CN117481033A

CN117481033A - Adventitious bud culture medium and method for promoting induction and differentiation of quinoa plant material

Info

Publication number: CN117481033A
Application number: CN202311480522.1A
Authority: CN
Inventors: 张康; 冉毅东; 高崑; 张立肖; 徐虎
Original assignee: Beijing Qiheshengke Biotechnology Co ltd
Current assignee: Beijing Qiheshengke Biotechnology Co ltd
Priority date: 2023-06-13
Filing date: 2023-06-13
Publication date: 2024-02-02
Also published as: CN116479038A; CN116479038B

Abstract

The present invention provides an adventitious bud culture medium and a method for promoting induction and differentiation of quinoa plant material, wherein the adventitious bud culture medium comprises a basal salt culture medium, trans-zeatin nucleosides and naphthylacetic acid. The invention also provides a method for obtaining the quinoa plant with the flavor-enhancing property, and in particular provides application of reducing the expression of the CqBADH2 gene. The invention discovers for the first time that the fragrance of the quinoa plant can be obviously improved by inhibiting or reducing the expression of the CqBADH2 gene of the quinoa plant. In addition, the invention realizes the simultaneous and accurate editing of a plurality of genes or alleles in quinoa by utilizing a gene editing technology for the first time, completes stable delivery, and provides a good platform for quinoa targeted molecular breeding.

Description

Adventitious bud culture medium and method for promoting induction and differentiation of quinoa plant material

The application is a divisional application of application No. CN202310695459.7, with the application No. 2023, no. 06 and No. 13, and the name of the application of 'a method for obtaining non-transgenic flavor-enhancing quinoa'.

Technical Field

The invention belongs to the field of biotechnology breeding, relates to a method for obtaining quinoa with increased fragrance, and in particular relates to a method for obtaining a breeding material for quinoa with increased fragrance by utilizing genome editing technology to realize site-directed mutagenesis of CqBADH2.1 and CqBADH2.2 genes of main-cultivated quinoa betaine aldehyde dehydrogenase. In particular to an adventitious bud culture medium and a method for promoting induction and differentiation of chenopodium plant materials

Background

Quinoa (Chenopodium quinoa) is an ancient crop with 7000 years history, is native to andes mountain, is flourishing in the seal and civilization, and is a cold-resistant drought-resistant plant which can be adapted to unable latitude and altitude. The protein content in quinoa seeds is up to 14%, wherein 48% of amino acids are essential amino acids for human body. Quinoa is considered by the united nations grain and agricultural organization (FAO) as the only single plant capable of meeting the basic nutritional needs of the human body. Is praised as perfect 'full nutrition' for human beings and 'ideal grain' for people to move into space.

Quinoa is an heterotetraploid, hybridized by ancestral diploid a genome (c. Pellicola) and B genome (c. Suecium), the complexity of which results in the current lack of successful establishment of efficient in vitro regeneration and genetic transformation systems, rendering the molecular breeding process hindered. Fayza Ruzayq AI Gethami et al established a regeneration system starting with quinoa leaf node as the starting explant (Fayza Ruzayq AI Gethami and Hameda EI Sayed Ahmed EI Sayd. InVitro: influence of Various Concentrations of Plant Growth Regulators (BAP & NAA) and Sucrose on Regeneration of Chenopodium quinoa Willd plant. Journal of Advance In Biology & Biotechnology (2020)). Wang Yanfang et al established Agrobacterium rhizogenes quinoa and a method for in situ transformation of quinoa leaves (Yanfang Wang et al The Establishment of Two Efficient Transformation Systems in quinoa, research square 2021), but did not obtain stable regenerated plants.

The CRISPR/Cas9 technology is utilized in quinoa for the first time to simultaneously and accurately edit a plurality of genes or alleles, so that stable delivery is completed, and a good platform is provided for quinoa targeted molecular breeding. Based on the genetic transformation system of the invention, mutant plants knockout of CqBADH2.1 and CqBADH2.2 are obtained, and the mutant plants have a phenotype of increased fragrance. Whereas editing of the gene was achieved only in diploid maize, soybean, rice before the advent of the study. The research fills the blank of the research on quinoa crops.

Disclosure of Invention

The invention aims to provide a method for obtaining quinoa with increased fragrance, in particular to provide one or more methods for obtaining quinoa with increased fragrance, and solves the technical problem of obtaining stable regenerated quinoa.

It is a first object of the present invention to provide a method for obtaining a quinoa plant with increased flavour, wherein the method comprises a targeted genomic modification which confers reduced expression of the qbadh2 gene of the quinoa plant compared to a quinoa plant lacking the targeted genomic modification.

Preferably, the quinoa plant is quinoa.

Preferably, the CqBADH2 gene comprises CqBADH2.1 having the sequence shown in SEQ No.1 or a functional variant thereof, cqBADH2.2 having the sequence shown in SEQ No.4 or a functional variant thereof.

Preferably, the functional variant has at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% sequence identity with its corresponding CqBADH2 nucleotide sequence.

Further preferred, the CqBADH2.1 and CqBADH2.2 simultaneously reduce expression.

In one embodiment, the targeted genomic modification is an insertion, deletion or substitution.

In one embodiment, the method of genomic modification comprises a mutation, a gene knockout, a gene disruption, an RNA interference technique, a gene editing technique, an inhibitor of an introduced gene/protein, or any combination thereof.

In one embodiment, the gene editing technique comprises CRISPR/Cas, TALEN, ZFN, meganuclease, or any combination thereof.

In one embodiment, the targeted genomic modified target site comprises the nucleotide sequence of 5'-ggctccaattgcccttccta-3' (SEQ No. 9) or a complement thereof.

Preferably, the gene editing technology is CRISPR/Cas technology; wherein the Cas effector protein in the CRISPR/Cas technology is selected from Cas3, cas4, cas5e (or CasD), cas6e, cas6f, cas7, cas8a1, cas8a2, cas8b, cas8c, cas9, cas10, cast10d, cas12, cas13, cas14, casX, casF, casG, casH, csy1, csy2, csy3, cse1 (or CasA), cse2 (or CasB), cse3 (or CasE), cse4 (or CasC), csc1, csc2, csa5, csn1, csn2, csm3, csm4, csm5, csm6, cmrl, cmr3, cmr4, cmr5, cmr6, cpf1, csb2, csb3, csx17, x14, x10, x16, csaX, 37x 3, csx 35, csx15, csf1, and 1966 f, and any combination thereof.

In one embodiment, the method comprises the steps of: introducing Cas effector protein and sgRNA targeting a CqBADH2 gene target site in a quinoa plant; plants with targeted genomic modifications are screened.

Preferably, the genomic modification results from the introduction in a chenopodium plant of a construct comprising: (a) Cas effector protein DNA, and an sgRNA sequence selected from SEQ No.16 or SEQ No.17 or a combination of both; or (b) a Ribonucleoprotein (RNP) complex comprising a Cas effector protein and an sgRNA sequence selected from SEQ No.16 or SEQ No.17 or a combination of both.

Further preferred, the construct is introduced into a plant cell using the following method: agrobacterium-mediated delivery, gene gun delivery, polyethylene glycol-mediated delivery, virus-mediated delivery, nanoparticle-mediated delivery, or DNA delivery by grafting.

Further preferred, the method comprises the step of regenerating a plant having a targeted genomic modification.

In one embodiment, the regenerating step comprises inoculating the plant material to adventitious bud induction medium.

Preferably, the adventitious bud induction medium comprises a basal salt medium and a hormonal ingredient.

Further preferably, the hormonal component contains 2-3 mg/L trans-zeatin nucleoside (tZT), 0.5mg/L tri-iodobenzoic acid (TIBA), 0.5-1mg/L Naphthalene Acetic Acid (NAA).

Further preferably, the hormonal component contains 2mg/L trans-zeatin nucleoside (tZT), 0.5mg/L triiodobenzoic acid (TIBA), 0.5mg/L Naphthalene Acetic Acid (NAA).

It is a second object of the present invention to provide an isolated nucleotide sequence of an sgRNA, wherein the nucleotide sequence is selected from SEQ No.16 or SEQ No.17.

In one embodiment, the use of the nucleotide sequence for a chenopodium plant CqBADH2 gene targeted genomic modification.

It is a third object of the present invention to provide an isolated nucleotide sequence of a primer pair, wherein the nucleotide sequence of the primer pair has at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% sequence identity with a nucleotide sequence selected from the group consisting of SEQ No.28 and SEQ No. 29.

In one embodiment, the use of the nucleotide sequence as a primer pair for identifying or screening a chenopodium plant having a flavour enhancing trait, said chenopodium plant having reduced expression of cqbadh2.1 and cqbadh2.2 within its genome.

In one embodiment, a detection kit for determining the presence or absence of a CqBADH2 genome targeted modification in a chenopodium plant is provided, wherein the kit contains the primers.

