CN103882034A

CN103882034A - Family gene jva2 of rice bacterial blight bacteria avrBs3/pthA

Info

Publication number: CN103882034A
Application number: CN201410083579.2A
Authority: CN
Inventors: 张燕; 夏更寿
Original assignee: Individual
Current assignee: Haining Qianjiang Xingye Investment Development Co ltd
Priority date: 2014-03-10
Filing date: 2014-03-10
Publication date: 2014-06-25
Anticipated expiration: 2034-03-10
Also published as: CN103882034B

Abstract

The invention discloses a family gene jva2 of rice bacterial blight bacteria avrBs3/pthA. The family gene jva2 is one avrBs3/pthA family member gene in Xoo Japanese jordanon JXOV bacterial strain and solves the problem of insufficient understanding of the avrBs3/pthA family member gene in the JXOV. The facts that the jva2 contains 13.5 middle repetitive units, the seventh and eighth repetitive units in the jva2 are totally the same and a clear and specific example of evolution of the avrBs3/pthA family member gene is provided are found. In the jva2 gene provided by the invention, the protein of prokaryotic expression is not subjected to dimerisation, no influence is caused to the pathogenicity of the Xoo bacterial strain PXO99A, and jva2 gene is used for finding out corresponding anti-disease genes in the rice so as to prevent and treat the bacterial blight.

Description

A kind of rice leaf spot bacteria avrBs3/pthA family gene jva2

Technical field

The present invention relates to gene clone, gene expression technique field in biotechnology, be specifically related to a kind of rice leaf spot bacteria avrBs3/pthA family gene jva2.

Background technology

Paddy rice (Oryzasativa) is worldwide important food crop ^[1], be also the biological model plant of cereal ^[2,3].Bacterial blight of rice (Bacterialblightofrice) is one of paddy rice three large diseases, and its pathogen is rice Xanthomonas Xanthomonasoryzaepv.oryzae(Xoo), Xoo has a lot of different microspecies, and the Xoo microspecies of having reported have more than 30 ^[4].

The bacterium belonging to other yellow unit cell is the same, and rice leaf spot bacteria Xoo contains pathogenic necessary Ш type and secretes system (T3S), and T3S strides across bacterium duplicature, probably directly through plant cell wall ^[5,6].The effector molecule albumen of bacterium is secreted by T3S and is entered vegetable cell ^[7], these effector molecules act on different plant physiology processes, suppress plant defense, and regulating plant transcription strengthens cytotoxin ^[8-9].AvrBs3/pthA is that maximum T3S secretes the effector molecule family, and in vegetable cell, works in the mode of the class plant gene transcription factor (Transcriptionactivator-likeeffector, TALE) ^[10-14].

AvrBs3/pthA family member has five typical constitutional featuress, is present in three regions: 1) N end secretes relevant sequence with T3S; 2) middle portion is region responsible and DNA specific binding, contains random repeating unit, and repeating unit is made up of 30-42 amino-acid residue, and repeat number is between 1.5-33.5 ^[15].34 amino-acid residues that in the middle of AvrBs3, repeating unit is encoded by 102bp form, and have cloned the similar member of some AvrBs3 that contain 34 amino-acid residue repeating units, and its repeat number is 5.5-25.5 ^[16-20].The aminoacid sequence high conservative of repeating unit, only have 12 and 13 amino acids residues to change, 12 and 13 amino acids residues are called and repeat variable couple of residue (repeatvariabledi-residue, RVD), the sequence of RVD has determined the DNA sequence dna specificity combining with repeating unit, in repeating unit these amino-acid residues to having determined that combined techniques between RVD and target DNA sequence dna ^[21-22].3) other three features are leucine zipper (leucinezipper of C end, LZ) structure, three nuclear localization signal (nuclearlocalizationsignal, and acid transcriptional activation domain (acidictranscriptionalactivationdomain, AAD) NLS) ^[23-25].

Since nineteen eighty-three, first avrBs3/pthA family member gene avrBs3 was cloned ^[26], this family member of multiple Xoo different strains is cloned, avrXa7, avrXa10, avrXa5, aB3.5, aB3.6, aB4.3 and aB4.5(PXO86) ^[27-28], pthXo1(PXO99 ^a), pthXo2(JXOI ^a), pthXo3(PXO61), pthXo1-2 and pthXo2-2(PXO71), avrXa7-2(KXO85 ^a) ^[29], avrXa3(JXO Ш) ^[30].Especially along with the develop rapidly of current sequencing technologies, the acquisition of whole genome sequence and analysis, the structure and character to this family member in different strains, understands more more comprehensively many.But this family member's composition, feature and function there are differences in different Xoo bacterial strains, therefore, still formed by the avrBs3/pthA family member sequence of a lot of Xoo bacterial strains and function needs to be illustrated.

