CN117512164A - Primers and method for efficiently detecting genome-wide level PREM transposon site - Google Patents
Primers and method for efficiently detecting genome-wide level PREM transposon site Download PDFInfo
- Publication number
- CN117512164A CN117512164A CN202311408280.5A CN202311408280A CN117512164A CN 117512164 A CN117512164 A CN 117512164A CN 202311408280 A CN202311408280 A CN 202311408280A CN 117512164 A CN117512164 A CN 117512164A
- Authority
- CN
- China
- Prior art keywords
- prem
- genome
- dna
- specific primer
- transposon
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 238000000034 method Methods 0.000 title claims abstract description 30
- 240000008042 Zea mays Species 0.000 claims abstract description 19
- 235000002017 Zea mays subsp mays Nutrition 0.000 claims abstract description 19
- 238000012163 sequencing technique Methods 0.000 claims abstract description 16
- 235000005824 Zea mays ssp. parviglumis Nutrition 0.000 claims abstract description 9
- 235000005822 corn Nutrition 0.000 claims abstract description 9
- 108020004414 DNA Proteins 0.000 claims description 25
- 239000012634 fragment Substances 0.000 claims description 17
- 238000012408 PCR amplification Methods 0.000 claims description 12
- 235000016383 Zea mays subsp huehuetenangensis Nutrition 0.000 claims description 10
- 235000009973 maize Nutrition 0.000 claims description 10
- 239000002773 nucleotide Substances 0.000 claims description 10
- 125000003729 nucleotide group Chemical group 0.000 claims description 10
- 238000003780 insertion Methods 0.000 claims description 6
- 230000037431 insertion Effects 0.000 claims description 6
- 102000012410 DNA Ligases Human genes 0.000 claims description 5
- 108010061982 DNA Ligases Proteins 0.000 claims description 5
- 108090000790 Enzymes Proteins 0.000 claims description 2
- 102000004190 Enzymes Human genes 0.000 claims description 2
- 102000003960 Ligases Human genes 0.000 claims description 2
- 108090000364 Ligases Proteins 0.000 claims description 2
- 238000012257 pre-denaturation Methods 0.000 claims description 2
- 238000012216 screening Methods 0.000 claims description 2
- 238000001514 detection method Methods 0.000 abstract description 10
- 238000007481 next generation sequencing Methods 0.000 abstract description 7
- 238000010276 construction Methods 0.000 abstract 1
- 241000196324 Embryophyta Species 0.000 description 3
- 238000004458 analytical method Methods 0.000 description 3
- 238000013461 design Methods 0.000 description 3
- 108091035707 Consensus sequence Proteins 0.000 description 2
- 238000009395 breeding Methods 0.000 description 2
- 230000001488 breeding effect Effects 0.000 description 2
- 210000000349 chromosome Anatomy 0.000 description 2
- 238000009826 distribution Methods 0.000 description 2
- 238000005516 engineering process Methods 0.000 description 2
- 108090000623 proteins and genes Proteins 0.000 description 2
- 108091026890 Coding region Proteins 0.000 description 1
- 102000016911 Deoxyribonucleases Human genes 0.000 description 1
- 108010053770 Deoxyribonucleases Proteins 0.000 description 1
- 241001465754 Metazoa Species 0.000 description 1
- 108091028043 Nucleic acid sequence Proteins 0.000 description 1
- 108020003564 Retroelements Proteins 0.000 description 1
- 230000003321 amplification Effects 0.000 description 1
- 238000000137 annealing Methods 0.000 description 1
- 239000011324 bead Substances 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 230000015572 biosynthetic process Effects 0.000 description 1
- 238000003776 cleavage reaction Methods 0.000 description 1
- 108091036078 conserved sequence Proteins 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 102000054766 genetic haplotypes Human genes 0.000 description 1
- 238000012165 high-throughput sequencing Methods 0.000 description 1
- 238000002743 insertional mutagenesis Methods 0.000 description 1
- 239000007788 liquid Substances 0.000 description 1
- 239000004973 liquid crystal related substance Substances 0.000 description 1
- 238000007403 mPCR Methods 0.000 description 1
- 230000001404 mediated effect Effects 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 239000003147 molecular marker Substances 0.000 description 1
- 238000003199 nucleic acid amplification method Methods 0.000 description 1
- 238000000746 purification Methods 0.000 description 1
- 238000011084 recovery Methods 0.000 description 1
- 230000007017 scission Effects 0.000 description 1
- 241000894007 species Species 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
- 238000009827 uniform distribution Methods 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the field of molecular biology, and particularly provides a primer and a method for efficiently detecting a genome-wide level PREM transposon site. The method provided by the invention is based on NGS sequencing, adopts specific primers, can enrich almost all PREM transposon sites on genome, and has extremely high efficiency. The method provided by the invention can enrich 15000 PREM sites in each corn material, the detection rate is close to saturation, and a high-efficiency scheme is provided for PREM site detection. In addition, the method provided by the invention helps to separate the sites of a single sample from large-scale data after mixed sequencing through the tag sequence on the primer, and is suitable for high-throughput detection; in addition, the invention greatly reduces the cost of library construction and sequencing through mixed PCR and sequencing.