It is a fourth object of the present invention to provide an adventitious bud culture medium for promoting induction and differentiation of a quinoa plant callus.

It is a fifth object of the present invention to provide a method for promoting induction and differentiation of quinoa plant material.

In one embodiment, the quinoa plant material is inoculated into the adventitious bud culture medium.

The invention has the main advantages that:

(1) The invention discovers for the first time that the fragrance of quinoa CqBADH2 can be obviously improved by inhibiting or reducing the expression of the quinoa CqBADH2 gene.

(2) The invention realizes the simultaneous and accurate editing of a plurality of genes or alleles in quinoa by utilizing the gene editing technology for the first time, completes the stable delivery, and provides a good platform for the targeted molecular breeding of quinoa.

Drawings

FIG. 1. A state diagram of Agrobacterium rhizogenes mediated transient transformation of quinoa; the upper left part of A of FIG. 1 corresponds to CqBADH2-g1, the upper right part corresponds to CqBADH2-g2, the lower left part corresponds to CqBADH2-g3, the lower right part corresponds to CqBADH2-g4, and the dark culture is carried out at 24+/-1 ℃ for 72 hours; b of FIG. 1 corresponds to the state diagram of CqBADH2-g1, cqBADH2-g2, cqBADH2-g3 and CqBADH2-g4 in turn from left to right and is placed on a CQ3 culture medium after co-culture; c in FIG. 1 corresponds to CqBADH2-g1, cqBADH2-g2, cqBADH2-g3, and CqBADH2-g4 in order from left to right, and is placed on CQ3 medium for 14 days.

FIG. 2 shows the results of the digestion of CqBADH2-g1, cqBADH2-g2, cqBADH2-g3, cqBADH2-g4, and CqBADH2-g5.

FIG. 3 shows a transformation culture state diagram of Agrobacterium tumefaciens.

FIG. 4 shows an enzyme map of CqBADH2-g3 transformed plants, wherein 138 plants are respectively numbered from left to right and from top to bottom in the bands of FIGS. 4A-C.

FIG. 5 shows sequencing patterns of mutants QE12 and QE28.

FIG. 6 measurement of 2-AP content in mature grain (T2 generation) of Cqbadh2 homozygous mutant.

FIG. 7. Effect of different base salts on Agrobacterium rhizogenes transformation efficiency.

Detailed Description

A further understanding of the present invention may be obtained by reference to the specific examples which are set forth to illustrate, but are not intended to limit the scope of the present invention. It will be apparent that various modifications and variations can be made to the present invention without departing from the spirit thereof, and therefore, such modifications and variations are also within the scope of the present application as hereinafter claimed.

Example 1 acquisition of quinoa CqBADH2.1 Gene and design of sgRNA

The gene sequences of quinoa CqBADH2.1 (SEQ No. 1) and CqBADH2.2 (SEQ No. 4), CDS sequences (SEQ No.2 and 5) and amino acid sequences (SEQ No.3 and 6) were obtained using BLAST website. Details are as follows. The sgrnas were designed in the cqbadh2.1 and cqbadh2.2 gene homology segments. According to the http:// crispor.tefor.net/crispor.py of the website, the design targets are as follows:

table 1: target site design of CqBADH2.1 and CqBADH2.2 Gene homology segments

Note that: the underlined sequence indicates the PAM sequence

Example 2 selection of targets and construction of knockout vectors

1. Vector construction

1. According to the targets of the CqBADH2.1 and CqBADH2.2 homologous segments, corresponding target primers are synthesized, and the primer sequences are as follows:

table 2: target primer sequence design

Note that: capital letters indicate primer sequences and lowercase letter sequences indicate sticky ends.

2. Linking carrier

In the first step, pKSE401 vector is digested with BsaI, the size of the band is 15429 bp+1225bp, and the backbone part is recovered by gel1529bp size band. The enzyme digestion system is as follows: plasmid 4 ng, bsaI 2.5. Mu. L, buffer 5. Mu.L, the remainder consisting of H ₂ O complements the 50. Mu.L system.

Secondly, target primers of CqBADH2-g1, cqBADH2-g2, cqBADH2-g3, cqBADH2-g4 and CqBADH2-g5 are annealed to form double-stranded DNA respectively, then the double-stranded DNA is connected with a pKSE401 vector (after BsaI digestion), E.coli DH5 alpha is transformed by the connection product, and the pKSE401-CqBADH2-g1, pKSE401-CqBADH2-g2, pKSE401-CqBADH2-g3, pKSE401-CqBADH2-g4 and pKSE401-CqBADH2-g5 are named respectively. The annealing system is as follows: 1. Mu.L of the upstream primer, 1. Mu.L of the downstream primer, and the rest of the system was made up by 1 Xeasy Taq Buffer to 10. Mu.L. The annealing procedure is as follows: 94. denaturation at 90-80℃for 5min, gradient circulation at 90℃for 1 min and extension at 80℃for 1 min for 8 cycles each lowered by 1℃and preservation at 4 ℃. The continuous system is as follows: annealed product 1. Mu. L, pKSE 401. Mu. L, T4 DNA library 0.5. Mu. L, T4 DNA ligase Buffer 1. Mu. L, H ₂ O 6.5 μL。

After culturing 1 d, colony PCR verification was performed on single spots grown the next day, with PCR primers as follows:

table 3: verification of primer design

And (3) identifying positive single spots by colony PCR, sequencing, selecting single spots with correct sequencing, and extracting plasmids for subsequent experiments.

2. Selection of targets

1. Agrobacterium rhizogenes mediated transient transformation system

Five constructed vectors, namely pKSE401-CqBADH2-g1, pKSE401-CqBADH2-g2, pKSE401-CqBADH2-g3, pKSE401-CqBADH2-g4 and pKSE401-CqBADH2-g5, were respectively introduced into Agrobacterium rhizogenes K599 (strain resistance is Kan), streaked and inoculated on LB solid medium (10 g/L peptone+5 g/L yeast powder+5 g/L sodium chloride+15 g/L agar+25 mg/L rifampicin+50 mg/L kanamycin, pH 7.0) and cultured overnight at 28 ℃. Picking single colony, inoculating into LB liquid medium (LB solid medium without agar), and culturing at 28deg.CShaking culture was carried out at 220 rpm overnight. The next day, centrifugation was performed at 3500rpm for 15min at 18℃and the supernatant was discarded, and resuspended in culture medium CQ1 (1.6G/L B5 medium (Duchefa G0210, netherlands) +0.5G/L morpholinoethanesulfonic acid+0.1G/L glutamine+0.1G/L asparagine+20G/L sucrose+200. Mu.M acetosyringone). The bacterial liquid concentration was measured by Eppendorf BioPhotometer plus instrument. First select OD ₆₀₀ Gear, add 500 μl CQ1 liquid to the cuvette for calibration and zeroing, then drain the cuvette with distilled water while the liquid is everywhere. Add 500. Mu.L of resuspended bacteria solution and determine OD ₆₀₀ Value, adjusted by CQ1 fluid, up to OD ₆₀₀ = 0.5± 0.05。

Seed of the main cultivated quinoa variety was sterilized (30 s with 75% alcohol, then rinsed 1 time with sterile water, then soaked with 5% active chlorine NaClO solution for 30-40 min, continuously gently shaken during this period, then rinsed 5 times with sterile water) and seedlings placed on germination medium CQ0 (MS vitamin-containing basal salt (MS Phototech M519) +30 g/L sucrose+8 g/L agar) were explanted for 10 days, and 1/2 hypocotyls and radicles were excised. Placing the bacterial liquid into a vacuum pump for pumping air for 10min. And then placed on a shaker at 200rpm for 20 min. In a sterile environment, the liquid is discarded and the excess bacterial liquid is sucked by sterile filter paper, and the transformed explant is placed on a co-culture medium CQ2 (1.6 g/L B5 culture medium+0.5 g/L morpholinoethanesulfonic acid+0.1 g/L glutamine+0.1 g/L asparagine+20 g/L sucrose+200 mu M acetosyringone+8 g/L agar) on which a layer of filter paper is laid, and is cultivated in the dark at 24+/-1 ℃ for 72 hours. After co-cultivation, the explants were transferred to hairy root induction medium CQ3 (MS contains vitamin basal salt+0.5 g/L morpholinoethanesulfonic acid+0.1 g/L glutamine+0.1 g/L asparagine+20 g/L sucrose+8 g/L agar+400 mg/L timentin). Dark culture at 25 ℃ + -2 ℃ for 14 days. The culture conditions at the different stages are shown in FIG. 1.

2. Target selection and identification system

100 root hairs are respectively taken from the samples with CqBADH2-g1, cqBADH2-g2, cqBADH2-g3, cqBADH2-g4 and CqBADH2-g5 target modification introduced, and genome DNA is extracted. PCR/RE (Polymerase Chain Reaction/Restriction digestion) experimental analysis was performed using the DNA as a template. The PCR/RE analysis method is described in the literature Shan Q.et al Rapid and efficient gene modification in rice and Brachypodium using TALENs. Molecular Plant (2013), wherein the primers used for PCR amplification are:

table 4: PCR/RE amplification primers

The PCR/RE restriction map showed that only the CqBADH2-g3 restriction map was mutated. As shown in FIG. 2, the arrow indicates the mutated band of interest. The result shows that only CqBADH2-g3 target primers can knock out CqBADH2.1 and CqBADH2.2 simultaneously and have knock-out activity.

Example 3 transformation of pKSE401-CqBADH2-g3 vector by Agrobacterium tumefaciens method

Next, the constructed vector pKSE401-CqBADH2-g3 was introduced into Agrobacterium tumefaciens GV3101 (strain resistance: kan), and the same procedure as in example 2 was followed. The suspension was resuspended in suspension CQ4 (25 mL/L YR 20 Xmother liquor+5 mL/L YR trace 100 Xmother liquor+5 mL/L YR iron salt 100 Xmother liquor+1 mL/L YR vitamin 1000 Xmother liquor+0.5 g/L morpholinoethanesulfonic acid+2.5 mg/L copper sulfate pentahydrate+20 g/L maltose+2 mg/L trans-zeatin nucleoside+0.5 mg/L triiodobenzoic acid+0.5 mg/L naphthylacetic acid+200. Mu.M acetosyringone). The bacterial liquid concentration was measured by Eppendorf BioPhotometer plus instrument. First select OD ₆₀₀ Gear, add 500 μl CQ1 liquid to the cuvette for calibration and zeroing, then drain the cuvette with distilled water while the liquid is everywhere. Add 500. Mu.L of resuspended bacteria solution and determine OD ₆₀₀ Value, adjusted by CQ1 fluid, up to OD ₆₀₀ =0.8±0.05. Wherein the special culture medium mother liquor is configured as shown in the following table, and the inorganic medicines are purchased from the biological engineering (Shanghai) stock limited company:

TABLE 5 preparation of YR 20X mother liquor in large quantities

TABLE 6 YR trace 100X mother liquor preparation

TABLE 7 YR vitamin 1000 x mother liquor preparation (filtration sterilization, split charging, preservation in-20deg.C refrigerator)

TABLE 8 YR preparation of ferric salt 100X mother liquor

In this example, the seed of quinoa (same as example 2) was sterilized and placed on a germination medium CQ0 (MS medium salt (containing vitamin) +30g/L sucrose+8g/L agar) for 7 days (when the germination of the real buds was started), the hypocotyl, radicle and cotyledon were transversely excised, the cotyledon was left for 3mm, the hypocotyl was left for 2mm, a W shape was formed, and the growth point was longitudinally cut in batches for 0.5mm (FIG. 3A). Placing the bacterial liquid into a vacuum pump, and pumping 15 inHg for 10min. And then placed on a shaker at 200rpm for 3h of infestation. Under a sterile environment, the liquid is discarded, the excess bacterial liquid is sucked by sterile filter paper, and the transformed explant is placed on a co-culture medium CQ5 (25 mL/L YR 20 times of mother liquor+5 mL/L YR trace 100 times of mother liquor+5 mL/L YR iron salt 100 times of mother liquor+1 mL/L YR vitamin 1000 times of mother liquor+0.5 g/L morpholinoethanesulfonic acid+2.5 mg/L copper sulfate pentahydrate+20 g/L maltose+2 mg/L trans-zeatin nucleoside+0.5 mg/L triiodobenzoic acid+0.5 mg/L naphthylacetic acid+200 uM acetosyringone+8 g/L agarose), and is subjected to dark culture at 24 ℃ +/-1 ℃ for 72 hours, as shown in FIG. 3B. After co-cultivation, the explants were transferred to a cluster bud induction medium CQ6 (50 mL/L YR 20 Xmother liquor+10 mL/L YR trace 100 Xmother liquor+10 mL/L YR iron salt 100 Xmother liquor+1 mL/L YR vitamin 1000 Xmother liquor+0.5 g/L morpholinoethanesulfonic acid+2.5 mg/L copper sulfate pentahydrate+20 g/L maltose+2 mg/L trans-zeatin nucleoside+0.5 mg/L triiodobenzoic acid+0.5 mg/L naphthylacetic acid+7 g/L polyvinylpyrrolidone+9 g/L agar+400 mg/L timentin). The culture was performed at 24.+ -. 1 ℃ for 4-6 weeks under light with an intensity of 4000-6000 lx under light of 16h/d (FIG. 3C). The obtained adventitious buds are divided and transferred to adventitious bud elongation induction culture medium CQ7 (50 mL/L YR 20 Xmother liquor+10 mL/L YR trace 100 Xmother liquor+10 mL/L YR iron salt 100 Xmother liquor+1 mL/L YR vitamin 1000 Xmother liquor+0.5 g/L morpholinoethanesulfonic acid+2.5 mg/L copper sulfate pentahydrate+20 g/L maltose+0.1 mg/L benzylaminopurine+0.01 mg/L naphthylacetic acid+1 g/L active carbon+8 g/L agar+300 mg/L timentin). Culturing at 24+ -1deg.C for 2-4 weeks under illumination with 4000-6000 lx intensity and 16h/D to obtain adventitious bud (FIG. 3D-1). The obtained adventitious bud was cut out and transferred to a rooting medium CQ8 (MS contains vitamin basic salt+0.5 g/L morpholinoethanesulfonic acid+0.1 g/L glutamine+0.1 g/L asparagine+20 g/L sucrose+0.5 mg/L indolebutyric acid (biological engineering (Shanghai) Co., ltd. A600725) +8 g/L agar+200 mg/L timentin). Culturing at 24+ -1deg.C under illumination for 2 weeks at 4000-6000 lx, and 16h/d to obtain transformed plants.

In addition, we used the same transformation method to transform in Chenopodium quinoa variety Chenopodium ambrosioides No.2, and transformed plants were also obtained. The elongated adventitious bud obtained by culturing Chenopodium album No.2 is shown in FIG. 3D-2. This example shows the universality of the transformation conditions of the present invention.

Example 4 mutant detection

The transformed plants of CqBADH2-g3 of example 3 were each extracted to obtain genomic DNA. PCR/RE experimental analysis was performed using the DNA as a template (the analysis method was the same as in example 2). 138 samples were taken (the bands in FIGS. 4A-C were numbered from left to right and from top to bottom), wherein 4 mutants were detected, the 3 rd, 7 th, 12 th and 28 th bands (FIG. 4A), respectively, corresponding to sample numbers QE3, QE7, QE12 and QE28.

PCR detection using primers M13F and gRNA-sc-R (example 2) found that 2 of these strains were negative, QE12, QE28, respectively. QE12 and QE28 were amplified using primers D-CqBADH2-F3 and D-CqBADH2-R3 and the amplified products were sequenced as shown in FIG. 5, wherein the boxed bases represent mutations.

Sequencing results showed that: mutants QE12 and QE28 of this example are double mutant of Cqbadhh 2.1 and Cqbadhh 2.2, wherein QE12 is a Cqbadhh 2.1 homozygous mutation, genotype is-1 bp, cqbadhh 2.2 heterozygous mutation, genotype is-2 bp; QE28 is a Cqbadhh2.1 homozygous mutation, the genotype is +1bp, the Cqbadhh2.2 homozygous mutation, the genotype is +1bp/-1bp.

Example 5:2-AP content detection

2-acetyl-1-pyrroline (2-AP for short) is an important volatile for cereal flavor generation, and various mutation types of betaine aldehyde dehydrogenase (BADH 2) can cause the accumulation of the volatile, thereby generating flavor. The quantitative analysis of 2-AP in Cqbadhh 2.1 and Cqbadhh 2.2 double mutant mature grains (T2 generation) is carried out by using GC-MS metabonomics technology, and the content measurement result is shown in figure 6. The results indicate that the 2-AP content of the two Cqbadh2 double mutants (QE 12, QE 28) is significantly increased compared to the wild type, i.e. the Cqbadh2 double mutant can give rise to a character of increased fragrance.

Example 6: quinoa rooting culture medium screening

According to example 2, agrobacterium rhizogenes mediated transient transformation system. We adjusted 1.6g/L B5 medium (1/2 B5) in CQ1 and CQ2 to 3.2g/L B medium (B5), 2.2g/L MS medium (1/2 MS) and 4.4g/L MS Medium (MS), respectively, with the remaining conditions unchanged, and used Agrobacterium rhizogenes of CqBADH2-g3 for rooting experiments in Chenopodium album No.2 and corresponding PCR assays. The results are shown in FIG. 7.

The PCR result shows that the induction efficiency of the quinoa hair root transformation is highest and reaches 52.5% after infection and co-culture with 1.6g/L B5 (1/2 B5) compared with other three culture media.

Example 7: screening of quinoa cluster bud induction culture medium

Seed number 2 was selected, sterilized according to the method described in example 2, germinated on CQ0 for 7 days, explants were cut and inoculated on different adventitious bud induction media, 30 explants were placed for each treatment, and repeated 3 times. To the basic medium of YR salt (50 mL/L YR 20X mother liquor+10 mL/L YR micro 100X mother liquor+10 mL/L YR iron salt 100X mother liquor+1 mL/L YR vitamin 1000X mother liquor), various concentrations of trans-zeatin nucleoside (tZT), triiodobenzoic acid (TIBA), naphthalene Acetic Acid (NAA), benzylaminopurine (BA) and other common plant hormones were added to perform various concentration combinations, aiming at obtaining hormone ratios of efficient induction buds as shown in Table 9 below. The adventitious bud induction rate was counted after 5 weeks with every 2 weeks.

Table 9: effects of different hormone combinations on adventitious buds

The results show that 20 combinations have a certain influence on the induction of the adventitious buds of quinoa. Along with the increase of tZT concentration, the occurrence rate of adventitious buds gradually rises, and the increase of tZT concentration in a certain range can improve the occurrence rate of adventitious buds to a certain extent; however, an excessively high concentration of tZT reduces the incidence of adventitious buds and enables the adventitious buds to be continuously healed; when ZT concentration is 2mg/L, the callus induction rate of the explant is 98.64%, the incidence rate of adventitious buds formed is close to 94.50% on average, and the plant keeps good uniformity and stability; when the tZT concentration reaches 3 mg/L or above, the callus is increased, and the number of differentiated adventitious buds is reduced. In sum, the optimum concentration range of tZT is 2-3 mg/L, and the optimum concentration range of NAA is 0.5-1 mg/L. After TIBA addition, vitrification caused by tZT can be neutralized, adventitious buds can be stimulated better to postsplit, and the optimal concentration range is 0.5mg/L. Therefore, 2mg/L tZT+0.5 mg/L NAA+0.5 mg/L TIBA is the optimal hormone combination formulation for adventitious bud induction culture. On the other hand, we have found a comparison with the prior art document (Zhu Mulan, etc., an in vitro regeneration method of quinoa leaf segments, CN202110221582.6 [ P ]. First publication No. 2021-06-25) reported adventitious bud induction. The adventitious bud induction medium (MS salt+1 mg/L BA+0.1 mg/L NAA) in the prior art document is used for replacing the adventitious bud induction medium of the embodiment, and other treatment methods and materials are the same as those of the embodiment, so that the adventitious bud culture induction rate is 23.46+/-3.78% and is far lower than the induction efficiency of tZT, NAA, TIBA of the invention. It follows that the present invention also proposes a hormone combination with high induction efficiency.

Sequence listing

SEQ No.1: CqBADH2.1 LOC110700462

ATAATCCATAGGACAATAGCGGTTTAAATCATCAACCTCAATCTTCACGTGTTTTTTCTCCTTCAAATCCTCTATATTATTTCGTATTATTTCATCAACTTTCTTTCTACTCATTTCTCTTTATCCAAGAAAAATGGCGATTCCTTCTCGTCAGCTATTCATTGACGGTGAATGGAAAGAACCCATCAACAAGAATCGCATTCCTGTCATCAATCCTTCCACTGAAGAGATTATCGGTTAGTTTAATCGAAAAAACCCATAAATTTCTTTAAGTGTCATGCTTTCTTTCAACTTAATTTCTTCATTTTTAGACTTGTAGTTCATTATGATCCTAGCATTGTGTTATTCAACTGCTAAAGATTTGCTTATAGTGTATATAATTTGATGGGATTTTTTTATTTATTTTTCTGATAGTGTGATTTATTGGGATTTGAGTTTGTGATTGCATTTTTTGACTTGGGTATTTGTTGAAATTTGATGTCTTTTTTAAATCATCTCTGAACTTGATGTAGTACTGGTAACATTTTTTTATATTGGGTTTGATTGGAAGGTGATAGAATGATTTATTGGGGGATTGAAATTACTTTTTTGTGGATTTGTTGATTAGAGATTGATATTGTTTTTTAACAGTGATTGATATTGTATTTAATGAACTGGGTTGTTAATCAAAATGGGGTTTTACTCCCATAGGTGACATTCCGGCAGCAACTGCTGAGGATGTGGAGCTTGCAGTGGCTGCAGCTAGAAGGGCTCTAAAGAGGAACAAAGGGGCAGATTGGGCAGCTGCATCTGGAGCTCATCGTGCCAAGTACTTACGTGCTATCGCTAAGAGGGTATGGATTTAGTGGCTGATTTGATCGGATTTGGTAATATGATCATGTTTTGATAAGTTTGTGTAGTTGGAGTACCAATGCTAATTTTTTGGAGGTTGGAATTGTAGGCGAATTGGAACACTTTGGTTTTGGGTTTGATGATTCTATTTTTATTTGATCAAAGTGGAGGAGTGATAAAATGGATAGCACATGTAGTATATGTTTGGAAAACTTTGTTAGAATGCTAGGTGAAAGATGAATTTTAACTTAATGTTAAAAGCTACTAGCTGGAAATTGGAAGTTAATCAGCTAGTTGATTGCACTACAAGTGTTGGTTAATTATCTTTAATGTCTTTATTTTTGCTTTTAGTGGGAATTTGCAGAAGACTTTAGGATATATCATTTCTCCTCATTTCATTTGAGTTCAAGATTCTCTCTTGAGCAACATTTCAACTTTGTTTTTTAATGGATGAACATATTATGCATGGATGTTCAGTTTTTATCTAAGTTGAAGGTGTGTGTTAATGCCTATCGGATCTTCTAGTAATTTGAGTGAGCTTGTAGGTTAGCTAGTCAGAGAATTTGAGCACTTTTGGTGATACCACTGAATGGTTAAGTACTATTGTAGTGGATTTCCTAGGTGTATATCTTATAATAGTCTTGAGGTCTGTCTTCGCTTTCCTAGCTTTTGGGATGTAAGGCTGACTGTCCTCGTTTCCCATTGGTATTCAAGACTCAATTGTATGTAATCCTTGAAGGGTCATATATTGGTTGAGAATCAGGGGGTAGCGTAGTAGTAAAGTTCCCACCTTCCTTATATCCTTTAGGTGTAAGATGCTTAATCACTTGTCTTTGGCTGGGAATTCTCTTTGGAGATCTCCTTCACACCACCTCCCCCCCCCCCTCCACGCAAACAAACCCTCATATTGCCTCGTTGGACCTGCAGATCTCCAAATAAAATATGCTTCGCCTCTCTCTATCTTTACACAGGGGTACTTGGGTAGAAAATATGGATCTGCTTGATACTGGTGTGGACTTCAGGGATTGCAATATCAAGGCTTACTTTAGCTTCACATGCAGGTAACAGAAAGAAAAGATGAATTTGCAAAGCTTGAAGCCATGGATTGTGGAAAACCTTTGGATGAAGCAGCATGGGATATTGTAAGCTTGTAATCTTGTGTTCAATAATTCTTGATTCTGTGTCTTTCTTGAGTACTAATTAGTAACCAAGGCTTTTGTTCTTATGTACAGGATGATGTTGCTGGGTGTTTTGAATACTATGCTGATCAAGCAGAAGCTCTTGATGCAAAACAAAAGGCTCCAATTGCCCTTCCTATGGAGACATTCAAGTCTCATGTGCTCAGGCAGCCCATTGGTGTTGTTGGGTTAATTTCTCCGTGGTAAGTTTTGACCTTAGCCCCCATCCCTCAAAATATAAAAGGTGAAAATGAAACAACTTTAAAGAACTCCCATTTGTTGGTGTCATCAGATTTATTTAGGGAAGATAGTAGTAGTGTTGCTAACTAAATTGACAAGGCAATCAGTCAAATTGAGGAAGTGCAACATGATACCACAAGAATACAAGATTACCTCAGTCATTGTCATTTTGTACCACATGATTAATCTTCATTGTCTTTATGTGTACTGAGTACCTTGTTTGGGTGGATCATATGTCCATATCATCTAGACAGACAAATAAGACTAGATATGGGCTATGAGATTTTAGCAAATTTTCTTTTTAGCATCCCATGCATTTCGAATTTTACACTAATGACACACTTGAGTTTGACATCTTACCTAAACTGAGAACACTGTAGTTCATAAGGTATTTGGATTAAGATCTCTTTACAGAATTACAGCTAAATCTGATGCTTAGTGTTGCTAATCTTTTTCTTTGTTGAAGGAACTACCCACTTCTTATGGCTACATGGAAAGTTGCTCCAGCTCTTGCTGCTGGTTGTGCAGCAATACTTAAGCCCTCAGAAATGGCATCTGTGTATGTTTCTTGTCAAAACATTTCAAGCTAGAATCTCTTTCTGATGCTTCTTTTATACTAATACTTTGTTACATGATTTCTTATATCAGGACTTGTCTAGAATTGGCTGATGTGTGCAGAGAAGTGGGACTTCCTCCAGGTGTGCTAAATATATTGTCAGGATATGGCCCAGAAGCTGGTGGCCCATTAGCATCCCACCCTGATGTTGACAAGGTTCATCCTTGGCTCCTTGTCCTCTTTAAGCTTTACGTTCTTAGTGCATTTGTGTAGCTCCCCGAATATTGAATATGTGGATGTGAACTCTTCTTCATATGCTTCTGTCCATCACATTTCTGTTTAATAGGTTGCATTTACTGGGAGCACTGCTACTGGTAGCAAGATTATGTCTTCTGCTGCTCAACTGGTCAAGGTATGTCATAGCATGTTTAGTCCATATATAAATTTTTGTGAAATTAATTATAGTTCCTTTGACAACATCAATTCTAACATAAACTGCAGCCTGTTTCATTAGAACTTGGTGGGAAAAGTCCAATTATCATCTTTGAAGATGTTGATTTGGATCAAGGTTAGTGGGCATTAAGTTCAGGCAACGTCGGTGCTTTATTATCTAGTAAAAGTGTAAAACTTACGATCAAATACATCTCATAACATGTCAAAATCTATTTTAAATTGGACAGCTGCTGAATGGGCTGCTTTTGGCTGTTTTTGGACTAATGGTCAAATCTGCAGTGCAACATCTAGACTGCTTGTTCATGTGAGTGTCCACTTGCAACAGAACATCTCCTGAATTTCGATGGTTTATTGTTTTTGTGTTGATATAAATGATATTTGTACTTTTGTAGGTTAGTGTTTTCTACAGTTTAATTAGTGTTTTCTACAGTTTAATTTTGTAAAGTTGAATCCATACAATCTTTTCAGGAAAACATTGCAGCTGAATTTTTGGACAGGCTTGTTAAATGGTGCAAAAACATTAAGATTGCTGACCCATTTGAGGACGGTTGCCGGCTTGGTCCTGTTGTCAGCAAGGGACAGGTTTGATAAATTCTTTCCTTTTCTTTTTGGCTTTATTTATTCTTAGCTATTCTGCACGGCATATTAATGTTTACTTCATATTCTTCAGTATGAGAAAGTTCTGAAGTTCATTTCAACTGCAAAGAGTGAGGGTGCAACTATTTTGTGTGGAGGCTCTCGTCCTGAGGTAAATTAGTGGGTGTACTTGTTACTAGCCACTAATGTAGTTTCTATAACCTAATATTATATTTTCATGGAACTATGCAGCATTTGAAGAAAGGGTATTTCATTGAACCAACAATTATAAGTGATGTCTCTACATCCATGCAAATATGGAAGGATGAAGTTTTTGGCCCTGTCTTATGTGTTAAAACTTTTAGTTCTGATGAAGAGGCCATCGAATTGGCAAATGACACCCAGTAAGGCTTTTGAATAGTGGAGCTGCTCAAAATATATTTTAAGACTCTTACCTTCTGTATACCTGCTCTCCCAGTTCATGAGCATCCTATTCTGACCATTTTCTGTATTTCACAGATACGGTTTAGGTGCTGCTGTGCTATCCAAAAATCTTGAAAGGTGTGAGAAAGTGACAAAGGTGAGAATTATTATCTATTAGAGCTTATTTGAATGTCGAACCATTTGTCAAACCTAGGTTTTTATGCTGTTTATTCATGCTTTGATCCAGGCCCTGGAAGTTGGAATTGTTTGGGTGAATTGCTCACAACCGTGCTTTTGCCAAGCTCCATGGGGTGGCACCAAGCGCAGCGGCTTTGGACGGGAACTTGGAGAATGGTGAGACCTTAATTTTTTGCGTTGTACTATTAATTCCTGGAATCCTGATCTATAAATGATGCACATTCTTTTAACTCTGATGCGCATATAGCATCAAACTGTTCAAATTTAGGGTATATACAGAACAAATTTAGGGTATAGCATCAAACTGTTCAAATTTAGCAATCTGCTTGTGTCTCCTTCCTGCTTTCAACATTTTTGATGATCCTGTATAGTTAACTTTGAAAAGTAGCGAATACGGCCTTAATGCATTCGTAGACGCTGTTTCTATTTAGACTACAAAAGCAGTGTATAAAGATTAATGACCCAAACAGATCTACATGGAAAGTTATGGTGACGAAGAAAGGCAAACTTTTGGCAAGGATCGTAACTAGGGAATGAGGATAGGATGGATTGGAGAGATGAATATTGGAGAAGAGGAAAGGGGTCAAAAAAGAGGAGAGTTTAGAGAAAGTGTTTGTTAGATTTTGTCCATTGTCCAATAAGATGTTATGGATTGACTTAGTATTTTCTGATTCAAAGACTAATTAAGAGATAAAAGCTTGATACTTTGATTAATAATGGCTGAATTGGATACAAAAGGATAGATTAATAGCTTAAGGCTATCACTCTCTTGATAACTTTAGGTTATCATTCTCCTAGTAACTTGAGGTTACTACTCTCAACATTTTTCCTCATAATTCACACATAAAGCCTAATGCATATACAGATATACTATCCCCTATTTATACTAAGGAGTTAAGGACTACTAACCTAAAACCATCTAAACATCCCAAATTGCCCTTCCTAAGGTTAATCTATTACATAAGATCAGTTCTCTTTGCTCTTGCAGCATCCTATTTTTATGATATTGAGTACCAATTCTCTAATACATTATCTACTTCGTAAACGATTTTCTATATGGTACAATGCATTAATTTTTGTAATTTCTTCAAATTACTTAACTTGTTGTGGTGCTCTTATTTGCTATCTGAAATAAGGCCTTTTTTCAGCATCACACGTTATAAGTTATGAGTTAGTATAGGAACCATTGTAACTTGAAAGGGCCTTCATGTTAACAAATTTATGTCTTGGGTTGACCAATTATGTATCTATGGTAAAGACTAAAGAATATTTCATAGTATTCTATCAGCGTTGTTGTCTGAGTTCGGAGAAATAATCCTAAGTTGACAACAGAGAGATGTTTATGAGGAATTAGCTTATAGCTTTTTGTGACATATTTGTTGATTGCATGAAAGACGTAAACGAATTTCTCTTAGCTCTTCAGCTCTTGTAAATTGAGGTTTTTTTCCTTGACTTTTTCTGCAGGGGTATTGAGAATTACTTGAATATCAAACAAGTGACTGAATATATCTCTGATGAACCATGGGGATGGTACAAGAATCCTTCAAAGCTTTGAAGAAATTTTAGTGGGTGTTATTAAAGCAATGGAGGTATCGAGATATCGAGGAACATGTCAAGATTGAAATACGGAGCTTACAGATAGTTTGAATAAAGAGGCTGAATATTAAGAGTGTATTATTTGTGTTCTCTACTGTACTACTTGATGGATATTCATTCTTCGATCTTGTAAGCAATGTAGTACGTACTACACAGACTTGATCCTCTCATTAATGGACGTAAAAATTTTATTGTGTTCATTTTGCCTCA

SEQ No.2 CqBADH2.1 CDS sequence

ATGGCGATTCCTTCTCGTCAGCTATTCATTGACGGTGAATGGAAAGAACCCATCAACAAGAATCGCATTCCTGTCATCAATCCTTCCACTGAAGAGATTATCGGTGACATTCCGGCAGCAACTGCTGAGGATGTGGAGCTTGCAGTGGCTGCAGCTAGAAGGGCTCTAAAGAGGAACAAAGGGGCAGATTGGGCAGCTGCATCTGGAGCTCATCGTGCCAAGTACTTACGTGCTATCGCTAAGAGGGTAACAGAAAGAAAAGATGAATTTGCAAAGCTTGAAGCCATGGATTGTGGAAAACCTTTGGATGAAGCAGCATGGGATATTGATGATGTTGCTGGGTGTTTTGAATACTATGCTGATCAAGCAGAAGCTCTTGATGCAAAACAAAAGGCTCCAATTGCCCTTCCTATGGAGACATTCAAGTCTCATGTGCTCAGGCAGCCCATTGGTGTTGTTGGGTTAATTTCTCCGTGGAACTACCCACTTCTTATGGCTACATGGAAAGTTGCTCCAGCTCTTGCTGCTGGTTGTGCAGCAATACTTAAGCCCTCAGAAATGGCATCTGTGACTTGTCTAGAATTGGCTGATGTGTGCAGAGAAGTGGGACTTCCTCCAGGTGTGCTAAATATATTGTCAGGATATGGCCCAGAAGCTGGTGGCCCATTAGCATCCCACCCTGATGTTGACAAGGTTGCATTTACTGGGAGCACTGCTACTGGTAGCAAGATTATGTCTTCTGCTGCTCAACTGGTCAAGCCTGTTTCATTAGAACTTGGTGGGAAAAGTCCAATTATCATCTTTGAAGATGTTGATTTGGATCAAGCTGCTGAATGGGCTGCTTTTGGCTGTTTTTGGACTAATGGTCAAATCTGCAGTGCAACATCTAGACTGCTTGTTCATGAAAACATTGCAGCTGAATTTTTGGACAGGCTTGTTAAATGGTGCAAAAACATTAAGATTGCTGACCCATTTGAGGACGGTTGCCGGCTTGGTCCTGTTGTCAGCAAGGGACAGTATGAGAAAGTTCTGAAGTTCATTTCAACTGCAAAGAGTGAGGGTGCAACTATTTTGTGTGGAGGCTCTCGTCCTGAGCATTTGAAGAAAGGGTATTTCATTGAACCAACAATTATAAGTGATGTCTCTACATCCATGCAAATATGGAAGGATGAAGTTTTTGGCCCTGTCTTATGTGTTAAAACTTTTAGTTCTGATGAAGAGGCCATCGAATTGGCAAATGACACCCAATACGGTTTAGGTGCTGCTGTGCTATCCAAAAATCTTGAAAGGTGTGAGAAAGTGACAAAGGCCCTGGAAGTTGGAATTGTTTGGGTGAATTGCTCACAACCGTGCTTTTGCCAAGCTCCATGGGGTGGCACCAAGCGCAGCGGCTTTGGACGGGAACTTGGAGAATGGGGTATTGAGAATTACTTGAATATCAAACAAGTGACTGAATATATCTCTGATGAACCATGGGGATGGTACAAGAATCCTTCAAAGCTTTGA

SEQ No.3 CqBADH2.1 amino acid sequence

MAIPSRQLFIDGEWKEPINKNRIPVINPSTEEIIGDIPAATAEDVELAVAAARRALKRNKGADWAAASGAHRAKYLRAIAKRVTERKDEFAKLEAMDCGKPLDEAAWDIDDVAGCFEYYADQAEALDAKQKAPIALPMETFKSHVLRQPIGVVGLISPWNYPLLMATWKVAPALAAGCAAILKPSEMASVTCLELADVCREVGLPPGVLNILSGYGPEAGGPLASHPDVDKVAFTGSTATGSKIMSSAAQLVKPVSLELGGKSPIIIFEDVDLDQAAEWAAFGCFWTNGQICSATSRLLVHENIAAEFLDRLVKWCKNIKIADPFEDGCRLGPVVSKGQYEKVLKFISTAKSEGATILCGGSRPEHLKKGYFIEPTIISDVSTSMQIWKDEVFGPVLCVKTFSSDEEAIELANDTQYGLGAAVLSKNLERCEKVTKALEVGIVWVNCSQPCFCQAPWGGTKRSGFGRELGEWGIENYLNIKQVTEYISDEPWGWYKNPSKL

SEQ No.4: CqBADH2.2 LOC110686717

TCTTTCTTTCATCATTTATTATTTCATCAACTTTCTATATTTCTACTCATTTTTCTCTATCCAAGGAAAAATGGCGATTCCTTCTCGTCAGCTATTCATTGACGGGGAATGGAAAGAACCCATCAACAAGAATCGCATTCCTGTCATCAATCCTTCCACTGAAGAGATCATCGGTTAGTTTACTGGATTAATTGCTTCCCCTTTTTAATTTTTTTTTAATAAAAATCTTTTTAAATTTCATGCTTTGAGCTTAATTTCTTCATTTGTAGTTGATTAAGATCCTAGCATTGTGTTATTCAACTCCTAAAGATTTGCTTATAGTGTATAATTTGATGGGATTTTTTATTTATTTTTCTGATAGTGTGATTTCTTGGGATTTGAGTTTGTGATTGCATTTTTTTGACTTGGGTATTTGTTGAAATTTGAAGTTTCTTTCAATCTTCTCTGAACTTGATGTAGTACTGGTGACATATTTGTCAATATGGGGTTTGATTGGAAGGTGATAGAGTGGTTTATTGGGGGATTGAAATTACTTTGTTTGGATCCGATGATTGAAGATTGATATTTTTTATTTTTAAAAGTGATTGAATATTGTATTTAATGAACTGGGTATTAATCAAAATGGGGTTTTACTTTTTATAGGTGACATCCCGGCAGCAACTGCTGAGGATGTGGAGCTTGCAGTTGCTGCAGCTAGAAAGGCTCTTAAGAGGAACAAAGGGGCAGATTGGGCAGCTGCATCTGGAGCTCATCGTGCCAAGTACTTACGTGCTATCGCTAAGAAGGTATGGATTCAGTGGCTTATTTGATCTGATTTGGTAATGTGATCATGTTTTGATAAGTTTGTGTAGGTGGAGTACCAGTGCTAGTTATTCAGTGGCTTATTTGATCTGATTTGGTAATGTGATCATGTTTTGATAAGTTTGTGTAGTTGGAGTACCAGTGGTAGTTGTTTGGAGGTTGGAACTGTAGGTGAATCGGAACACTCGGGTTTGATGATTCTATTTGATTGAAGTGGAGGAGTGATAAAACGAATAGCTCATATAGTATATGTTTGGCAAACTTTGTTAGGATGTTAGGTGAAAGATGAAAGTTAGCTTAATGTTAAAAGCTACTAGCTGGAGATTAGAAGTTAATCTGCTAATTGATTGTACTACAAGTGTTGGTTACTTATCTTAAATGTCTTTATTTTCGCTTCTAGTGGGAATTTGCAGAAGACATTAAGATATATCATTTCTCCTTATTTCATTTGAGTTCAAGATTCTCTCTTGAGCAACATTTCAACTTTCATTTTAAATGGATGAAAATACTATGGATGGATGTTTAGTTTTTATTTAAGTTGAGGTGTGTGTTAATGCCAATCGGATCTTCTAGTAGTTTGAGTGAACTTGTTGGTTAGCTAGTCAGAGAATTTGAGCACTTTTGTTGATACCACTGAATGTTTAATTACTATTGTGGTGGATTTCCCAGGTGTAAATTTTATAACAGTCTTAAGGTCTGTCTTGGCTTTCCCAGCTCTTGGGAAGTAAGGCTGACTGTCCTCGTTTCCCATTGGTATAATCCTGCAATTTGTTACTACCTTATTATAGTCGGTTTGACATATCTACTTAAACAGGGACATGGGGCATTGAGAATATGGTCAAAGTGGATTTATGTTTCATCATCTTAGGGCCAAGTATTAGATACAGATTGATATAAAGGGTCAGACAGGAGATTTTAAAGCATTCCTTTAATTTTGTTTCAATTTAAGCGTTCAAGACTCACTTGTATGTAATCCTTCAAGGGTCATATATTGGTAGAGAATCAGGTGGTAGCTTAGTAACAAAGTTCCCACCTTCCTTGTATCCTTTAGTTGTAAGATGCTTAATCACTTGCCTTTGGCTGGGAATTCTCTTTGGAGATCTCCTTCACACCCCCCCCCCAACCCCCAAACACACACAAACCCTCATTTTGCTTCATTGGACCTGCAAATCTCCAAATAAATTATGTTTCGCCTCTCTCTATCTTTATACGTGGTACTTCGGTAGAAAATATGGATCTGCTTGATACTGGTGTGGACTTCAGGGGTGGCAATATCAAGCCTAACTTTATCTTCACATGCAGGTAACAGAAAGAAAAGATGAACTTGCAAAGCTTGAAGCCATGGATTGTGGAAAACCTTTGGATGAAGCAGCATGGGACATTGTAAGCTCGTAATCTTGTATTCAATATTTCTTGATTCTGTGTCTTTTTTGAGTGCTAATTAGTAACCAAGGCTTTTGTTCTTATGTACAGGATGATGTTGCTGGGTGTTTTGAATACTATGCTGATCAAGCAGAAGCTCTTGATGCTAAACAAAAGGCTCCAATTGCCCTTCCTATGGAGACATTCAAGTCTCATGTGCTCAGGCAGCCCATTGGTGTTGTTGGGTTAATTTCTCCGTGGTAAGTTTTGACCTTAGCCCTCATCCCTCAAAATAAAAAGGCGAAATTGAAACAACTTTAAAGAAATCCCATTTGTTGGCGTCATCAGATTTATTAAGGGAAGATAGTAGTAATGTTGTTAAATTGACAAGGCAATCAGTCAAATTGAGGAAGTACAACATGATACCACAAGAACACAAGATAGTTAGTGTCATTTTGTATCACATGATCAATCTTAATTGTCTTTATGTGTACTGAGTACCTTTTTTTGGTGGACCATATGTCCATATCATCTAGATAGACAAATAAGACTATAGATATGGGCTATGAGATGCTAGCAAATTTTCTTTTTAGCCTCCCATGCATGTAAATCTTATTCTTCCTCCGTTTTTTTAGTTGCAATGCGAATTTTACACTAATCACACACTTGACTTTGACATCTAACCTAAACTGAGTATACTATAGTTCATAAGGTATTTGGATTAAAATCTCTTTACAGCTAAATTTGATGCATAGTGTTGCTATTTTTTCTTTGCTGAAGGAACTACCCACTTCTAATGGCTACATGGAAAGTTGCTCCAGCTCTTGCTGCTGGTTGTGCAGCAATACTTAAGCCCTCAGAAATGGCATCTGTGTATGTTTCTTGTCAAAACATTTCAAGCTAGAATCACTTTCTGATGCTTCTGTTATACTAATACTTTGTTACATGATTTCTCATATCAGGACTTGTCTAGAATTGGCTGATGTGTGCAGAGAAGTGGGACTGCCTCCAGGTGTGCTAAATATATTGTCAGGATATGGCCCAGAAGCTGGTGGCCCATTAGCATCCCACCCTGATGTTGACAAGGTTCATCCTTGGCTCCTTGTCCACTTTAAGCTTTACATTCTTACTGCATTTGTGTAGCTTCCCGAATATTGAATATGTGGATGTGAACTCTTCTTCATATGCTTCTGTCCATCACATTTCTGTTCAATAGGTTGCATTTACTGGGAGCACTGCTACTGGTAGCAAGATTATGTCTTCTGCTGCTCAACTGGTCAAGGTATGTCATAGCATGTTTAGTCCATATATATTTTTGTGAAATTAATTATAGTTCCTTTGACAACATCATTTCTAACATGAACTGCAGCCTGTTACATTAGAACTTGGTGGGAAAAGTCCAATTATCGTCTTTGAAGATGTTGATTTGGATCAAGGTTAGTGGCATTAAGTTCAGGCAACGTTGGTGCTTTATTATCTAGTAAACCTTTCGATCAAATACATGTCATAACATGTCAAAATCTATTTTAAATTGGACAGCTGCTGAATAGGCTGCTTTTGGCTGTTTTTGGACTAATGGTCAAATCTGCAGTGCAACATCTAGACTGCTCGTTCATGTGAGTGTCCACTTGCAACAGAATATCTCCTGAATTTCGATGGTTTATTGTTTTTGTGTTGATATAAATGATATATGTAGGTGAGGTTCTCTACAGTATAATTTCGTAAAGTTGAATCCTTACAATCTTTTCAGGAAAACATTGCAGCTGAATTTTTGGACAGGCTTGTGAAATGGTGCAAAAACATTAAGATTGCTGACCCATTTGAGGACGGCTGCCGGCTTGGTCCTGTTGTCAGCAAGGGGCAGGTTTGATAAATTCTTTCCTTTTCTTTTTGGCTTTATTTATTCTTAGCTATGTTGCACGGCCAATTAATGTTTACTTCATATTCTTCAGTATGAGAAAGTTTTGAAGTTCATTTCAACTGCAAAGAGTGAGGGTGCAACTATTTTGTGTGGAGGCTCTCGTCCTGAGGTAAATTAGTGCGTGTACTTGTTACTAGCCACTAATGTAGTTTCTATAACCTAATATTATATAGTCATGGAACTATGCAGCATTTGAAGAAAGGGTATTTCATTGAACCAACAATTATAAGTGATGTCTCTACGTCCATGCAAATATGGAAGGATGAAGTTTTTGGCCCTGTCTTATGTGTTAAAACTTTTAGTTCTGATGAAGAGGCCATCGCATTGGCAAATGACACCCAGTAAGGCTTTTGAATTGTGGAGCTGCTCAAAATATATTTTAAGACTCTTACCTTCTGTACACCTGCTCTCCCAGTTCATGAGCATCCTATTCTGACCATTTTCTGTGTTTCACAGATACGGTTTAGGTGCTGCTGTGCTATCCAAAAATCTTGAAAGGTGTGAGAAAGTGACAAAGGTGAGAATTATCATCTATTAGAGCTTATTTGAATGTCGAACTATTTGTCAAACCAAGGTTTTTATGCTGTTTATTTATGCTTTGATCCAGGCACTGGAAGCTGGAATTGTTTGGGTAAATTGCTCACAACCGTGCTTTTGCCAAGCTCCATGGGGTGGCACCAAGCGCAGCGGCTTTGGACGTGAACTTGGAGAATGGTGAGACCTTAATTTTTTGCGGTTGTACTATTAATTCCTGGAATCCTGATCTATAAATGATGCACAATCTTTTAGCTCTGATGCGCATATAGCATTAAACTGTTCAAATTTAGGGTATATACAGAACATATTAACACTGGCATATCACCCATAGCAATCTGCTTGTGTCTCCTTCCTGCTTTCAACATTTTTGATGATCCTGTATAGTTAACTTTGAAAAGTAGCGATTACAGCCTTAATGCATTTGTAGACACTGTTTCTATTTAGACTACAGAAGCAGTATATAAAGATTATTGACCCAAACAGATCAGTTACATGGAAAGTTCTGGTGACGAAGAAAGGCAAACTTTTGGGAAGGATCATAACTAGGGAATGAGGATAGGATGGATTGGAGAGATGAATATTGGAGAAGAGGAAAGGGGTCAGGAAAGAGGAGAGTTTAGAGAAAGTGTTTGTTAGATTTTGTCCATTGTCCAATAAGATCAGTTCTCTTTGTTCTTGCAGCATCCTATTTTTATGATATTGAGTATCAATTCTCTTATACATTATCTATCTACTGCATAAACGATTTTCTCTATGGTACAATGCATTTATTCTTGTAATTTCTTCAAATTACTTGAGTTATTGTGGTGCTCTTATTTGCTATCTGAAATTAGGCCTTTTTCAGCATCACACATTATAAATTGTGAATTAGTATAGGAACCATTGTAACTTGAAAGGGCCTTCATGTTAACAAATTTATGTCTTGGGTTGACCAAATATGTATCTATGGTCAAGACTCAAGAATATTTCATAGTATTCTATCAATGTTGTTGTCTGAGTTAGGGGAAATAAACCTAAAAGTTGACAACAGAGAGATGTTTATGAGGAAATTTAGCTTATAGCTTTTTCTGACATATTTGTTGATTGCATGAAAGACGTAAACAAATTGCTCTTAGCTCTTGTAAATTGAGTTTTTTCCTTGACTTTTTCTGCAGGGGTATTGAGAATTACTTGATAATCAAACAAGTGACTGAATATATCTCTGATGAACCATGGGGATGGTACAAGAATCCTTCAAAGCTTTGAAGGAATTTTAGTGGGTGTTATTAAAGCGATGGAGGTATTGAGATATCGAGGAACTTGTCAGGATTGAAATAGAGAGCTTACATAGTTTGAATAAAGAGCTGAATATTAAGAGTGTATTATGTGTGTGCTGTACTGTACTACTTGGTGGATACTCATTCTTCAATCTTTTAAGCAATGAAGTATGTACTATGTATACTTGATCCTCTCATTAATGGACATACAATTTTTTTTTA

SEQ No.5 CqBADH2.2 CDS sequence

ATGGCGATTCCTTCTCGTCAGCTATTCATTGACGGGGAATGGAAAGAACCCATCAACAAGAATCGCATTCCTGTCATCAATCCTTCCACTGAAGAGATCATCGGTGACATCCCGGCAGCAACTGCTGAGGATGTGGAGCTTGCAGTTGCTGCAGCTAGAAAGGCTCTTAAGAGGAACAAAGGGGCAGATTGGGCAGCTGCATCTGGAGCTCATCGTGCCAAGTACTTACGTGCTATCGCTAAGAAGGTAACAGAAAGAAAAGATGAACTTGCAAAGCTTGAAGCCATGGATTGTGGAAAACCTTTGGATGAAGCAGCATGGGACATTGATGATGTTGCTGGGTGTTTTGAATACTATGCTGATCAAGCAGAAGCTCTTGATGCTAAACAAAAGGCTCCAATTGCCCTTCCTATGGAGACATTCAAGTCTCATGTGCTCAGGCAGCCCATTGGTGTTGTTGGGTTAATTTCTCCGTGGAACTACCCACTTCTAATGGCTACATGGAAAGTTGCTCCAGCTCTTGCTGCTGGTTGTGCAGCAATACTTAAGCCCTCAGAAATGGCATCTGTGACTTGTCTAGAATTGGCTGATGTGTGCAGAGAAGTGGGACTGCCTCCAGGTGTGCTAAATATATTGTCAGGATATGGCCCAGAAGCTGGTGGCCCATTAGCATCCCACCCTGATGTTGACAAGGTTGCATTTACTGGGAGCACTGCTACTGGTAGCAAGATTATGTCTTCTGCTGCTCAACTGGTCAAGCCTGTTACATTAGAACTTGGTGGGAAAAGTCCAATTATCGTCTTTGAAGATGTTGATTTGGATCAAGCTGAATTTTTGGACAGGCTTGTGAAATGGTGCAAAAACATTAAGATTGCTGACCCATTTGAGGACGGCTGCCGGCTTGGTCCTGTTGTCAGCAAGGGGCAGTATGAGAAAGTTTTGAAGTTCATTTCAACTGCAAAGAGTGAGGGTGCAACTATTTTGTGTGGAGGCTCTCGTCCTGAGCATTTGAAGAAAGGGTATTTCATTGAACCAACAATTATAAGTGATGTCTCTACGTCCATGCAAATATGGAAGGATGAAGTTTTTGGCCCTGTCTTATGTGTTAAAACTTTTAGTTCTGATGAAGAGGCCATCGCATTGGCAAATGACACCCAATACGGTTTAGGTGCTGCTGTGCTATCCAAAAATCTTGAAAGGTGTGAGAAAGTGACAAAGGCACTGGAAGCTGGAATTGTTTGGGTAAATTGCTCACAACCGTGCTTTTGCCAAGCTCCATGGGGTGGCACCAAGCGCAGCGGCTTTGGACGTGAACTTGGAGAATGGGGTATTGAGAATTACTTGATAATCAAACAAGTGACTGAATATATCTCTGATGAACCATGGGGATGGTACAAGAATCCTTCAAAGCTTTGA

SEQ No.6 CqBADH2.2 amino acid sequence

MAIPSRQLFIDGEWKEPINKNRIPVINPSTEEIIGDIPAATAEDVELAVAAARKALKRNKGADWAAASGAHRAKYLRAIAKKVTERKDELAKLEAMDCGKPLDEAAWDIDDVAGCFEYYADQAEALDAKQKAPIALPMETFKSHVLRQPIGVVGLISPWNYPLLMATWKVAPALAAGCAAILKPSEMASVTCLELADVCREVGLPPGVLNILSGYGPEAGGPLASHPDVDKVAFTGSTATGSKIMSSAAQLVKPVTLELGGKSPIIVFEDVDLDQAEFLDRLVKWCKNIKIADPFEDGCRLGPVVSKGQYEKVLKFISTAKSEGATILCGGSRPEHLKKGYFIEPTIISDVSTSMQIWKDEVFGPVLCVKTFSSDEEAIALANDTQYGLGAAVLSKNLERCEKVTKALEAGIVWVNCSQPCFCQAPWGGTKRSGFGRELGEWGIENYLIIKQVTEYISDEPWGWYKNPSKL

SEQ No.7：CqBADH2-g1

atcaacaagaatcgcattcc

SEQ No.8：CqBADH2-g2

acttacgtgctatcgctaag

SEQ No.9：CqBADH2-g3

ggctccaattgcccttccta

SEQ No.10：CqBADH2-g4

tcctatggagacattcaagt

SEQ No.11：CqBADH2-g5

cattcaagtctcatgtgctc

SEQ No.12：T-CqBADH2-g1F

GGAATGCGATTCTTGTTGAT

SEQ No.13：T-CqBADH2-g1R

atcaacaagaatcgcattcc

SEQ No.14：T-CqBADH2-g2F

acttacgtgctatcgctaag

SEQ No.15：T-CqBADH2-g2R

CTTAGCGATAGCACGTAAGT

SEQ No.16：T-CqBADH2-g3F

ggctccaattgcccttccta

SEQ No.17：T-CqBADH2-g3R

TAGGAAGGGCAATTGGAGCC

SEQ No.18：T-CqBADH2-g4F

ACTTGAATGTCTCCATAGGA

SEQ No.19：T-CqBADH2-g4R

tcctatggagacattcaagt

SEQ No.20：T-CqBADH2-g5F

cattcaagtctcatgtgctc

SEQ No.21：T-CqBADH2-g5R

GAGCACATGAGACTTGAATG

SEQ No.22：M13F

TGTAAAACGACGGCCAGT

SEQ No.23：gRNA-sc-R

AAAAGCACCGACTCGGTGCCA

SEQ No.24：D-CqBADH2-F1

TCTTTCTACTCATTTCTCTTTATCCAAG

SEQ No.25：D-CqBADH2-R1

CAAGTTCAGAGATGATTTAAAAAAGAC

SEQ No.26：D-CqBADH2-F2

CAGTGGCTGCAGCTAGAAGG

SEQ No.27：D-CqBADH2-R2

CCAAACATATACTACATGTGCTATCC

SEQ No.28：D-CqBADH2-F3

AAAGCTTGAAGCCATGGATTG

SEQ No.29：D-CqBADH2-R3

CTTCCCTAAATAAATCTGATGAC

SEQ No.30：D-CqBADH2-F45

AAAGCTTGAAGCCATGGATTG

SEQ No.31：D-CqBADH2-R45

TCACCTTTTATATTTTGAGGGATGG。

Claims

1. An adventitious bud culture medium, wherein the adventitious bud culture medium comprises a basal salt culture medium, trans-zeatin nucleosides and naphthalene acetic acid.

2. The adventitious bud culture medium of claim 1, wherein the adventitious bud culture medium comprises a basal salt culture medium, 2mg/L to 3 mg/L trans-zeatin nucleosides and 0.5mg/L to 1mg/L naphthalene acetic acid.

3. The adventitious bud culture medium of claim 1, wherein the adventitious bud culture medium comprises a basal salt culture medium, trans-zeatin nucleosides and naphthalene acetic acid, and further comprises triiodobenzoic acid.

4. The adventitious bud culture medium of claim 3, wherein the adventitious bud culture medium comprises a basal salt culture medium, 2mg/L to 3 mg/L of the trans-zeatin nucleoside, 0.5mg/L of the triiodobenzoic acid, and 0.5mg/L to 1mg/L of the naphthalene acetic acid.

5. The adventitious bud culture medium of claim 3 or 4, wherein said adventitious bud culture medium comprises a basal salt culture medium, 2mg/L of said trans-zeatin nucleoside, 0.5mg/L of said triiodobenzoic acid, and 0.5mg/L of said naphthalene acetic acid;

alternatively, the adventitious bud medium comprises a basal salt medium, 2.2 mg/L of the trans-zeatin nucleoside, 0.5. 0.5mg/L of the triiodobenzoic acid, and 1. 1mg/L of the naphthylacetic acid.

6. The medium of any one of claims 1 to 4, wherein the basal salt medium is a YR salt basal medium comprising 50mL/L YR major 20 x mother liquor, 10mL/L YR minor 100 x mother liquor, 10mL/L YR iron salt 100 x mother liquor, and 1mL/L YR vitamin 1000 x mother liquor;

the YR large amount of 20 times mother liquor comprises anhydrous calcium chloride and/or calcium chloride dihydrate with the concentration of 2.51 g/L, monopotassium phosphate with the concentration of 8.00 g/L, potassium nitrate with the concentration of 70.70 g/L, magnesium sulfate heptahydrate with the concentration of 3.70 g/L and ammonium nitrate with the concentration of 27.20 g/L;

the YR trace 100 times mother solution comprises cobalt chloride hexahydrate with the concentration of 0.01 g/L, potassium iodide with the concentration of 0.30 g/L, manganese sulfate monohydrate with the concentration of 4.00 g/L, boric acid with the concentration of 1.20 g/L, copper sulfate pentahydrate with the concentration of 0.01 g/L, sodium molybdate dihydrate with the concentration of 0.10 g/L and zinc sulfate heptahydrate with the concentration of 0.80 g/L;

the YR vitamin 1000X mother solution comprises inositol with the concentration of 100.00 g/L, thiamine hydrochloride with the concentration of 1.00 g/L, pyridoxine hydrochloride with the concentration of 0.50 g/L, nicotinic acid with the concentration of 0.50 g/L and glycine with the concentration of 2.00 g/L;

the YR ferric salt 100 times mother solution comprises EDTA ferric sodium salt with the concentration of 3.67. 3.67 g/L.

7. A method of adventitious bud culture medium according to any one of claims 1 to 6 for promoting induction and differentiation of quinoa plant material.

8. The method of claim 7, wherein the quinoa plant is quinoa.

9. The method of claim 7 or 8, wherein the quinoa material is an explant of quinoa after 7 days germination.

10. The method of claim 7 or 8, comprising inoculating quinoa plant material to the adventitious bud culture medium.