Summary of the invention

The invention provides a kind of rice leaf spot bacteria avrBs3/pthA family gene jva2, it is an avrBs3/pthA family member gene in Xoo Japan microspecies JXOV bacterial strain, solve for avrBs3/pthA family member gene in JXOV and understood inadequate problem, and jva2 contains 13.5 middle repeating units, in jva2, the 7th and the 8th repeating unit is in full accord, provides avrBs3/pthA family member gene evolution clear concrete example.

The invention has the beneficial effects as follows, this jva2 gene belongs to JXOV bacterial strain avrBs3/pthA family member gene, and the albumen of expressing in protokaryon do not have Dimerizedly, does not have Xoo bacterial strain PXO99 ^apathogenic impact, can be for finding new Gene For Resistance To Rice Bacterial Blight, for molecule breeding for disease resistance provides new material and theoretical direction.

Brief description of the drawings

Fig. 1 is five feature schematic diagram of AvrBs3/pthA family member that the Jva1 aminoacid sequence of the same clan with the present invention has;

Fig. 2 is five feature schematic diagram of AvrBs3/pthA family member that Jva2 aminoacid sequence of the present invention has;

Fig. 3 is that the middle repeating unit the 12nd and 13 the variable amino acid residues that contain with the present invention Jva1 of the same clan form HD to eight repeat pattern schematic diagram of NG;

Fig. 4 guards motif analysis schematic diagram with the N-end of the present invention Jva1 of the same clan;

Fig. 5 is the SDS-PAGE gel electrophoresis figure that slightly carries total protein with the present invention Embodiment B L21/pET30 of the same clan and BL21/pEjva1;

Fig. 6 is the conservative motif analysis schematic diagram of N-end of Jva2 of the present invention;

Fig. 7 is the SDS-PAGE gel electrophoresis figure that embodiment of the present invention BL21/pET30 and BL21/pEjva2 slightly carry total protein.

Embodiment

Below in conjunction with the drawings and specific embodiments, the present invention is described in detail.

The genetic expression of first part, jva2 of the present invention

Rice leaf spot bacteria avrBs3/pthA family gene jva2 of the present invention, the sequence rna molecule of gene is:

ATGGATCCCATTCGTTCGCGCACGCCAAGTCCTGCCCGCGAGCTTCTGCCCGGACCCC

AACCGGATAGGGTTCAGCCGACTGCAGATCGGGGGGGGGCTCCGCCTGCTGGCGGCC

CCCTGGATGGCTTGCCCGCTCGGCGGACGATGTCCCGGACCCGGCTGCCATCTCCCCC

TGCGCCCTCGCCTGCGTTCTCGGCGGGCAGCTTCAGCGATCTGCTCCGTCAGTTCGATC

CGTCGCTTCTTGATACATCGCTTCTTGATTCGATGCCTGCCGTCGGCACGCCGCATACA

GCGGCTGCCCCAGCAGAATGGGATGAGGCGCAATCGGGTCTGCGTGCAGCCGATGAC

CCGCCACCCACCGTGCCTGTCGCTGTCACTGCCGCGCGGCCGCCGCGCGCCAAGCCG

GCCCCGCGACGGCGTGCGGCGCAACCCTCCGACGCTTCGCCGGCCGCGCAGGTGGAT

CTACGCACGCTCGGCTACAGTCAGCAGCAGCAAGAGAAGATCAAACCGAAGGTGCGT

TCGACAGTGGCGCAGCACCACGAGGCACTGGTGGGCCATGGGTTTACACACGCGCAC

ATCGTTGCGCTCAGCCAACACCCGGCAGCGTTAGGGACCGTTGCTGTCACGTATCAGG

ACATAATCAGGGCGTTGCCAGAGGCGACACACGAAGACATCGTTGGCGTCGGCAAAC

AGTGGTCCGGCGCACGCGCCCTGGAGGCCTTGCTCACGAAGGCGGGGGAGTTGGGAG

GTCCACCGTTACAGTTGGACACAGGCCAACTTGTCAAGATTGCAAAACGTGGCGGCGT

GACCGCAGTGGAGGCAGTGCATGCATCGCGCAATGCACTGACGGGTGCCCCCCTGAA

CCTGACCCCGGACCAAGTGGTGGCCATCGCCAGCAATATTGGCGGCAAGCAGGCGCTG

GAGACGGTGCAGCGCCTGTTGCCGGTGCTGTGCCAGGACCATGGCCTGACCCCGGAC

CAGGTGGTGGCCATCGCCAACAATAACGGCGGCAAGCAGGCGCTGGAGACGGTGCAG

CGGCTGTTGCCGGTGCTGTGCCAGGACCATGGCCTGACCCCGGACCAGGTGGTGGCCA

TCGCCAGCAATATTGGCGGCAAGCAGGCGCTGGAGACGGTGCAGCGGCTGTTGCCGG

TGCTGTGCCAGGACCATGGCCTGACCCCGGACCAGGTGGTGGCCATCGCCAGCCATGG

CGGCGGCAAGCAGGCGCTGGAGACGGTGCAGCGGCTGTTGCCGGTGCTGTGCCAGGA

CCATGGCCTGACCCCGGACCAGGTGGTGGCCATCGCCAGCCATGGCGGCGGCAAGCA

GGCGCTGGAGACGCTGCAGCGGCTGTTGCCGGTGCTGTGCCAGGACCATGGCCTGAC

CCCGGACCAGGTCGTGGCCATCGCCAGCCACGATGGCGGCAAGCAGGCGCTGGAGAC

GGTGCAGCGGCTGTTGCCGGTGCTGTGCCAGGACCATGGCCTGACCCCGGACCAAGT

CGTGGCCATCGCCAGCAATGGCGGCGGCAAGCAGGCGCTGGAGACGCTGCAACGGCT

GTTGCCGGTGCTGTGCCAGGACCATGGCCTGACCCCGGACCAGGTCGTGGCCATCGCC

AGCAATGGCGGCGGCAAGCAGGCGCTGGAGACGCTGCAACGGCTGTTGCCGGTGCTG

TGCCAGGACCATGGCCTGACCCCGGACCAGGTCGTGGCCATCGCCAGCCACGATGGC

GGCAAGCAGGCGCTGGAGACGGTGCAGCGGCTGTTGCCGATGCTGTGCCAGGACCAT

GGCCTGACCCCGGACCAGGTGGTGGCCATCGCCAGCCATGGCGGCGGCAAGCAGGCG

CTGGAGACAGTGCAGCGGCTGTTGCCGGTGCTGTGCCAGGACCATGGCCTGACCCCG

GACCAGGTGGTGGCCATCGCCAGCCACGATGGCGGCAAGCAGGCGCTGGAGACGGTG

CAGCGGCTGTTGCCGGTGCTGTGCCAGGACCATGGCCTGACCCTGGACCAGGTGGTG

GCCATCGCCAGCCACGATGGCGGCAAGAAGGCGCTGGAGACGGTGCAACGGCTGTTG

CCGGTGCTGTGCCAGGACCATGGCCTGACCCCGGACCAGGTCGTGGCCATCGCCAGCC

ACGATGGCGGCAAGCAGGCGCTGGAGACGGTGCAGCGGCTGTTGCCGGTGCTGTGCC

AGGACCATGGCCTGACCCCGGACCAGGTCGTGGCCATCGCCAGCAATGGCGGCGGCA

AGCAGGCGCTGGAGAGCATTGTTGCCCAGTTATCTCGCCCTGATCCGGCGTTGGCCGC

GTTGACCAACGACCACCTCGTCGCCTTGGCCTGCCTCGGCGGACGTCCTGCCCTGGAT

GCAGTGAAAAAGGGATTGCCGCACGCGCCGGAATTGATCGGAAGAGTCAGTCGCCGT

ATTGGCGAACGCACGTCCCATCGCGTTGCCGACTACGCGCAAGTGGTTCGCGTGCTGG

AGTTTTTCCAGTGCCACTCCCACCCAGCGCAAGCATTCGATGACGCCATGACGCAGTT

CGGGATGAGCAGGCACGGGTTGGTACAGCTCTTTCGCAGAGTGGGCGTCACCGAATTC

GAAGCCCGCTGCGGAACGCTCCCCCCAGCCTCGCAGCGTTGGGACCGTATCCTCCAGG

CATCAGGGATGAAAAGGGCCAAACCGTCCCTTACTTCAGCTCAAACACCGGATCAGGC

GTCTTTGCATGCATTCGCCGATTCGCTGGAGCGTGACCTTGATGCGCCCAGCCCAATGC

ACGAGGGAGATCAGACGCGGGCAAGCAGCCGTAAACGGTCCCGATCGGATCGTGCTG

TCACCGGCCCCTCCACACAGCAATCTTTCGAGGTGCGCGTTCCCGAACAGCGCGATGC

GCTGCATTTGCCCCTCAGCTGGAGGGTAAAACGCCCGCGTACCAGGATCGGGGGCGGC

CTCCCGGATCCTGGTATGCCCATCGCTGCCGACCTGGCAGCGTCCAGCACCGTGATGTG

GGAACAAGATGCGGCCCCCTTCGCAGGGGCAGCGGATGATTTCCCGGCATTCAACGAA

GAGGAGCTCGCATGGTTGATGGAGCTATTGCCTCAGTCAGGCTCAGTCGGAGGGACGA

TCTGA

。

Second section, Jva2 of the present invention and prepare materials and methods with the present invention Jva1 of the same clan

Jva1 bacterial strain, the plasmid used that table 1-1 preparation and the present invention are of the same clan

Table 1-2 prepares Jva2 of the present invention bacterial strain used, plasmid

1.1, bacterial isolates, plasmid and culture condition

The bacterial isolates using in the present invention and plasmid are with reference to upper table 1-1 and upper table 1-2.Wherein, the substratum of E.coli is Luriabroth (LB), 37 DEG C of culture temperature; Xoo substratum is NB, 28 DEG C of culture temperature.Add the different antibiotic final concentrations of substratum to be respectively: penbritin (Ap) 100 μ g/ml; Secondary flat (Rif) the 50 μ g/ml of profit; Kantlex (Km) 25 μ g/ml; Spectinomycin (Sp) 50 μ g/ml.

1.2, the Cloning and sequencing of jva1 and jva2 gene

According to the DNA sequence dna of the avrBs3/pthA family member avrXa10 of known Xoo bacterial strain PXO86, design primer is as follows:

Upstream primer 5'GG gGTACC (KpnI)aTGGATCCCATTCGTTC3';

Downstream primer 5'G gAATTC (EcoRI)cGCCCCTCAGATCGTCC3'.

Taking Xoo bacterial strain JXOV genomic dna as template, pcr amplification obtains product, and rubber tapping is reclaimed, and enzyme is connected to carrier pMD18-T after cutting purifying, obtains respectively pMjva1 and pMjva2.

Order-checking and analyses and comparison sequence, software used is DNAStar.

1.3, prokaryotic expression jva1 and jva2

Jva1 and jva2 are connected to expression vector pET30a(+), obtain pEjva1 and pEjva1, be transformed in e. coli bl21 (DE3), choose single colony inoculation in 20ml liquid LB+Km25,37 DEG C, shaking culture is about 12 hours; Get 1ml and be inoculated in 100ml liquid LB+Km25 nutrient solution, 37 DEG C, continue shaking culture to OD600=0.5; Add the IPTG of 100 μ l1M, 28 DEG C, shaking culture 3 hours; Centrifugal (8000r/min, 10min) collects thalline; Add appropriate amount of deionized water suspension thalline, centrifugal (8000r/min, 10min) collects thalline; Add the TE suspension thalline of 5ml, and add the PMSF of 50 μ l10mM; Bacteria suspension is put in ice, ultrasonic disruption thalline; Centrifugal (10,000r/min, 10min) collect supernatant.

1.4, the thick leach protein of SDS-PAGE electrophoresis detection

According to formula in " molecular cloning ", preparation 10%Tris-glycine sds polyacrylamide gel electrophoresis separation gel, pours in glass sandwich, and at upper strata envelope ultrapure water, after solidifying, pure water is fallen dry, blots with thieving paper at one jiao; The concentrated glue of configuration 5%, pours into glass sandwich, plugs broach, avoids producing bubble; After glue to be concentrated is dry, extract broach, for subsequent use; On thick leach protein, cleer and peaceful 2 × SDS-PAGE sample loading buffer mixes, and boiling water bath 3min is cooling rapidly on ice, loading; Electrophoresis apparatus and power supply join, and 20v/cm voltage is maintained to dyestuff and enters separation gel, and voltage is increased to 40v/cm, until dyestuff is to glue bottom; Get glue, put in stationary liquid fixingly, after tetrabromophenol sulfonphthalein blueness takes off to the greatest extent, continue to fix 5 minutes, slightly wash glue with deionized water; Add staining fluid dyeing to spend the night, add destainer decolouring some hours, change during this time destainer for several times, take pictures.

1.5, PXO99 ^athe acquisition of zygote and leaf-cutting inoculation test

Gene jva1 and jva2 are connected on pUFR034 carrier, obtain pUjva1 and pUjva2.Three carrier pUFR034, pUjva1 and pUjva2 are transformed into Host Strains S17-1, obtain zygote three zygote S17-1/pUFR034, S17-1/pUjva1 and S17-1/pUjva2.The method of amphiphilic mating obtains zygote PXO99 ^a/ pUFR034, PXO99 ^a/ pUjva1 and PXO99 ^a/ pUjva2.

Wild-type PXO99 ^awith zygote PXO99 ^a/ pUFR034, PXO99 ^a/ pUjva1 and PXO99 ^ait is 10 that/pUjva2 cultivates concentration ⁸cFU/ml, 15 strain phase rice varieties of leaf-cutting inoculation, measured scab after 15 days, got 5 leaf spot lesion mean values, and test is in triplicate ^[31].The rice varieties that the present invention uses in experiment is with reference to table 2.

Table 2 paddy rice used in the present invention

Part III, to Jva2 and with the biological characteristic analysis of the present invention's Jva1 gene of the same clan

2.1, the aminoacid sequence of jva1 and jva2 gene and supposition

Jva1 full length gene 3009bp, 1002 amino-acid residues of encoding, and jva2 full length gene 3111bp, 1036 amino-acid residues of encoding.Jva1 and Jva2 aminoacid sequence, substantially all have five typical constitutional featuress of avrBs3/pthA family member gene, N end secretes relevant sequence, middle 34 amino-acid residue repeating unit sequences, C end LZ, NLS and AAD sequence (as shown in Figure 1, Figure 2) with T3S.

The relatively aminoacid sequence of these two genes, almost in full accord, different have two aspects: first, the repeating unit that Jva1 region intermediate contains 12.5 34 amino-acid residues, Jva2 contains the repeating unit of 13.5 amino-acid residues, than the many repeating units of Jva1, in Jva2, the 7th is identical with the repeating unit of the 8th 34 amino-acid residues, and this identical repeating unit is positioned at the 7th (with reference to Fig. 1, Fig. 2) of Jva1.Second aspect, it is different from Jva1 that the C-end of Jva2 contains six amino-acid residues, but be not included in LZ, NLS and AAD characteristic sequence.

If Fig. 1 is five features of avrBs3/pthA family member that the Jva1 aminoacid sequence of the same clan with the present invention has.N terminal sequence is secreted relevant with T3S; Middle 34 amino acid repeating units are relevant with DNA binding specificity; C end has LZ, NLS and AAD sequence signature.In Jva1, in the 7th repeating unit and Jva2, the 7th, the 8th repeating unit sequence is in full accord.

In the middle of Jva1, repeating unit 1 to 12.5 the 12nd and 13 amino acids residues are respectively: NINNNIHGHGHDNGHDHGHDHDHDNG, the 6th 12,13 amino acids to the 12.5th repetition contain the pattern feature of a HD to eight tumor-necrosis factor glycoproteinss of NG, this with on paddy rice, play member PthXo1, PthXo2, PthXo3 and the AvrXa7 sequence of toxic action in the HD that exists of 12,13 amino acids sequences to eight repeat patterns of NG consistent (with reference to Fig. 3) ^[29].

If Fig. 3 is that middle repeating unit the 12nd and 13 the variable amino acid residues that Jva1 contains form HD to eight repeat patterns of NG.PthXo1-3 and AvrXa7 are the Toxicity To Rice factors.In Fig. 3, numeral is the position with respect to first repeating unit.

2.2, the N of Jva1 and Jva2 end may relate to T3S and secretes the constitutional features

It is 8% that the N-of Jva1 and Jva2 holds the content of Serine in front 25 amino-acid residues.

Relatively Jva1, Jva2, AvrBs1 (YP_361663.1), AvrBs2 (YP_361783.1), AvrBs3 (P14727.2), AvrBs4 (CAA48680.1) and AvrBsT (EGD08030.1) n terminal amino acid sequence, Jva1 and Jva2 contain the proline residue that primary amino acid surrounds equally, and it is in full accord to relate to 12 amino acid residue sequences in 12 amino-acid residues and AvrBs3 and the AvrBs4 of this sequence signature ^[32].

Fig. 4 and Fig. 6 are respectively the conservative motif analysis of N-end of Jva1 and Jva2.The N-terminal sequence of comparative analysis Jva1, Jva2 and AvrBs1-4 and AvrBsT, what in square frame, emphasize is conservative proline residue, the identical sequence that proline residue both sides are inferred is listed separately.In figure, numeral is the position with respect to whole first amino-acid residue of albumen.

2.3, prokaryotic protein expression Jva1 and Jva2

Fragment jva1 and jav2 are connected to expression vector pET30 (a+) (being called for short pET30), obtain pEjva1 and pEjva2, proceed to Host Strains BL21 (DE3), cultivate and abduction delivering.Extract transformant BL21/pET30, BL21/pEjva1 and BL21/pEjva2 total protein, SDA-PAGE glue shows, BL21/pEjva1 and BL21/pEjva2 have more a thicker band than BL21/pET30 is obvious, be positioned at slightly top of 100KD, and band in BL21/pEjva2 is than the band in BL21/pEjva1 slightly larger (as Fig. 5, Fig. 7).

Fig. 5 and Fig. 7 are the SDS-PAGE gel electrophoresis that BL21/pET30, BL21/pEjva1 and BL21/pEjva2 slightly carry total protein.Wherein, M is albumen marker; Swimming lane 1 is BL21/pET30; Swimming lane 2 is BL21/pEjva1 or BL21/pEjva2.

2.4, Jva1 and Jva2 are to PXO99 ^athe pathogenic impact of bacterial strain

Concentration is 10 ⁸the wild type strain PXO99 of CFU/ml ^aand zygote PXO99 ^a/ pUFR034, PXO99 ^a/ pUjva1 and PXO99 ^a/ pUjva2 inoculates 15 rice varieties that contain different resistant genes, the average scab length that four bacterial strains caused after 15 days does not have significant difference, result shows, in resistant gene Xa1, Xa2, Xa3, Xa4, xa5, Xa7, xa8, Xa10, xa13, Xa16, Xa17, Xa18 and Xa21, all there is no the relation mutually done corresponding to Jva1 and Jva2.Jva1 and Jva2 do not increase PXO99 yet ^abacterial strain is pathogenic.

Part IV, to jva2 and with the biologic applications analysis of the present invention's jva1 gene of the same clan

Homologous gene is divided into orthologous gene (ortholog), horizontal homologous gene (paralog) and allos homologous gene conventionally, and it is apparent that the evolutionary relationship between the avrBs3/pthA family member in same Xoo bacterial strain belongs to horizontal homologous gene.Function between typical paralogs is same or analogous, but is different sometimes.Different reasons be the gene that copies in the case of lacking original selective pressure, can freely suddenly change and obtain new function.The avrBs3/pthA family member avrXa7 of Xoo under culture condition, suddenly change lose rely on Xa7 nontoxic active function and keep toxicity function to be found ^[33].The avrBs3/pthA family member of two JXOV of the present invention, only differ a 102bp, and 34 aminoacid sequences (as Fig. 1) in full accord of the 7th and the 8th repeating unit coding of jva2, although also cannot determine that self-replacation generation has had more a repeating unit, or the copy of a repeating unit has been lacked in sudden change, but more clear concrete evolution example is provided.

(the IowaStateUniversity of Iowa State University, USA) Bogdanove professor is in the time of the evolutionary relationship of studying between Xoo and the avrBs3/pthA family member of Xanthomonasoryzaepv.oryzicola (Xooc), middle 102bp sequence with each member is done phylogenetic analysis, while finding member's cluster of Xoo and Xooc, there is crossover phenomenon, infer that thus between the avrBs3/pthA family member of these two pathogenic mutation be also the relation (Privatecommunication) of paralog.Really, the function of the gene of the gene of the avrBs3/pthA family of Xooc and the avrBs3/pthA family of Xoo is very different.Up to now, on paddy rice, be not cloned into disease-resistant gene corresponding to avrBs3/pthA family gene of one and Xooc.But the avrBs3/pthA family member avrRxo1 of Xooc can excite the anaphylaxis of the corn that carries Rxo1 resistant gene, and Rxo1 gene can proceed to Rice Resistance Xooc ^[34,35].

AvrBs3 gene expression product has been proved to be at plant cytoplasm interdimers, by Eukaryotic core transport machine, may be transported to plant nucleolus by the mediation of importin α, and this mutual repeat region that depends on of AvrBs3-AvrBs3, vegetable-protein do not relied on ^[36].Two genes of the avrBs3/pthA family of the JXOV bacterial strain that the present invention expresses in BL21 protokaryon, SDS-PAGE glue appear at 100KD slightly above, with the monomer size 100KD left and right of inferring quite.Depend on repeat region in the middle of avrBs3/pthA family but not the Dimerized process of vegetable-protein not have the reason of generation to await further research in prokaryotic cell prokaryocyte.

The middle repeat region of the avrBs3/pthA family member Jva1 of JXOV of the present invention contains the pattern feature of HD to eight tumor-necrosis factor glycoproteinss of NG, is indicating that this member may toxic effect ^[29], and 34 amino acid number of repeat unit of Jva1 region intermediate are 12.5, are far longer than induction target gene and express the minimum unit number 6.5 requiring ^[21].But the PXO99 of Jva1 is carried in inoculation ^abacterial strain, does not find significantly to strengthen toxicity function, is likely the reason of functional redundancy.PXO99 ^aon 15 rice varieties of test, be pathogenic more intense bacterial strain, if Jva1 imports the pathogenic more weak bacterial strain of rice varieties to test, likely observe the effect of the virulence factor of this gene.In addition, the Resistance genes of vice corresponding with jva1 do not found in inoculation test yet, but do not get rid of the resistant gene that in paddy rice, existence is answered in contrast.

Do mutually in long-term evolution process at Xoo and paddy rice, it is the variation that sequence and function are all occurring for the pathogenic effector molecule of Xoo or Resistance genes of vice, avrBs3/pthA family gene belongs to maximum T3S as yellow unit cell and secretes albumen, plays critical effect to Xoo bacterial strain is pathogenic.Therefore, research avrBs3/pthA family member, understand these members' sequence, evolutionary relationship and constitutional features, and explore its protein expression, mechanism of action, understand Xoo pathogenesis to further, thereby instruct Rice Production to have great importance, need, with the Protocols in Molecular Biology upgrading, to obtain more deep progress.In fact,, along with the development of new molecular engineering (modularcloningorgoldengatecloning), can assemble design the avrBs3/pthA family gene that contains the middle repeating unit composition of different 34 amino acid completely ^[39-40], better realize object of the present invention.

Reference:

1Bennetzen?J?L，Ma?J.The?genetic?colinearity?of?rice?and?other?cereals?on?the?basis?of?genomic?sequence?analysis[J].Current?Opinion?in?Plant?Biology，2003，6:128-133.

2Ronald?P，Leung?H.The?most?precious?things?are?not?jade?pearls…[J].Science，2002，296:58-59.

3Shimamoto?K，Kyozuka?J.Rice?as?a?model?for?comparative?genomics?of?plants[J].Annual?Review?of?Plant?Biology，2002，53:399-419.

4

D?O，Ronald?P?C，Bogdanove?A?J.Xanthomonas?oryzae?pathovars:model?pathogens?of?a?model?crop[J].Molecular?Plant?Pathology，2006，7（5）：303-324.

5Büttner?D，Bonas?U.Regulation?and?sectetion?of?Xanthomonas?virulence?factors[J].FEMS?Microbiology?Reviews，2009，34:07-33.

6Weber?E，Ojanen-Reuhs?T，Huguet?E?et?al.The?type?Ⅲ-dependent?Hrp?pilus?is?required?for?productive?interaction?of?Xanthomonas?campestris?pv.vesicatoria?with?pepper?host?plants[J].Journal?of?Bacteriology，2005，187:2458-2468.

7Büttner?D，Bonas?U.Port?of?entry:the?type?Ⅲ?secretion?translocon[J].Trends?in?Microbiology，2002，10:186-192.

8Boch?J.Plant?pathogenic?bacteria:Genomics?and?molecular?biology[M].Norfolk，UK:Caister?Academic?Press，2009.241-171.

9Hogenhout?S?A，Van?derHoorn?R?A，Terauchi?R?et?al.Emerging?concepts?in?effector?biology?of?plant-associated?organisms?[J].Molecular?Plant-Microbe?Interaction，2009，22:115-122.

10Kay?S，Bonas?U.How?Xanthomonas?type?Ⅲ?effectors?manipulate?the?host?plant[J].Current?Opinion?in?Microbiolgy，2009，12:37-43.

11Schornack?S，Meyer?A， P?et?al.Gene-for-gene-mediated?recognition?of?nuclear-targeted?AvrBs3-like?bacterial?effector?proteins[J].Journal?of?Plant?Physiology，2006，163:256-272.

12White?F?F，Potnis?N，Jones?J?B?et?al.The?type?Ⅲ?effectors?of?Xanthomonas[J].Molecular?Plant?Pathology，2009，10:749-766.

13White?F?F，Yang?B.Host?and?pathogen?factors?controlling?the?rice-Xanthomonas?oryzae?interaction[J].Plant?Physiology，2009，150:1677-1686.

14White?F?F，Yang?B，Johnson?L?B.Prospects?for?understanding?avirulence?gene?function[J].Current?Opinion?in?Plant?Biology，2000，3:291-298.

15Boch?J，Bonas?U.Xanthomonas?AvrBs3family-Type?III?effectors:discovery?and?function[J].Annual?Review?of?Phytopathology，2010，48:419-436.

16Ballvora?A，Pierre?M，Van?den?Ackerveken?G?et?al.Genetic?mapping?and?functional?analysis?of?the?tomato?Bs4locus，governing?recongnition?of?the?Xanthomonas?campestris?pv.vesicatoria?AvrBs4protein[J].Molecular?Plant-Microbe?Interaction，2001，14:629-638.

17Gu?K?Y，Yang?B，Tian?D?S?et?al.R?gene?expression?induced?by?a?type-Ш?effector?triggers?disease?resistance?in?rice[J].Nature，2005，435:1122-1125.

18Herbers?K，Conrads-Strauch?J，Bonas?U.Race-specificity?of?plant?resistance?to?bacterial?spot?disease?determined?by?repetitive?motifs?in?a?bacterial?avirulence?protein[J].Nature，1992，356:172-174.

19Yang?B，Zhu?W，Johnson?L?B?et?al.The?virulence?factor?AvrXa7of?Xanthononas?oryzae?pv.oryzae?is?a?type?III?secretion?pathway-dependent，nuclear-localized，double-stranded?DNA?binding?protein[J].PNAS，2000，97:9807-9812.

20Zhu?W?G，Yang?B，Chittoor?J?M?et?al.AvrXa10contains?an?acidic?transcriptional?activation?domain?in?the?functionally?conserved?C?terminus[J].Molecular?Plant-Microbe?Interaction，1998，11:824-832.

21Boch?J，Scholze?H，Schornack?S?et?al.Breaking?the?code?of?DNA?binding?specificity?of?TAL-Type?III?effectors[J].Science，2009，326:1509-1512.

22Moscou?M?J，Bogdanove?A?J.A?simple?cipher?governs?DNA?recognition?by?TAL?effectors[J].Science，326，1501.

23Yang?Y，Gabriel?D?W.Xanthomonas?avirulence/pathogenicity?gene?family?encodes?functional?plant?nuclear?targeting?signals[J].Molecular?Plant-Microbe?Interaction，1995，8:627-631.

24Gabriel?D?W.Plant?microbe?interactions[M].St?Paul，MN:APS?Press，1999:39–55.

25Van?den?Ackerveken?G，Marois?E，Bonas?U.Recognition?of?the?bacterial?avirulence?protein?AvrBs3occurs?inside?the?host?plant?cell[J].Cell，1996，87:1307–1316.

26Marco?G?M，Stall?R?E.Control?of?bacterial?spot?of?pepper?initiated?by?strains?of?Xanthomonas?campestris?pv.vesicatoria?that?differ?in?sensitivity?to?copper[J].Plant?Disease，1983，67:779-781.

27Hopkins?C?M，White?F?F，Choi?S-H?et?al.Identification?of?a?family?of?avirulence?genes?from?Xanthomonas?oryzae?pv.oryzae[J].Molecular?Plant-Microbe?Interaction，1992,5(6):451-459.

28Bai?J，Choi?S?H，Ponciano?G?et?al.Xanthomonas?oryzae?pv.oryzae?avirulence?genes?contribute?differently?and?specifically?to?pathogen?aggressiveness[J].Molecular?Plant-Microbe?Interaction，2000,13:1322-1329.

29Yang?B，White?F?F.Diverse?members?of?the?AvrBsS/PthA?family?of?type?III?effectors?are?major?virulence?determinants?in?bacterial?blight?disease?of?rice[J].Molecular?Plant-Microbe?Interaction，2004,17:1192-1200.

30Li?P，Long?J?Y，Huang?Y?C?et?al.A?new?avrBs3family?member?avrXa3is?a?bi-functional?avirulence?gene?from?rice?Xanthomonas（in?Chinese）[J].Progress?in?Natural?Science，2004，14（7）：767-772.

31Fang Z D.Method of plant pathology (in Chinese) [M] .Beijing:China Agricultural Press (Beijing: Chinese agriculture press), 1996.385-386

32Escolar?L，Van?den?Ackerveken?G，Rossier?O?et?al.Type?III?secretion?and?in?planta?recognition?of?the?Xanthomonas?avirulence?proteins?AvrBs1and?AvrBsT[J].Molecular?Plant?Pathology，2001，2:287–296.

33Yang?B，Sugio?A，White?F?F.Avoidance?of?host?recognition?by?alterations?in?the?repetitive?and?C-termina?lregions?of?AvrXa7,a?type?III?effector?of?Xanthomonas?oryzae?pv.oryzae[J].Molecular?Plant?Pathology，2005,18:142–149.

34Zhao?B?Y，Ardales?E?Y，Raymundo?A?et?al.The?avrRxo1gene?from?the?rice?pathogen?Xanthomonas?oryzae?pv.oryzicola?confers?a?nonhost?defense?reaction?on?maize?with?resistance?gene?Rxo1[J].Molecular?Plant-Microbe?Interaction，2004，17(7):771-779.

35Zhao?B?Y，Lin?X?H，Poland?J?et?al.A?maize?resistance?gene?functions?against?bacterial?streak?disease?in?rice[J].PNAS，2005，102（43）：15383-15388.

36Gürlebeck?D，Szurek?B，Bonas?U.Dimerization?of?the?bacterial?effector?protein?AvrBs3in?the?plant?cell?cytoplasm?prior?to?nuclear?import?[J].The?Plant?Journal，2005，42:175-187.

37Simon?R，Priefer?U，Pühler?A.A?broad?host?range?mobilization?system?for?in?vivo?genetic?engineering:transposon?mutagenesis?in?gram?negative?bacteria[J].Bio/Technology，1983，1:784-791.

38DeFeyter?R,Kado?C?I,Gabriel?D?W.Small,stable?shuttle?vectors?for?use?in?Xanthomonas[J].Gene,1990,88:65-72.

39Morbitzer?R,Elsaesser?J,Hausner?J?et?al.Assembly?of?custom?TALE-type?DNA?binding?domains?by?modular?cloning[J].Nucleic?Acids?Research，2011，39（13）：5790-5799.

40Weber?E，Gruetzner?R，Werner?S?et?al.Assembly?of?designer?TAL?effectors?by?golden?gate?cloning[J].PLoS?ONE，2011,6(5):e19722。

Claims

1. a rice leaf spot bacteria avrBs3/pthA family gene jva2, its feature is, its gene order is: