CN101457228A - Genetic engineering application of ralstonia solanacearum novel extracellular protein PopW - Google Patents
Genetic engineering application of ralstonia solanacearum novel extracellular protein PopW Download PDFInfo
- Publication number
- CN101457228A CN101457228A CNA2009100291186A CN200910029118A CN101457228A CN 101457228 A CN101457228 A CN 101457228A CN A2009100291186 A CNA2009100291186 A CN A2009100291186A CN 200910029118 A CN200910029118 A CN 200910029118A CN 101457228 A CN101457228 A CN 101457228A
- Authority
- CN
- China
- Prior art keywords
- popw
- ralstonia solanacearum
- primer
- protein
- amplification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a genetic engineering application of a ralstonia solanacearum new extracellular protein PopW belonging to the genetic engineering technique field comprising the following steps: designing a primer by using genome DNA as templates, amplifying the PopW coding region sequence by using a high fidelity polyase, connecting an outcome to a protein expression vector pET30a(+) vector, then converting to an Escherichia coli BL21(DE3) for protein expression and purifying the PopW protein by nickel column. A subcellular location research shows that the protein is located on the plant cell wall. In the greenhouse condition the PopW also induces the tobacco to resist the infection of the tobacco mosaic virus, which shows that the PopW can induce the tobacco system to acquire resistance, provides great possibility for later controlling diseases as biological pesticides and has important social benefit and economic benefit.
Description
Technical field
The genetically engineered that the present invention relates to the new extracellular protein PopW of a kind of Ralstonia solanacearum ZJ3721 is used, and belongs to the genetically engineered field.
Background technology
The hrp gene cluster of most gram negative bacteriums can cause anaphylaxis on non-host plant, and shows pathogenic on host plant.The product of hrp gene plays regulating and controlling effect in its expression and secretion process.HrpN as Erwinia amylovora, the similar Harpin albumen of the PopA of the HrpZ of Pseudomona syringae and Ralstonia solanacearum is identified, they can be secreted into born of the same parents by the three types system of secreting and cause non-host plant generation anaphylaxis outward, be that a class is rich in glycine and Serine, lack halfcystine and heat-stable a kind of albumen, on aminoacid sequence, do not have similarity.
Ralstonia solanacearum can cause wilting of hundreds of farm crop in worldwide, comprises tomato, potato, tobacco, peanut and banana etc.Germ enters xylem by host's root wound infection, is diffused rapidly to whole plant then.Thereby its pathogenesis is to produce a large amount of exocellular polysaccharides to stop up the conveying of guard system prevention plant moisture.At type strain GMI1000, three extracellular protein PopA1, PopB and PopC are identified.PopA1 is one and is secreted into the outer albumen of born of the same parents by the three types system of secreting, lack simultaneously terminal 92 the amino acid whose PopA1 derivative PopA3 of N-also from the supernatant liquor that is grown in the barren substratum of nutrition purifying come out.PopA1 and PopA3 all can cause the anaphylaxis of petunia.PopA is positioned at Ralstonia solanacearum hrp gene cluster upstream 2kb, and its expression is subjected to the regulation and control of hrpB gene.Arlat group has found new albumen PopB and PopC from the genome of Ralstonia solanacearum, PopB albumen is made up of 173 amino acid, contains two nuclear localization signals; Long 1024 amino acid of PopC wherein contain 22 leucine zippers.PopB, popC, and popA is subjected to the hrpB regulation and control simultaneously. under Congo red inducing, it is outer that they find that PopB and PopC are secreted into born of the same parents by the Hrp system.
A new Harpin albumen PopW is cloned in the present invention from Ralstonia solanacearum, and its characteristics are analyzed.This protein is like the HrpN of E.amylovora, and the PopA of HrpW and Ralstonia solanacearum can cause anaphylaxis on tobacco, under greenhouse experiment, can the evoking tobacco resisting tobacco mosaic virus infect.
Summary of the invention
Technical problem: the objective of the invention is to disclose the genetically engineered application of the new extracellular protein PopW of a kind of Ralstonia solanacearum ZJ3721, belong to the genetically engineered field, infecting of this gene energy evoking tobacco resisting tobacco mosaic virus improved the plant disease-resistant ability, thereby carried out the research and development of biological pesticide.
Technical scheme
1) clone of popW gene
Ralstonia solanacearum ZJ3721 is incubated at the MBG substratum under 30 ℃ of conditions, treat that strain growth arrives logarithmic phase, extracts the test kit operation instructions according to bacterial genomes and extracts the Ralstonia solanacearum genomic dna;
Design amplification popW gene primer popW1:
Upstream primer F:CG
CATATGTCCATCCAGATTGATCGC Nde I
Downstream primer R:GC
AAGCTTGCCCGAGTAGGCCTTGTAG Hind III
Or amplification popW gene primer popW2:
Upstream primer F:ATG TCC ATC CAG ATTGATCGC
Downstream primer R:GCCCGAGTAGGCCTTGTAG
Or amplification popW gene primer popW3:
Upstream primer F:TC
TAGAATGTCCATCCAGATTGATCGC Xba I
Downstream primer R:
GGATCCGCCCGAGTAGGCCTTGTAGCT BamH I
With the genomic dna is template, uses the coding region sequence of high-fidelity pfu polymeric enzymatic amplification PopW, and amplification program is: 94 ℃ of pre-sex change 4min, and 94 ℃ of sex change 30s, 60 ℃ of renaturation 1min, 72 ℃ are extended 1min, and after 30 circulations, 72 ℃ of 10min, product cut glue and reclaim;
2) proteic expression of PopW and purifying
Product cut add after glue reclaims be connected to that the intermediate carrier enzyme is cut behind the A or direct enzyme cutting after be connected to protein expression vector pET30a (+) carrier, order-checking is identified, obtain recombinant plasmid pET-popW, be converted into then in the e. coli bl21 (DE3) and carry out protein expression, the positive colony that screens is inoculated in the test tube that contains the LB liquid nutrient medium, 37 ℃, overnight incubation under 180 rev/mins of conditions, ratio in 1:100 was inoculated among the 10mL LB in second day, cultivated 3 hours according to above-mentioned condition, adding inductor sec.-propyl-β-D thiogalactoside then, to make its final concentration be 1mM, behind the inducing culture 2 hours, under 4 ℃, 6000 leave the heart collected thalline in 10 minutes, it is suspended in 20mM Tris-HCl, pH8.0, adding final concentration is the phenylmethylsulfonyl fluoride of 1mM, carry out bacterial cell disruption on the ultrasonic disruption instrument then, when bacterium liquid becomes clarification, centrifugal absorption supernatant, carrying out polyacrylamide gel electrophoresis detects, and with ni-sepharose purification PopW albumen, concrete operations are carried out with reference to High-Affinity Ni-IDA Resin process specifications, obtain purifying PopW albumen.More than the purifying PopW albumen of Huo Deing can be applied aspect disease resistance of plant.
Beneficial effect
1, the invention discloses a kind of Ralstonia solanacearum popW gene and coded protein thereof.In the process of doing mutually with plant, PopW is positioned the cell walls of plant, for research Ralstonia solanacearum and host mutual provides theoretical pattern.
2, the PopW of inventor's acquisition is a kind of heat-stable harpin albumen, can cause tobacco generation anaphylaxis, is second the harpin albumen of finding in the Ralstonia solanacearum.
3, the PopW that obtains of the present invention handles tobacco, can evoking tobacco opposing tobacco mosaic virus (TMV) infect, and resistance is not limited only to the blade that PopW handles, and also comprises the blade around it, and is accompanied by the PR-1 expression of gene in the middle of this process.Illustrate that PopW can the evoking tobacco system obtain disease resistance.This explanation PopW has the value that is developed to biogenic pesticide.
Description of drawings
Fig. 1 .PopW protein expression (A) and purifying (B) result.
M be albumen marker (SM0431, MBI), 1,2 and 3 is expressions of results of three different clones, B figure is the result of PopW after purified.
Embodiment
(dna sequence dna of Ralstonia solanacearum ZJ3721 and extracellular protein gene PopW is openly seen accession number EF080949 to Ralstonia solanacearum (Ralstonia solanacearum) ZJ3721;
Http:// www.ncbi.nm.nih.gov/entrez/viewer.fcgi? db=nuccore﹠amp; Id=117168855) under 30 ℃ of conditions, be incubated at MBG substratum (0.5% peptone, 0.1% casein hydrolysate, 0.1% yeast extract powder, 0.1% glucose and 1.6% agar), treat that strain growth arrives logarithmic phase, extract genomic dna (Axyprep Bacterial Genomic DNA kit, Hangzhou).Design primer popW2 according to pattern bacterium Ralstonia solanacearum GMI1000 whole genome sequence:
Upstream primer popW2 F:ATG TCC ATC CAG ATTGATCGC,
Downstream primer popW2 R:GCCCGAGTAGGCCTTGTAG
With the genomic dna is template, carry out pcr amplification, the PCR program is as follows: 94 ℃ of pre-sex change 4min, 94 ℃ of sex change 30s, 58 ℃ of renaturation 1min, 72 ℃ are extended 1min, after 30 circulations, 72 ℃ of 10min, the agarose electrophoresis with 1% detects pcr amplification product 1143bp, (TaKaRa, Dalian) handbook reclaims according to Agarose Gel DNA Purification KiT.Then the product 4 μ L that are recovered to are connected on the carrier pMD19-T, 16 ℃ the reaction 16 hours after, with thermal excitation transformed into escherichia coli competent cell DH5 α, the picking positive colony checks order, and sequencing result shows that the complete coding region of Ralstonia solanacearum ZJ3721 extracellular protein gene PopW is 1143bp;
According to the dna sequence dna complete encoding sequence of Ralstonia solanacearum ZJ3721 extracellular protein gene PopW, the design enzyme-added respectively primer popW1 that cuts the site in two ends:
Upstream primer popW1F:CG
CATATGTCCATCCAGATTGATCGC, (Nde I)
Downstream primer popW1R:GC
AAGCTTGCCCGAGTAGGCCTTGTAG (Hind III)
Genomic dna with acquisition among the embodiment 1 is a template, use the coding region sequence of high-fidelity pfu archaeal dna polymerase amplification PopW, amplification program is: 94 ℃ of pre-sex change 4min, 94 ℃ of sex change 30s, 60 ℃ of renaturation 1min, 72 ℃ are extended 1min, after 30 circulations, 72 ℃ of 10min, the product size is 1143bp, end is cloned into intermediate carrier pMD19-T after adding A, utilize Nde I and the Hind III restriction enzyme site introduced further to be cloned into protein expression vector pET30a (+) carrier, order-checking is identified, obtains recombinant plasmid pET-PopW, is converted into then among the BL21 (DE3) and carries out protein expression, with the cultured centrifugal collection thalline of e. coli bl21 (DE3) that contains above-mentioned recombinant plasmid, it is suspended in 20mM Tris-HCl (pH8.0), and adding final concentration is the proteinase inhibitor PMSF of 1mM, carries out the albumen fragmentation on the ultrasonic disruption instrument, extract albumen then, carry out polyacrylamide gel electrophoresis and detect, with ni-sepharose purification PopW albumen, obtaining protein concentration is 60 μ g/ml (Fig. 1).
According to the dna sequence dna of Ralstonia solanacearum ZJ3721 extracellular protein gene PopW, see the complete encoding sequence of SEQ ID NO.1, the design enzyme-added respectively primer popW3 that cuts the site in two ends:
Upstream primer popW3F:TC
TAGAATGTCCATCCAGATTGATCGC (Xba I)
Downstream primer popW3R:
GGATCCGCCCGAGTAGGCCTTGTAGCT (BamH I)
Genomic dna with acquisition is a template, use high-fidelity pfu polymeric enzymatic amplification not contain the coding region sequence of the PopW of terminator codon, amplification program is: 94 ℃ of pre-sex change 4min, 94 ℃ of sex change 30s, 60 ℃ of renaturation 1min, 72 ℃ are extended 1min, after 30 circulations, 72 ℃ of 10min, pcr amplification product 1140bp.Utilize Xba I and the BamH I restriction enzyme site introduced further to be cloned into plant expression vector pBI121-GFP (the Andreeva A.V. that carries green fluorescence protein gene, Kutuzov M.A.2001.Nuclear localization of plant proteinSer/Thr phosphatase PP7.Mol.CellBiol.Res.Commun.4,345-352), be built into the pBI121-PopW:GFP fusion vector; Change onion epidermis cell over to by Agrobacterium LBA 4404 (purchase) then, when behind 28 ℃ of cultivation 24h, we use fluorescence microscope expression of gene situation.Whole cell is surrounded by green fluorescence, in order to get rid of this green fluorescence is not to be positioned on the cytolemma, we handle onion epidermis with the sucrose solution of 1M has made its that plasmolysis takes place, in plasmolytic cell, the GFP signal still with normal cell in the middle of the same cell walls that tightly is enclosed in.Yet in the middle of the empty carrier contrast, fluorescent signal is filled with whole tenuigenin, illustrates that this assignment of genes gene mapping is in cell walls.
With the PopW albumen of above-mentioned acquisition, concentration 〉=25 μ g/ml to the intercellular substance injection of the tobacco leaf grass back side, has been observed the anaphylaxis of tobacco, the about 1cm of necrotic plaque diameter with syringe without a head within 24 hours.Simultaneously PopW cause the function of anaphylaxis have thermotolerance (100 ℃, 10min)..
With the PopW albumen of above-mentioned acquisition, concentration is 20 μ g/ml, is sprayed on the blade of tobacco, handles in contrast with the aqua sterilisa that does not contain PopW.After two days, to the blade that sprayed PopW and two top and following blade inoculation tobacco mosaic virus (TMV)s thereof, each handles 3 repetitions to the method that adopts frictional inoculation respectively.Before this experiment, we determine that the consumption of tobacco mosaic virus (TMV) is not inoculate the scab that causes on the PopW leaf about 200 at every.We observe the number and the diameter of scab after 4 days, calculate inhibiting rate by the reduction of scab.Find, blade that PopW handles and above two blades on, inhibiting rate can reach 94.74-97.40%, and two blade inhibiting rates reach 93% below handling blade, except the minimizing of scab number, to compare with the blank that does not have to handle, the scab diameter that PopW handled obviously diminishes, illustrate that PopW can cause system's resistance of tobacco, thereby suppress infecting of tobacco mosaic virus (TMV) effectively.
Above embodiment shows the new extracellular protein PopW of a kind of Ralstonia solanacearum ZJ3721 that clones among the present invention, it has the feature of Harpin, comprise amino acid whose composition, thermostability, proteolytic enzyme responsive and on SDS-PAGE migration wait characteristic more slowly, PopW total length and its N-terminal harpin district can both cause that HR reacts.The PopW that the inventor provides is a kind of heat-stable harpin albumen, can cause tobacco generation anaphylaxis, is second the harpin albumen of finding in the Ralstonia solanacearum.He with host's process in the middle of be to be positioned on the cell walls of plant.PopW of the present invention handles tobacco, can evoking tobacco opposing tobacco mosaic virus (TMV) infect, and resistance is not limited only to the blade that PopW handles, and also comprises the blade around it, and is accompanied by the PR-1 expression of gene in the middle of this process.Illustrate that PopW can the evoking tobacco system obtain disease resistance, illustrates that PopW can be developed to biogenic pesticide.
SEQUENCE?LISTING
＜110〉Agricultural University Of Nanjing
＜120〉genetically engineered of ralstonia solanacearum novel extracellular protein PopW is used
＜130〉specification sheets
<160>6
<170>PatentIn?version?3.1
<210>1
<211>26
<212>DNA
＜213〉synthetic
<220>
＜221〉amplification popW gene primer popW1 upstream
<222>(1)..(26)
<223>
<400>1
<210>2
<211>27
<212>DNA
＜213〉synthetic
<220>
＜221〉amplification popW gene primer popW1 downstream
<222>(1)..(27)
<223>
<400>2
<210>3
<211>21
<212>DNA
＜213〉synthetic
<220>
＜221〉popW gene primer popW2 upstream
<222>(1)..(21)
<223>
<400>3
<210>4
<211>19
<212>DNA
＜213〉synthetic
<220>
＜221〉amplification popW gene primer popW2 downstream
<222>(1)..(19)
<223>
<400>4
<210>5
<211>27
<212>DNA
＜213〉synthetic
<220>
＜221〉amplification popW gene primer popW3 upstream
<222>(1)..(27)
<223>
<400>5
<210>6
<211>27
<212>DNA
＜213〉synthetic
<220>
＜221〉amplification popW gene primer popW3 downstream
<222>(1)..(27)
<223>
<400>6
Claims (2)
1, the genetically engineered of the new extracellular protein PopW of Ralstonia solanacearum ZJ3721 is used, and comprising:
1) clone of popW gene
Ralstonia solanacearum ZJ3721 is incubated at the MBG substratum under 30 ℃ of conditions, treat that strain growth arrives logarithmic phase, extracts the test kit operation instructions according to bacterial genomes and extracts the Ralstonia solanacearum genomic dna;
Design amplification popW gene primer popW1:
Upstream primer F:CG
CATATGTCCATCCAGATTGATCGC Nde I
Downstream primer R:GC
AAGCTTGCCCGAGTAGGCCTTGTAG Hind III
Or amplification popW gene primer popW2:
Upstream primer F:ATG TCC ATC CAGATTGATCGC
Downstream primer R:GCCCGAGTAGGCCTTGTAG
Or amplification popW gene primer popW3:
Upstream primer F:TC
TAGAATGTCCATCCAGATTGATCGC Xba I
Downstream primer R:
GGATCCGCCCGAGTAGGCCTTGTAGCT BamH I
With the genomic dna is template, uses the coding region sequence of high-fidelity pfu polymeric enzymatic amplification PopW, and amplification program is: 94 ℃ of pre-sex change 4min, and 94 ℃ of sex change 30s, 60 ℃ of renaturation 1min, 72 ℃ are extended 1min, and after 30 circulations, 72 ℃ of 10min, product cut glue and reclaim;
2) proteic expression of PopW and purifying
Product cut add after glue reclaims be connected to that the intermediate carrier enzyme is cut behind the A or direct enzyme cutting after be connected to protein expression vector pET30a (+) carrier, order-checking is identified, obtain recombinant plasmid pET-popW, be converted into then in the e. coli bl21 (DE3) and carry out protein expression, the positive colony that screens is inoculated in the test tube that contains the LB liquid nutrient medium, 37 ℃, overnight incubation under 180 rev/mins of conditions, ratio in 1:100 was inoculated among the 10mL LB in second day, cultivated 3 hours according to above-mentioned condition, adding inductor sec.-propyl-β-D thiogalactoside then, to make its final concentration be 1mM, behind the inducing culture 2 hours, under 4 ℃, 6000 leave the heart collected thalline in 10 minutes, it is suspended in 20mMTris-HCl, pH8.0, adding final concentration is the phenylmethylsulfonyl fluoride of 1mM, carry out bacterial cell disruption on the ultrasonic disruption instrument then, when bacterium liquid becomes clarification, centrifugal absorption supernatant, carrying out polyacrylamide gel electrophoresis detects, and with ni-sepharose purification PopW albumen, concrete operations are carried out with reference to High-Affinity Ni-IDA Resin process specifications, obtain purifying PopW albumen.
2, use according to the genetically engineered of the new extracellular protein PopW of claim 1 Ralstonia solanacearum ZJ3721, it is characterized in that the application of purifying PopW albumen aspect disease resistance of plant of acquisition.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2009100291186A CN101457228A (en) | 2009-01-13 | 2009-01-13 | Genetic engineering application of ralstonia solanacearum novel extracellular protein PopW |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2009100291186A CN101457228A (en) | 2009-01-13 | 2009-01-13 | Genetic engineering application of ralstonia solanacearum novel extracellular protein PopW |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101457228A true CN101457228A (en) | 2009-06-17 |
Family
ID=40768348
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2009100291186A Pending CN101457228A (en) | 2009-01-13 | 2009-01-13 | Genetic engineering application of ralstonia solanacearum novel extracellular protein PopW |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101457228A (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101974451A (en) * | 2010-09-16 | 2011-02-16 | 南京农业大学 | PopW antibacterial protein and pseudomonas fluorescens mixed biological preparation PopW-PF1 |
| CN105112555A (en) * | 2015-10-08 | 2015-12-02 | 中国烟草总公司郑州烟草研究院 | Tobacco bacterial wilt real-time fluorescence quantitative PCR detection kit and detection method |
| CN108504672A (en) * | 2018-03-30 | 2018-09-07 | 南京农业大学 | Ralstonia solanacearum N477 extracellular proteins PHD and its encoding gene and application |
| CN114600880A (en) * | 2022-02-08 | 2022-06-10 | 南京农业大学 | Wettable powder of PopW protein and application thereof |
| WO2022142978A1 (en) * | 2020-12-31 | 2022-07-07 | 吴伯骥 | Use of hrpw-type multi-mimotope ligandins in food products, cosmetics, health products or pharmaceuticals |
| CN114762724A (en) * | 2020-12-31 | 2022-07-19 | 吴伯骥 | Application of HrpWEch protein in pharmacy for recognizing and activating multiple types of receptors and/or membrane proteins and signal paths thereof |
-
2009
- 2009-01-13 CN CNA2009100291186A patent/CN101457228A/en active Pending
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101974451A (en) * | 2010-09-16 | 2011-02-16 | 南京农业大学 | PopW antibacterial protein and pseudomonas fluorescens mixed biological preparation PopW-PF1 |
| CN101974451B (en) * | 2010-09-16 | 2013-01-02 | 南京农业大学 | PopW antibacterial protein and pseudomonas fluorescens mixed biological preparation PopW-PF1 |
| CN105112555A (en) * | 2015-10-08 | 2015-12-02 | 中国烟草总公司郑州烟草研究院 | Tobacco bacterial wilt real-time fluorescence quantitative PCR detection kit and detection method |
| CN108504672A (en) * | 2018-03-30 | 2018-09-07 | 南京农业大学 | Ralstonia solanacearum N477 extracellular proteins PHD and its encoding gene and application |
| WO2022142978A1 (en) * | 2020-12-31 | 2022-07-07 | 吴伯骥 | Use of hrpw-type multi-mimotope ligandins in food products, cosmetics, health products or pharmaceuticals |
| CN114762724A (en) * | 2020-12-31 | 2022-07-19 | 吴伯骥 | Application of HrpWEch protein in pharmacy for recognizing and activating multiple types of receptors and/or membrane proteins and signal paths thereof |
| CN114600880A (en) * | 2022-02-08 | 2022-06-10 | 南京农业大学 | Wettable powder of PopW protein and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102660560B (en) | Artificially synthesized Bt insect-resistant gene Cry1F-t and application thereof | |
| CN102010873B (en) | Artificially synthesized Bt insect-resistant gene Cry1Ab-t and application thereof | |
| CN101457228A (en) | Genetic engineering application of ralstonia solanacearum novel extracellular protein PopW | |
| CN102010466A (en) | Plant resistance associated protein MYB, as well as coding gene and application thereof | |
| RU2684719C2 (en) | Protein associated with resistance to disease and encoding its genes and their application in the regulation of plant resistance to diseases | |
| CN101358190A (en) | Artificial synthetic high gene order expression high virulence protein for lepidoptera pest and use thereof | |
| CN102268448A (en) | Expression equipment for expressing heterologous protein in Trichoderma reesei cell, and gene engineering bacteria | |
| CN111454924A (en) | Trichoderma viride histone acetylase encoding gene TvGCN5 and application thereof | |
| CN113388017B (en) | Drought-resistant protein and application of coding gene thereof in cultivating drought-resistant plants | |
| CN108504672B (en) | Ralstonia solanacearum N477 extracellular protein PHD and coding gene and application thereof | |
| CN101481410A (en) | Drought resisting related transcription factor of cotton, and encoding gene and use thereof | |
| CN1936002A (en) | Method for separating bidirectional promoter and its use | |
| CN109305996A (en) | Fusarium graminearum secreted protein exciton FgHrip1 and its application | |
| CN103254301B (en) | Plant disease resistance related protein GbMBL1, its coding gene and application | |
| CN108384792A (en) | Tomato SlCYP724B2 genes and its application | |
| CN101003571A (en) | Plant against disease relevant protein SGT1, and coding gene, and application | |
| CN102206662B (en) | miR399 fusion gene, construction method thereof and application thereof in plant breeding | |
| CN1323169C (en) | Artificially synthesized Bt cry8 gene sequence with high toxicity on Coleoptera pests | |
| CN112795578B (en) | Magnaporthe grisea MoPTEN gene and application thereof | |
| CN101413007B (en) | Bacillus thuringiensis cry8 I genes and protein effective for Coleopteran pests, and uses thereof | |
| CN111778266A (en) | Quorum sensing signal molecule degradation gene AidF, degradation enzyme AidF coded by same and application of quorum sensing signal molecule degradation gene AidF | |
| CN114276424B (en) | Method for improving growth of termitomyces albuminosus hyphae through over-expression gene hmg | |
| CN114574513B (en) | Multi-main corynespora CcTLS2 protein and coding gene and application thereof | |
| CN102584960B (en) | Bt (Bacillus thuringiensis) protein Cry70Aa1 as well as encoding gene and application thereof | |
| CN106967727B (en) | Rape photosynthetic efficiency related gene perg, preparation method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20090617 |