Description
Technical Field
The invention relates to the technical field of molecular biology, in particular to a primer and a method for efficiently detecting a genome-wide level PREM transposon site.
Background
Transposons in plants and animals are widely available, and play an important role in the evolution and domestication of species and the formation of new varieties, and meanwhile, a large number of people make use of transposons to make mutant libraries, make artificial variations and create new crop varieties. Long terminal repeat (Long terminal repeat, LTR) retrotransposons are a class of mobile DNA sequences that are ubiquitous in eukaryotic genomes and which are constantly self-replicating in the genome via a "copy-paste" mechanism, mediated by RNA. In higher plants, many active LTR retrotransposons have been studied in detail and applied to molecular marker technology, gene tagging, insertional mutagenesis, and gene function analysis.
At present, active LTR retrotransposons are found in different plants, more than 10 types of LTR retrotransposons are achieved, PREM (Pollen RetroElement Maize) is the most important LTR transposon found in corn, and belongs to Ty1-copia class, PREM-2 is 9439bp long, and LTR is 1307bp long. Having two gag regions, the coding region has the structure gag-gag-pr-int-rt-rh. The transposon is characterized by a substantially uniform distribution throughout the genome and a copy number of about 30000. In different corn varieties, the copy number of PREM is basically consistent, the coverage is good, and the PREM is suitable for developing a genotype detection tool such as a component mark, a liquid chip and the like, and has strong application potential.
In agricultural breeding, the parents or offspring are required to be scanned for whole genome loci, excellent haplotypes are screened by utilizing genotype differences, and then single molecular markers are developed and applied to breeding. However, existing detection means, including such as SSR markers, indel markers, multiplex PCR, kasp markers, and the like, have the defect of low label count (generally less than 1000); the resequencing of random sequences results in lower efficiency and excessive cost, and the above technical methods limit the development of the field, and a site number of up to 10 is highly required 4 And the capture site is clear, high-flux and low-cost detection means.
Disclosure of Invention
It is an object of the present invention to provide a whole genome-level capture site of greater than 10 4 The capture site immobilization, high throughput, high efficiency, low cost primers and methods. The second object of the present invention is to provide a device for controlling the temperature of a liquid crystal display deviceMethods for detecting the insertion site of a PREM transposon. In order to achieve the above object, the present invention adopts the following technical scheme:
in a first aspect, the present invention provides a specific primer comprising: primer3 with nucleotide sequence shown as SEQ ID NO.1 and Primer5 with nucleotide sequence shown as SEQ ID NO. 2.
The specific primer provided by the invention further comprises: the nucleotide sequence is shown as an adapter primer shown in SEQ ID NO. 5.
In a second aspect, the invention provides a method for isolating the genomic sequence of a PREM transposon insertion site, wherein the maize genomic DNA is disrupted using a 4-6 base cohesive end DNase; ligating the adaptor1 and the adaptor2 with the broken DNA fragments to obtain DNA fragments with adaptors; the nucleotide sequence of the joint 1 is shown as SEQ ID NO.3, and the nucleotide sequence of the joint 2 is shown as SEQ ID NO. 4; and (3) taking the DNA fragment with the linker as a template, carrying out PCR amplification by adopting the specific primer, sequencing a PCR amplification product, and comparing the PCR amplification product with a genome sequence to obtain a corresponding PREM transposon site.
In the method provided by the invention, the broken DNA fragment is between 250bp and 5 kb.
As a specific embodiment of the present invention, the present invention provides a method for isolating genomic sequence of a PREM transposon insertion site, comprising:
(1) Taking corn genome DNA, breaking by using DNA breaking enzyme NlaIII, wherein the breaking condition is 37 ℃ for 1-5 hours, and obtaining breaking products, and breaking DNA fragments of 250bp-5 kb; (2) Connecting the breaking product obtained in the step (1) with a connector 1 and a connector 2 by using DNA ligase to obtain a DNA fragment with the connector; (3) Recovering the DNA fragment with the linker in the step (2), and carrying out PCR amplification by using the specific primer after obtaining a recovered product; (4) Recovering the amplified product of the step (3), quantifying, sequencing by an NGS sequencer, and comparing with a genome sequence to obtain a corresponding PREM transposon site.
In the method provided by the invention, the ligase in the step (2) is T4 DNA ligase, and the ligation condition is 25 ℃ for 1-3 hours; the kit in the step (3) is an Axygen gel recovery kit AP-GX-250; the PCR amplification conditions of step (3) are: pre-denaturation at 98 ℃ for 2 min; 98℃for 10 seconds, 62℃for 20 seconds, 72℃for 1 minute, 15 cycles; extension was carried out at 72℃for 8 minutes.
In a third aspect, the use of the above specific primer or the above method for isolating a genomic sequence of a prep transposon insertion site; and the use of the above specific primers or the above method for genome-level identification of PREM transposons; and the application of the specific primer or the method in genome level screening PREM transposon are all within the protection scope of the invention.
The invention has the beneficial effects that:
(1) The specific primer designed by the invention not only ensures that the length of the PREM tail end is 150-350bp specific sequence in the subsequent analysis, but also ensures that the 150-350bp flanking genome sequence is separated in the subsequent second-generation NGS sequencing process, thus being a smart and efficient novel primer design.
(2) Compared with the existing PREM transposon site identification method, the method provided by the invention can enrich almost all PREM transposon sites on genome, and has extremely high efficiency; in addition, the method provided by the invention can separate the sites of a single sample from large-scale data after mixed sequencing due to the existence of the tag sequence of the primer, and is suitable for high-throughput detection; in addition, the invention adopts mixed PCR and sequencing, so that the cost of library establishment and sequencing is greatly reduced.
Drawings
In order to more clearly illustrate the invention or the technical solutions of the prior art, the following description will briefly explain the drawings used in the embodiments or the description of the prior art, and it is obvious that the drawings in the following description are some embodiments of the invention, and other drawings can be obtained according to the drawings without inventive effort for a person skilled in the art.
FIG. 1 is an identification of the genomic flanking sequences of the Prem1 transposon of the present invention based on the Illumina sequencing platform. Wherein the sequences tagged with PREM5 'and PREM3' are PREM transposons 5 'and 3', respectively.
FIG. 2 shows the 3' -end alignment consensus sequence of the different Prem1 family members of the maize genome of the present invention.
FIG. 3 shows the alignment and consensus sequence of the 5' ends of the different Prem1 family members of the maize genome of the present invention.
FIG. 4 shows the distribution of PREM transposons of the invention in the maize B73 genome.
FIG. 5 shows the detection of the distribution of PREM transposons in the maize B73 genome by the method of the invention.
Detailed Description
For the purpose of making the objects, technical solutions and advantages of the present invention more apparent, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings, and it is apparent that the described embodiments are some embodiments of the present invention, not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.
EXAMPLE 1PREM specific primer design and test
The PREM sequences used in the present invention include, but are not limited to: the genbank seq ID in NCBI is the PREM sequence of U03680 (PREM-1), U03681 (PREM-la), U03682 (PREM-lb), U03683 (PREM-lc), U03685 (PREM-1D), U03684 (PREM-le).
Scanning alignment is carried out in the corn B73 genome, and according to the characteristics of the common sequences of the PREM, the conserved sequences at the 3 'end and the 5' end are cut out, and the alignment results are shown in figures 2 and 3. The invention will ultimately utilize NGS sequencing technology to obtain all PREM sites at the full genome level. The read length of the NGS is generally 150bp at a single end, the sum of the two ends is 300-700bp, and the read length is short. In order to ensure that adjacent genome sequences larger than 100bp can be obtained within the reading length range, the embodiment designs that the 5 'or 3' end primers on the PREM are about 70bp away from the tail ends of the directions, and the sequences on the estimated obtained genome are not equal to 70-700 bp.
Specific primers Primer5 and Primer3 of 5 'and 3' ends of PREM are designed in the invention, and in addition, corresponding linker sequences adapter 1 and adapter 2 are also designed, and the linker PCR Primer adapter Primer is shown in table 1. The sequence corresponding to the uppercase letter portion without underline in Primer5 and Primer3 is the anchor sequence, and the uppercase letter with underline is the transposon end specific sequence.
TABLE 1 specific primers, adaptors, adaptor primer sequences for detection of whole genome PREM loci
| Sequence name | Sequence(s) |
| Primer5 | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTATTTAGGAANTAGGTGTAAGCCT(SEQ ID NO.1) |
| Primer3 | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTTTCAGTTTCGCCCTATTC(SEQ ID NO.2) |
| Adaptor1 | atgaagacgcaatagaacatg(SEQ ID NO.3) |
| Adaptor2 | Ttctattgcgtcttcatcctgttaatacac(SEQ ID NO.4) |
| Adaptor primer | CAAGCAGAAGACGGCATACGAGATgcgtcttcatcctgttaa(SEQ ID NO.5) |
The adapter and the Primer are matched with an anchor sequence and a sequencing Primer sequence adopted in NGS second-generation high-throughput sequencing, the anchor sequence in the Primer is used for annealing with the same sequence of the adapter, and PCR amplification is completed to obtain a product for sequencing.
EXAMPLE 2NGS sequencing methods PREM site enrichment from maize genome
In this example, a B73 corn sample was selected and the experiment was performed as follows:
(1) Taking 50ng of corn genome DNA, breaking the corn genome DNA for 5 hours at 37 ℃ by (NEB, cat. No. R0125L) to obtain a breaking product, wherein the breaking DNA fragment is between 250bp and 5 kb;
(2) Adding 10pM connectors and 1 mu l T DNA ligase of the adapter 1 and the adapter 2 into the disruption product, and reacting for 3 hours at 25 ℃ to connect to obtain a DNA fragment with the connectors; in this step, the ratio of linker to cleavage product was 10pM:50ng.
(3) Recovering the DNA fragment with the linker obtained in the step (2) by using a PCR product purification kit to obtain a mixed sample;
(4) The PCR was performed by adding 10pM Primer3, 10pM Primer5 and 10pM Adaptor primer, and 1. Mu.g of the mixed sample of (3) to the system, and the amplification conditions were 98℃for 2 minutes, 15 cycles (98℃for 10 seconds, 62℃for 20 seconds, 72℃for 1 minute) and extension at 72℃for 8 minutes, to obtain a PCR amplification product.
(5) Recovering the PCR amplification product obtained in the step (4) by using the AMPure XP beads of Beckman in an equal volume manner;
(6) NGS novaseq sequencing alignment.
(7) Based on the sequencing analysis result, the number of effective sequences refers to the genome sequence comprising the PREM sequence and the flanking wings (the number of effective sequences on each chromosome and their occupation are shown in FIG. 4 and FIG. 5, and specifically shown in Table 2).
TABLE 2 detection of the number of PREM loci on each chromosome of the B73 genome by the method of the invention
The positions of the partial PREM transposons at which the effective sequences are located are shown in Table 3.
TABLE 3 position and length of partial PREM transposon in maize B73 genome detected by the method provided in this example
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
Finally, it should be noted that: the above embodiments are only for illustrating the technical solution of the present invention, and are not limiting; although the invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical scheme described in the foregoing embodiments can be modified or some technical features thereof can be replaced by equivalents; such modifications and substitutions do not depart from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims (10)
1. A specific primer, wherein the specific primer comprises: primer3 with nucleotide sequence shown as SEQ ID NO.1 and Primer5 with nucleotide sequence shown as SEQ ID NO. 2.
2. The specific primer of claim 1, wherein the specific primer further comprises: the nucleotide sequence is shown as an adapter primer shown in SEQ ID NO. 5.
3. A method for isolating a genomic sequence of a prep transposon insertion site, characterized in that a 4-6 base cohesive end dnase is used to break the maize genomic DNA;
ligating the adaptor1 and the adaptor2 with the broken DNA fragments to obtain DNA fragments with adaptors; the nucleotide sequence of the joint 1 is shown as SEQ ID NO.3, and the nucleotide sequence of the joint 2 is shown as SEQ ID NO. 4;
using the DNA fragment with the linker as a template, adopting the specific primer of claim 2 to carry out PCR amplification, sequencing the PCR amplification product, and comparing with a genome sequence to obtain a corresponding PREM transposon site.
4. A method according to claim 3, wherein the disrupted DNA fragment is between 250bp-5 kb.
5. A method according to claim 3, comprising:
(1) Taking corn genome DNA, breaking by using DNA breaking enzyme NlaIII, wherein the breaking condition is 37 ℃ for 1-5 hours, and obtaining breaking products, and breaking DNA fragments of 250bp-5 kb;
(2) Connecting the breaking product obtained in the step (1) with a connector 1 and a connector 2 by using DNA ligase to obtain a DNA fragment with the connector;
(3) Recovering the DNA fragment with the linker in the step (2), and carrying out PCR amplification by using the specific primer of claim 2 after obtaining a recovered product;
(4) Recovering the amplified product of the step (3), quantifying, sequencing by an NGS sequencer, and comparing with a genome sequence to obtain a corresponding PREM transposon site.
6. The method according to claim 5, wherein the ligase in step (2) is T4 DNA ligase and the ligation conditions are 22-25℃for 1-3 hours; the PCR amplification conditions of step (3) are: pre-denaturation at 98 ℃ for 2 min; 98℃for 10 seconds, 62℃for 20 seconds, 72℃for 1 minute, 15 cycles; extension was carried out at 72℃for 8 minutes.
7. Use of a specific primer according to any one of claims 1-2 or a method according to any one of claims 3-6 for isolating a genomic sequence of a prep transposon insertion site.
8. Use of a specific primer according to any one of claims 1-2 or a method according to any one of claims 3-6 for genome-level identification of a PREM transposon.
9. Use of a specific primer according to any one of claims 1-2 or a method according to any one of claims 3-6 for genome-level screening of PREM transposons.
10. The use according to any one of claims 7-9, wherein the genome is a maize whole genome.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311408280.5A CN117512164A (en) | 2023-10-27 | 2023-10-27 | Primers and method for efficiently detecting genome-wide level PREM transposon site |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311408280.5A CN117512164A (en) | 2023-10-27 | 2023-10-27 | Primers and method for efficiently detecting genome-wide level PREM transposon site |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN117512164A true CN117512164A (en) | 2024-02-06 |
Family
ID=89746726
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202311408280.5A Pending CN117512164A (en) | 2023-10-27 | 2023-10-27 | Primers and method for efficiently detecting genome-wide level PREM transposon site |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN117512164A (en) |
-
2023
- 2023-10-27 CN CN202311408280.5A patent/CN117512164A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP3192900B1 (en) | Method for constructing nucleic acid single-stranded cyclic library and reagents thereof | |
| JP2019523638A (en) | Multi-positioning double tag adapter set for detecting gene mutation, and its preparation method and application | |
| CN110669836B (en) | Molecular marker for identifying hereditary sex of Oxytropis myriophylla and application thereof | |
| EP3885445A1 (en) | Methods of attaching adapters to sample nucleic acids | |
| CN115198023B (en) | Hainan cattle liquid-phase breeding chip and application thereof | |
| US20220411882A1 (en) | Snp molecular marker for weight gain trait selection and genetic sex identification of ictalurus punctatus as well as screening method and application of snp molecular marker | |
| CN113789394B (en) | Molecular marker C13 for identifying ammonia nitrogen tolerance character of portunus trituberculatus and application thereof | |
| CN108359723B (en) | Method for reducing deep sequencing errors | |
| KR101903334B1 (en) | Method of individual identification and paternity test using the microsatellite marker composition in dogs | |
| CN116083605B (en) | Genetic marker system containing 67 high-efficiency autosomal micro haplotypes and detection primer and application thereof | |
| CN117512164A (en) | Primers and method for efficiently detecting genome-wide level PREM transposon site | |
| CN107794573B (en) | Method for constructing DNA large fragment library and application thereof | |
| CN113801945B (en) | Molecular marker C768 for identifying ammonia nitrogen tolerance character of portunus trituberculatus and application thereof | |
| CN110241234B (en) | Fluorescence-labeled 32-plex InDels composite amplification system and application thereof | |
| CN113122642A (en) | Method for assembling and annotating Hu sheep genome based on third-generation PacBio and Hi-C technology | |
| EP3409788B1 (en) | Method and system for nucleic acid sequencing | |
| CN112210620B (en) | AcDs whole genome site efficient detection primer and method based on NGS sequencing | |
| CN117887879A (en) | Primer combinations and methods for isolating the genomic sequence of an Opie transposon insertion site | |
| CN109988769B (en) | Gene and application thereof | |
| CN110914454B (en) | Genome sequence analysis of human DNA samples contaminated with microorganisms using whole genome capture inter-transposon segment sequences | |
| CN117887881A (en) | Primer for detecting Huck transposon whole genome locus based on second-generation sequencing, and method and application thereof | |
| CN113930518B (en) | Molecular marker C49 for identifying ammonia nitrogen tolerance character of portunus trituberculatus and application thereof | |
| CN113981113B (en) | InDel marker C142 for identifying ammonia nitrogen tolerance character of portunus trituberculatus, primers and application thereof | |
| CN111662989B (en) | SSR fluorescence labeling primer for paternity test of deer on slope and identification method | |
| CN113981112B (en) | InDel marker C3082 for identifying ammonia nitrogen tolerance character of portunus trituberculatus, primers and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication |