas translucens pv. undulosa, pv. translucens, and pv. secalis by quantitative PCR
CN116064906A (en) Primer group for synchronously detecting multiple soybean quarantine pathogens and detection method thereof
Buddhachat et al. RPA-assisted Cas12a system for detecting pathogenic Xanthomonas oryzae, a causative agent for bacterial leaf blight disease in rice
CN115747353A (en) Primer group, reagent, kit and detection method for detecting Listeria monocytogenes
CN117089631A (en) Sequence combination for rapidly detecting solenopsis invicta based on CRISPR/Cas12a-RPA and application thereof
CN117535436B (en) Sequence combination for rapidly detecting rice bacterial leaf spot bacteria based on CRISPR/Cas12a-RPA and application
CN114277166B (en) RPA detection primer, probe and detection method for melon bacterial fruit blotch
CN117448470B (en) Sequence combination for rapidly co-detecting rice bacterial leaf blight bacteria and bacterial strip spot bacteria and application thereof
CN116121408A (en) Site visualization kit for detecting listeria monocytogenes based on CRISPR/Cas12a and application
CN115992273A (en) Nucleic acid molecule, kit and detection method for detecting streptococcus pneumoniae
CN116064905A (en) Primer combination for detecting verticillium dahliae, kit and application
CN112176080B (en) Nested PCR primer group, kit and detection method for specifically detecting purple sisal leaf roll disease phytoplasma
Zhang et al. CRISPR-Cas12a-based DNA detection for fast pathogen diagnosis and GMO test in plants
CN112359133A (en) RPA primer group, kit and rapid detection method for detecting candida auricula
CN114107526B (en) RPA primer pair and crRNA for detecting acidophilic bacteria of watermelons, kit and use method thereof
CN104164486B (en) The LAMP detection kit of the shrivelled pathogen of a kind of Eucalyptus and using method thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant