CN117535301A - PagVQ13 gene and application thereof in resisting poplar fungus infection - Google Patents

PagVQ13 gene and application thereof in resisting poplar fungus infection Download PDF

Info

Publication number
CN117535301A
CN117535301A CN202311274693.9A CN202311274693A CN117535301A CN 117535301 A CN117535301 A CN 117535301A CN 202311274693 A CN202311274693 A CN 202311274693A CN 117535301 A CN117535301 A CN 117535301A
Authority
CN
China
Prior art keywords
poplar
gene
pagvq13
infection
musiva
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202311274693.9A
Other languages
Chinese (zh)
Inventor
严涵薇
吴静
谈丽娜
项艳
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Anhui Agricultural University AHAU
Original Assignee
Anhui Agricultural University AHAU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Anhui Agricultural University AHAU filed Critical Anhui Agricultural University AHAU
Priority to CN202311274693.9A priority Critical patent/CN117535301A/en
Publication of CN117535301A publication Critical patent/CN117535301A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8282—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for fungal resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/415—Assays involving biological materials from specific organisms or of a specific nature from plants

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biomedical Technology (AREA)
  • Analytical Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Hematology (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Botany (AREA)
  • Urology & Nephrology (AREA)
  • Plant Pathology (AREA)
  • Mycology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention belongs to the technical field of plant biology, and particularly relates to a VQ13 gene and application thereof in resisting poplar fungus infection, wherein the PtMAPK3-1 gene is found to be a poplar MAPK cascade gene family member through bioinformatics analysis, the MAP K3-1 gene plays an important role in the stress resistance and disease resistance process of poplar, the interaction protein PagVQ13 of PagMAPK3-1 is predicted through protein interaction database and expression pattern analysis, and the interaction relationship between the PagMAPK3-1 and the VQ13 is verified through yeast double hybridization and BiFC experiments. According to the invention, through constructing an expression vector and transgenic agrobacterium tumefaciens to over-express VQ13, the in-vivo ROS of poplar over-expressing VQ13 accumulates after S.musiva infection, so that nutrition is provided for further infection and propagation of pathogenic fungi in plants, and the PagVQ13 in K8 poplar has a negative regulation and control effect in the poplar disease resistance reaction. The invention provides a molecular marker for screening the disease-resistant poplar varieties and a regulating and controlling means for improving the disease resistance of poplar.

Description

PagVQ13 gene and application thereof in resisting poplar fungus infection
Technical Field
The invention belongs to the technical field of plant biology, and particularly relates to a PagVQ13 gene and application thereof in resisting poplar fungus infection.
Background
With the increasing economy and population, the demand for wood product resources and bioenergy raw materials by humans is increasing, however, the productivity of forests is limited due to the rise in temperature, the limited availability of water resources and the increased probability of natural disasters occurring. The poplar has the advantages of high growth speed, strong adaptability, short rotation period and the like, and is widely planted in the global scope as a board and a paper pulp. However, long-term large-area poplar planting, poplar is also subject to a large number of insect pest infestations. Ulcers and leaf spots caused by Sphaerulina musiva (coccidioides sp. S. Musiva) can lead to premature defoliation, reduced photosynthetic area and stem breakage of poplar, not only reducing annual yield of wood, but more seriously leading to death of poplar and failure of forestation. Poplar leaf spot is a disease caused by fungi and mainly infects poplar and related plants. A fungus of the genus sphaerella (sph.) is one of the pathogenic bacteria of the leaf spot, which can cause defoliation and rot of plants, leading to yield loss in light persons and death in heavy persons. Sphaerulina musiva can cause leaf spot and canker in poplar. It is native to eastern populus americana (Populus deltoides) and causes only leaf spot symptoms. On a hybrid poplar that is susceptible to infection, s.musiva can cause leaf necrosis, cause early leaf fall, and cause ulcers on stems and branches, thereby reducing the growth rate, making the tree susceptible to colonization by microorganisms. There is currently no way to prevent the spread of s.musiva in poplar planting areas, once s.musiva has spread into an area, it is difficult to remove the fungus. At present, chemical and biological control measures can greatly reduce the incidence of poplar, and in addition, the creation of disease-resistant transgenic poplar is another effective means for controlling poplar diseases. Chinese patent No. CN202210837131.X proposes over-expression of PtoCXE06 gene in poplar to enhance resistance of poplar to Populus rotten skin bacteria. Chinese patent CN202211588272.9 found the effector protein SmCSEP3 in s.musiva infection in poplar and proposed transient expression or overexpression of SmCSEP3 in poplar to enhance poplar resistance to s.musiva infection. Therefore, the genetic engineering technology and plant disease resistance are combined, the research of the disease resistance of poplar is developed, the relevant regulation and control mechanism of disease resistance is explored, and the method has important significance for improving the survival rate of artificial forest of poplar, increasing the wood yield and protecting landscape ecology.
VQ proteins are a hotspot in research in recent years, and more researches indicate that VQ proteins are involved in plant disease-resistant reactions. AtVQ23/SIB1 (sigma factor binding protein 1) is the first found VQ protein in Arabidopsis thaliana, and overexpression of SIB1 in Arabidopsis thaliana results in activation of defense-related genes such as glutathione transferase (glut athione transferase) by plants after pathogen infection or SA and JA treatment, thereby enhancing resistance to Pseudomonas syringae infection; in rice, osVQ14 and OsVQ32 can act as substrates of OsMPKK6-OsMPK4 cascade, and the resistance of rice to bacterial blight (Xanthomonas or yzae pv. Oryzae) is enhanced. Overexpression of SIVQ5 in tomato may enhance resistance of tomato to botrytis cinerea.
Disclosure of Invention
At present, aiming at S.musiva infection, related infection, disease resistance genes and internal signal paths of poplar are explored, and researches for improving the antifungal capability of the poplar by adopting a genetic engineering method are relatively few and further penetration is needed. The invention aims at exploring related mechanism mechanisms and providing more means for improving the disease resistance of poplar.
Based on the above, the invention provides the following technical scheme:
in one aspect, the invention provides a negative regulation gene for poplar disease resistance, wherein the gene is PagVQ13, and the nucleic acid sequence of the gene is shown as SEQ ID NO. 6; or the nucleic acid sequence has more than 97% of identity with SEQ ID NO. 6.
In one aspect, the invention provides an expression vector, which contains PagVQ13 gene, wherein the sequence of the PagVQ13 gene is shown as SEQ ID NO.6, or the nucleic acid sequence has more than 97% of identity with SEQ ID NO. 6. The expression vector can be a prokaryotic expression vector or a eukaryotic expression vector.
In one aspect, the invention provides a genetically engineered bacterium, wherein the genetically engineered bacterium comprises the expression vector. Preferably, the engineering bacteria are one of escherichia coli and agrobacterium tumefaciens.
In one aspect, the invention provides the use of the PagVQ13 gene as a screening marker for poplar infection resistance to S.musiva bacteria. Preferably, the Yang Shuwei populus tomentosa or 84K populus tomentosa.
When PagVQ13 gene expression of the tested variety is obviously higher than the expression level of wild poplar K8, the variety is a variety with poor S.musiva bacterial infection disease resistance; when PagVQ13 gene expression of the tested variety is obviously lower than the expression level of wild poplar K8, the variety is a variety with better disease resistance of S.musiva bacterial infection.
In one aspect, the invention provides a method for improving the infection resistance of poplar to S.musiva bacteria, by transient transfection or stable transfection, to reduce PagVQ13 gene expression in poplar.
Advantageous effects
The invention discovers that under the stress of salt, drought and M.brunnea fungi, the transcription levels of PtMAPK3-1, ptMKK7, ptMKK9 and PtRaf23-1 under various biotic and abiotic stresses are obviously changed through genomics analysis, and particularly PtMAPK3-1 can respond to various adverse effects to be a novel MAPK family member, the interaction protein PagVQ13 of PagMAPK3-1 is predicted through protein interaction database and expression pattern analysis, the interaction relation between MAPK3-1 and VQ13 is verified through yeast two-hybrid and BiFC experiments, and PtVQ13 interacts with PtMAPK3-1 and participates in the defense reaction of poplar after infection of subglobaria fungi.
After S.musiva inoculation is carried out on the transgenic poplar of the over-expression PagVQ13, the transgenic poplar shows more necrotic lesions, and the physiological and biochemical index detection of DAB dyeing, PAL activity, CAT activity, POD activity, MDA content and the like further shows that the PagVQ13 plays a negative regulation role in the disease resistance reaction of the poplar, thereby providing a molecular marker for screening the disease-resistant poplar varieties and a regulation means for improving the disease resistance of the poplar.
Drawings
Fig. 1: gel electrophoresis analysis after PCR amplification of PagMAPK3-1 gene.
Fig. 2: prediction of the interaction protein of PtMAPK 3-1.
Fig. 3: expression profiling of PtMAPK3-1 and PtVQs after pathogen infection, wherein (a) S.musiva and (b) S.populicola were analyzed after days 0, 1, 4, 15 after infection.
Fig. 4: yeast two-hybrid analysis of PagMAPK3-1 and PagVQ 13.
Fig. 5: and (3) PCR electrophoresis detection of PagVQ13 transgenic poplar genome.
Fig. 6: and detecting the expression quantity of PagVQ13 over-expressed transgenic poplar genes.
Fig. 7: phenotypic analysis of PagVQ13 transgenic poplar post s.musiva inoculation, wherein (a) plaque growth after s.musiva inoculation; (b) Histogram of lesion area statistics
Fig. 8: physiological and biochemical index detection after two days of S.musiva inoculation of PagVQ13 transgenic poplar, wherein (a) DAB staining, (b) PAL activity, CAT activity, POD activity and MDA content are detected.
Detailed Description
In the invention, plant material hybrid poplar 84K (Populus alba multiplied by Populus glandulosa) is given by Wang Liujiang teacher in China forestry sciences; other molecular biological reagents are conventional reagents except special descriptions and come from biological reagent companies on the market, and related biological operation methods are referred to the "molecular cloning experiment guidelines" (J. Sam Broker, D.W. Lassel, editions of science Press) except the special descriptions.
Example 1: identification of poplar MAPK cascade Gene family Member
Genomic data for the populus tomentosa genome assembly versions v1.0 and v3.0 were obtained from the Phycomsm database (http:// genome. Jgi-psf. Org/Poptr 1.Home. Html) and the Phytozome database (https:// phytzome. Jgi. Doe. Gov/pz/portal. Html). According to previous studies, protein sequences of 21 PtMAPKs and 11 PtMA PKKs in the poplar genome v1.0 version were obtained (Hamel L P, nicole M C, sritubtim S, et al, animal signature: comparativ e genomics of plant MAPKand MAPKK gene families [ J ]. Trends in plant science,2006,11 (4): 192-198.); ptMAPKs (i.e., the MAPKs of populus carpus) and PtMAPKKs gene IDs were obtained in the v3.0 version of the protein pool of populus carpus by BLAST tools in TBtools using these 32 protein sequences as query sequences. To determine potential members of the PtMAPKKK gene family, the genomic and protein sequences of populus tomentosa were downloaded from the plant genome database (https:// phytozome. Jgi. Doe. Gov/pz/portal. Html). BLAST searches of the protein database of Poplar were performed using the queried protein sequence of MAPKKK of Arabidopsis, jujube, jatropha, kiwi as query sequence. Subsequently, genes containing serine/threonine protein kinase domain (PF 00069) in populus tomentosa were searched using Hidden Markov Model (HMM). Comparing the genes obtained by BLAST search and HMM search, removing genes that cannot meet both conditions, and removing redundant transcripts. Finally, the gene numbers of 21 PtMAPKs and 11 PtMAPKKs in the new version are obtained. In order to better understand the gene expression level of MAPK cascade gene response stress, the invention obtains transcriptome data related to poplar abiotic stress (drought and salt) and biological influence (Marssonina brunnea infection) from a GEO database of NCBI, and as a result, ptMPK3-1, ptMKK9, ptMKK7 and PtRaf23-1 are obviously up-regulated after pathogenic bacteria are infected, and PtMAPK3-1 responds to various stresses. Based on the gene, the MAPK3-1 gene is an important candidate gene for stress resistance and disease resistance of poplar.
EXAMPLE 2 cloning and analysis of the PagMAPK3-1 Gene, a Poplar MAPK Cascade Gene family Member
The inventors studied the relationship of MAPK3-1 gene in the Chinese poplar variety 84K poplar, based on the results of the genomic analysis of the Populus deltoides in example 1, mainly in foreign poplar varieties.
PagMAPK3-1 was cloned using the full-length cDNA of 84K poplar as a template, and the related primers used in the PCR experiments were as follows:
PagMAPK3-1-F：ATGGCGAATTATGCACAGGGAAATG(SEQ ID NO.1)
PagMAPK3-1-R：CTAGCATGCATATTCTGGATTAAGTGC(SEQ ID NO.2)
the PCR product was recovered by gel, and the recovered PCR product was ligated to cloning vector pEasy-BluntSimple to transform E.coli.
Analysis of results: the PCR products were isolated by 1% agarose gel electrophoresis gel purification and showed a bright and single band between 2000bp and 1000bp (FIG. 1). The genome sequence annotation shows that the PagMAPK3-1 gene has a size of 1116bp, and the success of the PagMAPK3-1 gene amplification is primarily demonstrated. The bright gel blocks are cut out for gel recovery and then connected with cloning vectors, and the cloning vectors are sent to a sequencing company for sequencing. The sequencing results are compared through DNAMAN software, and the results show that the sequences are consistent, and the cloning success of the target gene is proved. Alignment of PagMAPK3-1 and PtMAPK3-1 sequences revealed that CDS sequences of MAPK3-1 in Populus deltoides and 84K Populus deltoides differ by 8 bases and that there is a difference of 3 amino acids after translation into proteins.
The sequence of the 84K poplar PagMAPK3-1 gene is shown as SEQ ID NO.3, and the size of the PagMAPK3-1 gene is 1116bp.
Example 3 screening and validation of poplar MAPK3-1 interacting proteins
3.1 acquisition and analysis of transcriptome data
Transcriptome data after infection of poplar with leaf spot pathogens Sphaerulina musiva and Sphaerulina populicola were obtained from the GEO database of the NCBI website. The original Counts value is converted into an FPKM value through an R language, the FPKM value of the target gene is extracted through Excel, and finally Log2 logarithmic transformation is carried out on the FPKM value through TBtools and the FPKM value is displayed in a heat map mode.
3.2 protein interaction prediction
And submitting the protein sequence of the target gene through a STRING protein interaction prediction website (https:// cn. STRING-db. Org /), so as to obtain a protein interaction network diagram.
Studies have shown that MAPK proteins can interact with VQ proteins to participate in plant growth, biotic and abiotic stress responses. Because the 84K poplar genome sequence is not recorded in the protein interaction database yet, and the MAPK3-1 sequence similarity in the populus tomentosa and the 84K poplar is very high, the invention submits the protein sequences of PtMAPK3-1 and 51 PtVQ in the populus tomentosa to a STRING protein interaction prediction website. The results indicate that PtMAPK3-1 may interact with 7 PtVQ proteins, ptVQ1, ptVQ13, ptVQ14, ptVQ17, ptVQ32, ptVQ35 and PtVQ47, respectively (see FIG. 2)
Transcriptome data for Yang Shuzai post-sphaerella (Sphaerulina spp.) infection was downloaded in the GEO database of the NCBI website. The expression patterns of PtMAPK3-1 and 51 PtVQ genes were clustered by heat pattern, and the results showed that PtMAPK3-1, potri.003G194700 (PtVQ 13) and Potri.006G 03300 (PtVQ 24) were all clustered on the same clade in both treatments after S.musiva and Sphaerulina populicola infection, and the expression amounts of these three genes were all increased (FIG. 3). In addition, it was found from the heat map that PtVQ13 was expressed at a significantly higher level than other genes at the 15 d-th gene after infection with pathogenic bacteria. Based on this, the present invention speculates that PtVQ13 interacts with PtMAPK3-1 and is co-involved in the defense response of poplar after infection with the genus Pachysococcidiosis.
3.3MAPK3-1 and VQ13 interaction yeast two-hybrid validation:
(1) PagVQ13 gene cloning and cloning vector construction, cloning PagVQ13 gene by using PagVQ13 cloning primer, connecting to cloning vector pEasy-blue Simple, transforming colibacillus, picking spot, shaking bacteria, sending test, extracting plasmid and other steps to obtain recombinant plasmid. The cloning primer:
PagVQ13-F：ATGGATGTACTTGGGGCTAACATGAA SEQ ID NO.4
PagVQ13-R：TTAATTAAGCACATCTAACTGAAAAGATTCATGAAAAAG SEQ ID NO.5
the PagVQ13 gene has a sequence shown in SEQ ID NO. 6.
According to pGBKT7 vector map, a VQ13 transcriptional active vector construction primer is designed as shown in the following table:
the plasmid extracted from the transformed escherichia coli is used as a template, the primer PagVQ13-BD-F, pagVQ13-BD-R is used for amplification, PCR primers are collected, then the PCR products and pGBKT7 are respectively subjected to enzyme digestion, connection and transformation, the escherichia coli is transformed, and the steps of spot picking, fungus shaking, delivering and measuring, plasmid extraction and the like are carried out to obtain the recombinant plasmid.
(2) According to pGADT7 vector map, pagMAPK3-1 transcriptional active vector construction primers are designed, and the primers are shown in the following table:
performing PCR amplification by using the transformed escherichia coli in the example 2 as a template to obtain PagMAPK3-1 gene amplification products, collecting PCR products, respectively performing enzyme digestion with pGADT7, connecting to construct an expression vector, transforming the transformed escherichia coli, and performing the steps of spot picking, fungus shaking, delivering and measuring, plasmid extraction and the like to obtain recombinant plasmids.
(3) (1) 4. Mu.l pGADT7, 6. Mu.l pGBKT7-PagVQ13 plasmid (negative control) were aspirated and co-added to 50. Mu. lY2HGold competent cells; mu.l pGBKT7-53, 4. Mu.l pGADT7-T plasmid (positive control) were pipetted together into 50. Mu. l Y2HGold competence; mu.l pGBKT7-PagVQ13, 4. Mu.l pGADT7-PagMAPK3-1 (experimental group) were pipetted together into 50. Mu. l Y2HGold competent cells. Subsequently, sequentially adding 5 μl of Carrier DNA and 250 μl of PEG/LiAc into the tube, and blowing to mix the reagents; placing into a metal bath at 30deg.C for reaction for 30min, taking out the centrifuge tube and turning over for 10 times at 15min, placing into a metal bath at 42deg.C for reaction for 15min, and turning over for 10 times at 7.5 min; centrifugation at 5000rpm for 1min, discarding supernatant, resuspending plaques with 400 μlddH2O, followed by centrifugation at 5000rpm for 1min, discarding supernatant, resuspending plaques with 50 μlddH 2O; respectively coating the transformed bacterial liquid on a two-notch plate (SD/-Leu/-Trp), and culturing in a yeast incubator at 30 ℃ for 2-3 d;
(2) picking single colony in 3ml YPDA liquid culture medium, culturing in shaking table at 30deg.C and 250rpm for 12 hr, and taking out yeast liquid; taking 1ml of yeast liquid, centrifuging at 500rpm for 5min in a 1.5ml centrifuge tube, discarding supernatant, re-suspending bacterial plaque with 0.9% physiological saline, repeating for one time, and finally adding 500 μl of 0.9% physiological saline for re-suspending;
(3) taking 10 mu l of yeast liquid into a 1.5ml centrifuge tube, adding 90 mu lddH2O which is diluted 10 times of the yeast liquid, sucking 10 mu l of yeast liquid after 10 times of dilution, adding 90 mu l of ddH2O which is diluted 100 times of the yeast liquid, and diluting the yeast liquid to 1000 times according to the operation; sequentially taking 5 mu l of original concentration bacterial liquid, diluting 10 times, 100 times and 1000 times bacterial liquid on a double-deficiency plate (SD/-Leu/-Trp) and a quadruple-deficiency plate (SD/-Trp/-His/-Leu/-Ade) in an ultra-clean workbench, sealing the plates after the bacterial liquid is spotted, wrapping tinfoil on the quadruple-deficiency plate, and culturing in a yeast incubator at 30 ℃ for 2-3 days to observe the growth condition of bacterial plaques.
Results: the invention verifies the interaction relationship between PagMAPK3-1 and PagVQ13 through a yeast two-hybrid system. The experimental group (pGBKT 7-PagVQ13+pGADT7-PagMAPK 3-1), the positive control (pGBKT 7-53+pGADT7-T) and the negative control (pGADT 7+pGBKT7-PagVQ 13) were transferred to Y2HGold yeasts, and cultured on the two-and four-defect plates (SD/-Leu/-Trp/-His/-Ade/X-alpha-Gal) and the four-defect plates were cultured in the dark. Results: as shown in FIG. 4, both the experimental and control groups grew normally on the two-missing plates, indicating successful co-transfer of plasmids from each group into yeast. On the quadruple plates, both positive and experimental groups grew normally and turned blue, negative controls did not grow, and remained consistent with controls after 10, 100 and 1000-fold dilutions. This suggests that PagMAPK3-1 and PagVQ13 interact in yeast systems.
Example 4 identification of disease resistance function of overexpressed transgenic poplar
4.1 obtaining of overexpressing transgenic lines
(1) Vector construction
Constructing PagVQ13 overexpression vector by Gateway technology:
a. the gateway linker was added to the F, R end of the PagVQ13 gene cloning primer, and the PagVQ13 cloning vector constructed in example 3 was used as a template for cloning, and the sequence of the linker added primer was as follows:
then, carrying out PCR product gel recovery;
b. the PCR product was cloned into the intermediate vector pDONR207 by BP reaction, the reaction system was as follows:
reagent(s) Dosage of
PCR products 150ng
Carrier body 75ng
BP enzyme 0.8μl
And (3) connecting at 25 ℃ for 6 hours, then carrying out PCR product gel recovery, transformation and sequencing.
c. After the construction and sequencing of the intermediate vector in the last step are correct, two genes are constructed on the overexpression vector pMDC32 by utilizing an LR reaction, and the reaction system is as follows:
reagent(s) Dosage of
PCR products 150ng
Carrier body 75ng
LR enzyme 0.8μl
The PCR products were recovered, transformed, sequenced, plasmid extracted and finally introduced into Agrobacterium competent cells GV3101 after 6h ligation at 25 ℃.
(2) Genetic transformation of poplar:
a. adding the agrobacterium obtained in the step (1) into LB culture medium containing corresponding Kan and Rif for amplification to ensure that the OD600 value reaches about 0.6;
b. placing the cut 84K poplar leaves with wounds into the bacterial liquid of the previous step in an ultra-clean workbench, and horizontally shaking the table for about 20min at a low speed;
c. the infected leaves are dried by sucking redundant bacterial liquid and then placed into a differentiation culture medium, and the infected leaves are subjected to dark culture for 2d at 24 ℃;
d. after 2d of dark culture, transferring the leaves into a screening culture medium containing hygromycin and timentin for screening, wherein resistant buds generally appear about 20 d;
e. cutting out the resistant bud seedling, transferring the cut resistant bud seedling into rooting culture medium containing the same resistance, propagating after rooting, and detecting the expression quantity.
Differentiation medium system 1L:
screening media system 1L: differentiation medium 1L, after sterilization, cooled to 50℃and hygromycin (0.0003 g/L) and timentin (0.2 g/L) were added under an ultra clean bench.
Rooting medium system 1L:
hygromycin (0.0003 g/L) and timentin (0.2 g/L) were added under an ultra clean bench after cooling to 50℃after sterilization.
(3) Genome PCR validation:
the poplar genome is extracted by a CTAB method, and then PCR experiment is carried out by taking the extracted genome as a template to detect PagVQ13 genes. The positive control group was over-expression vector plasmid. After the PCR reaction is finished, gel electrophoresis detection is carried out, and the plants with PCR bands at the positions corresponding to the positive control can be positive plants (see figure 5).
(4) Analysis of the relative expression levels of positive lines:
RNA of positive plants is extracted and reverse transcribed respectively, and the obtained cDNA is used as a template for qRT-PCR experiments. The relative expression level of the target gene in each strain was detected by qRT-PCR experiments.
The results show that: pagVQ13 over-expressed transgenic lines, the PagVQ13 gene expression levels of OE-4 and OE-5 were 20 times higher than that of WT (see FIG. 6), and thus these two lines were selected for subsequent analysis.
EXAMPLE 5 disease resistance study of PagVQ13 transgenic poplar
5.1 S. musiva infection
S.musiva bacteria are separated from leaf-spot-disease populus tomentosa leaves, cultured by using a PDA culture medium, mycelium is scraped by a gun head or an inoculating needle, and dissolved by using a sterile 0.05% Tween 80 aqueous solution, the number of middle spores of spore suspension is regulated, healthy leaves of transplanted poplar seedlings are adopted, the healthy leaves are placed in a culture dish paved with wet gauze, the back surfaces of the leaves face upwards, and 25 mu l of prepared spore suspension is dripped at the positions, which avoid the veins, on the two sides of the leaves. The dishes were placed in a 25℃incubator for dark culture, and the onset of the disease was observed daily.
Results: observation of the condition of lesions after 4 days of inoculation of S.musiva spore suspensions on 84K poplar (wild type control WT), pagVQ13 transgenic poplar leaves, respectively, as shown in FIG. 7, WT 84K poplar leaves showed slight lesions on the sixth day after inoculation with S.musiva, whereas PagVQ13 transgenic poplar leaves had more necrotic areas than WT. After statistical analysis of the lesion size after the sixth day of inoculation of the germ, it was found that the lesion sizes of OE-4 and OE-5 were significantly higher than WT. The above results indicate that overexpression of PagVQ13 reduces resistance of poplar to s.musiva.
5.2 measurement of physiological Biochemical index
Plants rapidly accumulate Reactive Oxygen Species (ROS) after being stressed by pathogenic bacteria, and the accumulation of reactive oxygen species in large amounts can lead to death of plant cells. Thus, plants activate antioxidant enzymes such as Catalase (CAT), peroxidase (POD), and PAL (phenylalanine enzyme) in the body in order to clear excessive ROS. Malondialdehyde (MDA) is one of the common indicators of the extent to which plants are subjected to oxidative stress, and reflects the extent to which plant membrane lipids are peroxidized. DAB staining of leaves of WT, OE-4 and OE-5 plants the following day after S.musiva inoculation allows detection of ROS, H, in plants 2 O 2 Accumulation of conditions.
(1) CAT (catalase), POD (peroxidase) activity assay, PAL (phenylalanine enzyme), wherein POD, CAT detection method reference: maehly A C, chance B.the assay of catalases and peroxidases [ J ]. Methods of Biochemical Analysis,1954,1:357-424.PAL detection methods reference: beaudoin-Eag an LD, thorpe TA. Tyrosine and phenylalanine Ammonia Lyase activities during shoot initi ation in tobacco callus cultures.plant Physiol.1985;78:438-41.
(2) MDA content measurement: the malondialdehyde content was determined using the thiobarbituric acid method, and the specific experimental method was referred to the "plant physiology experiments course" published by 2017 science publishers, by Wang Sangen.
(3) DAB staining: the poplar leaves in the affected area are placed in a 50ml centrifuge tube, and DAB dye solution is added to submerge the leaves. Shaking the mixture for 4-7h under the condition of avoiding light at 25-28 ℃ and 80r/min, adding a decolorizing solution (the decolorizing solution is prepared by ethanol: acetic acid: glycerol=3:1:1) after removing the dye solution, and decolorizing the mixture for 15min by transferring the centrifuge tube into a constant temperature water tank (95 ℃), wherein the decolorizing solution can be replaced for 1-2 times.
Each of the above indicators was taken as a leaf of poplar in the disease area, 3 replicates per sample, and histogram and ANOVA difference significance analysis was presented with GraphPad Prism 5 software (p <0.05; p < 0.01).
Results:
as shown in fig. 8 (b), the PAL, CAT and POD activity assays showed an increase in PAL, CAT, POD activity for wild-type poplar (WT) while PAL and POD activity for the over-expressed PagMAPK3-1 transgenic poplar decreased and were significantly lower than WT.
Referring to FIG. 8 (b), the MDA content of the transgenic lines after pathogen treatment was significantly higher than that of WT plants.
Referring to FIG. 8 (a), on the next day after S.musiva inoculation, yellow brown precipitations were generated in leaves of WT, OE-4 and OE-5 plants, indicating that after S.musiva infection of poplar, active oxygen accumulation of plants could be induced. Fewer precipitants in WT leaves than in two transgenic plants, indicating that overexpressing PagMAPK3-1 transgenic poplar caused more cell death and H after S.musiva invasion 2 O 2 The accumulation provides nutrition for further infection and propagation of pathogenic fungi in plants.
The foregoing is a further elaboration of the present invention in connection with the detailed description, and it is not intended that the invention be limited to the specific embodiments shown, but rather that a number of simple deductions or substitutions be made by one of ordinary skill in the art without departing from the spirit of the invention, should be considered as falling within the scope of the invention as defined in the appended claims.

Claims (8)

1. A negative regulation gene for poplar disease resistance is characterized in that the gene is PagVQ13, the nucleic acid sequence of which is shown as SEQ ID NO.6, or the nucleic acid sequence has more than 97% of identity with SEQ ID NO. 6.
2. An expression vector is characterized in that the expression vector contains PagVQ13 gene, the sequence of the PagVQ13 gene is shown as SEQ ID NO.6, or the nucleic acid sequence has more than 97% of identity with SEQ ID NO. 6.
3. A genetically engineered bacterium, wherein the engineered bacterium comprises the expression vector of claim 2.
4. The engineered bacterium of claim 3, wherein the engineered bacterium is agrobacterium tumefaciens.
5. Use of a gene according to claim 1 as a screening marker for poplar infection against s.musiva bacteria.
6. Use according to claim 5, characterized in that said Yang Shuwei populus trichocarpa or 84K populus.
7. The use according to claim 5, wherein the test strain is a strain with poor disease resistance to s.musiva bacterial infection when the PagVQ13 gene expression of the strain is significantly higher than the expression level of wild-type poplar K8; when PagVQ13 gene expression of the tested variety is obviously lower than the expression level of wild poplar K8, the variety is a variety with better disease resistance of S.musiva bacterial infection.
8. A method for improving the infection resistance of poplar against s.musiva bacteria, characterized in that the PagVQ13 gene expression in poplar is reduced by transient transfection or stable transfection.
CN202311274693.9A 2023-09-28 2023-09-28 PagVQ13 gene and application thereof in resisting poplar fungus infection Pending CN117535301A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202311274693.9A CN117535301A (en) 2023-09-28 2023-09-28 PagVQ13 gene and application thereof in resisting poplar fungus infection

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202311274693.9A CN117535301A (en) 2023-09-28 2023-09-28 PagVQ13 gene and application thereof in resisting poplar fungus infection

Publications (1)

Publication Number Publication Date
CN117535301A true CN117535301A (en) 2024-02-09

Family

ID=89786828

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202311274693.9A Pending CN117535301A (en) 2023-09-28 2023-09-28 PagVQ13 gene and application thereof in resisting poplar fungus infection

Country Status (1)

Country Link
CN (1) CN117535301A (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20190194763A1 (en) * 2017-11-13 2019-06-27 Ut-Battelle, Llc Methods of identifying and modulating pathogen resistance in plants
CN116024234A (en) * 2022-12-12 2023-04-28 南京林业大学 Poplar aschersonia aleyrodis effector protein SmCSEP3 and application thereof
CN116064566A (en) * 2022-07-15 2023-05-05 中国林业科学研究院 Poplar bark rot-resistant bacterium gene PtoCXE06 and application thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20190194763A1 (en) * 2017-11-13 2019-06-27 Ut-Battelle, Llc Methods of identifying and modulating pathogen resistance in plants
CN116064566A (en) * 2022-07-15 2023-05-05 中国林业科学研究院 Poplar bark rot-resistant bacterium gene PtoCXE06 and application thereof
CN116024234A (en) * 2022-12-12 2023-04-28 南京林业大学 Poplar aschersonia aleyrodis effector protein SmCSEP3 and application thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
储文渊;王玉娇;朱东悦;陈竹;严涵薇;项艳;: "盐和干旱胁迫下杨树新内参基因的筛选", 林业科学, no. 10, 15 October 2017 (2017-10-15), pages 70 - 79 *

Similar Documents

Publication Publication Date Title
CN110734482B (en) Lilium regale WRKY transcription factor gene LrWRKY4 and application thereof
CN114164217B (en) Application of rice OsSTE24 gene in improving rice blast fungus resistance
CN111574605A (en) Application of rice gene OsLAT5 in regulation of absorption and accumulation of diquat
CN108588041B (en) Gossypium barbadense cytochrome P450 gene, and coding protein and application thereof
CN116514941B (en) MsRGP protein, coding gene thereof and application of MsRGP protein in improving drought resistance and salt tolerance of plants
CN112553222A (en) Hot pepper heat-resistant gene and application thereof
CN109943579B (en) Lilium regale LrCCoAOMT gene and application thereof
CN116064586B (en) Papaya CpWRKY50 gene and application thereof in improving papaya anthracnose resistance
CN114908118B (en) Application of expressed LasRNHI gene and/or CsBBX28 gene and method for prolonging vegetative growth stage of plant
CN114921473B (en) Gene for negative regulation and control of synthesis of endogenous salicylic acid of cassava and application of gene
Li et al. Gene transcription analysis during interaction between potato and Ralstonia solanacearum
CN114231542B (en) bHLH gene influencing salt tolerance of populus deltoides and application thereof
US20240043858A1 (en) A Protein Vapbp2-L For Enhancing Drought Resistance Of Plants And Application Thereof
CN117535301A (en) PagVQ13 gene and application thereof in resisting poplar fungus infection
CN117535317A (en) MAPK gene and application thereof in resisting poplar fungus infection
CN116555279B (en) Gene segment for enhancing lodging resistance of capsicum, coded protein thereof, detection kit, rapid detection method and application
CN116731139B (en) Application of PtoERF15 gene of populus tomentosa in regulation and control of drought resistance of poplar
CN113528558B (en) Application of gene GhSINAs in prevention and treatment of cotton verticillium wilt
CN114958870B (en) Application of GmPTF1a/b gene in regulation and control of soybean nodulation
CN116426548B (en) Tartary buckwheat cytochrome P450 enzyme FtCYP94C1, and coding gene and application thereof
CN116496372B (en) Rice OsGLP8-11 for inhibiting sclerotinia and application thereof
CN116790618B (en) Cloning and application of tartary buckwheat damping-off resistant gene FtEIN3
CN112142831B (en) Jujube witches broom phytoplasma effector gene Zaofeng3 and application
CN117701593A (en) Poplar sugar transport protein gene PagSWEET15b, and encoding protein and application thereof
CN116103322A (en) Functional gene for enhancing resistance of plants to botrytis cinerea infection and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination