CN117448425B - Four-color fluorescence spectrum calibration reagent and preparation method and application thereof - Google Patents

Four-color fluorescence spectrum calibration reagent and preparation method and application thereof Download PDF

Info

Publication number
CN117448425B
CN117448425B CN202311781949.5A CN202311781949A CN117448425B CN 117448425 B CN117448425 B CN 117448425B CN 202311781949 A CN202311781949 A CN 202311781949A CN 117448425 B CN117448425 B CN 117448425B
Authority
CN
China
Prior art keywords
primer pair
fluorescent primer
fluorescent
pcr amplification
amplified product
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202311781949.5A
Other languages
Chinese (zh)
Other versions
CN117448425A (en
Inventor
于颖
韩达
朱柳
师学江
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing Sino Mdgene Technology Co ltd
Original Assignee
Beijing Sino Mdgene Technology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing Sino Mdgene Technology Co ltd filed Critical Beijing Sino Mdgene Technology Co ltd
Priority to CN202311781949.5A priority Critical patent/CN117448425B/en
Publication of CN117448425A publication Critical patent/CN117448425A/en
Application granted granted Critical
Publication of CN117448425B publication Critical patent/CN117448425B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
    • G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
    • G01N21/64—Fluorescence; Phosphorescence
    • G01N21/6428—Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes"
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
    • G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
    • G01N21/64—Fluorescence; Phosphorescence
    • G01N21/6428—Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes"
    • G01N2021/6439—Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes" with indicators, stains, dyes, tags, labels, marks
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Zoology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Analytical Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Optics & Photonics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present disclosure provides a four-color fluorescence spectrum calibration reagent, a preparation method and an application thereof, and relates to the biotechnology field, wherein four-color fluorescence is ROX, TAMRA, HEX and 6-FAM respectively; the method comprises the following steps: labeling ROX, TAMRA, HEX and 6-FAM on the forward primers of the fluorescent primer pair 1, the fluorescent primer pair 2, the fluorescent primer pair 3 and the fluorescent primer pair 4 respectively; respectively mixing the fluorescent primer pair 1, the fluorescent primer pair 2, the fluorescent primer pair 3 and the fluorescent primer pair 4 with a PCR amplification premixed solution and corresponding template DNA to carry out PCR amplification reaction to obtain four groups of amplified product fragments; the amplified product fragment is pretreated to obtain a calibration reagent. Compared with other spectral calibration reagents in the market, the spectral calibration reagent is used for capillary electrophoresis fluorescence spectrum calibration, and the obtained DNA fragment detection spectrum has no overlapping peak and good calibration effect.

Description

Four-color fluorescence spectrum calibration reagent and preparation method and application thereof
Technical Field
The disclosure relates to the field of biotechnology, and in particular relates to a four-color fluorescence spectrum calibration reagent, and a preparation method and application thereof.
Background
Capillary electrophoresis is a novel liquid phase separation technology which uses capillary as a separation channel and uses a high-voltage direct-current electric field as a driving force. The specific nucleotide sequence of the DNA fragment can be determined by capillary electrophoresis, and the amount of DNA to be analyzed can be labeled relative to each other to obtain information such as genotype.
When DNA fragment labeling is performed by capillary electrophoresis, a single capillary simultaneously detects fluorescent signals emitted by a plurality of fluorescent markers, and as the spectrum emitted by the fluorescent markers is not sharp, but is a fluorescent band with a certain width, signal overlapping between different fluorescent spectrums can be caused, and the fluorescent signals are difficult to distinguish by common light splitting. In order to calibrate signal overlap and realize specific analysis of detection signals, spectrum correction processing is required to be carried out on the used fluorescent markers.
While there are eight-color, five-color fluorescence spectrum calibration reagents on the market today, there is a lack of four-color fluorescence spectrum calibration reagents for ROX, TAMRA, HEX and 6-FAM.
Disclosure of Invention
The disclosure provides a four-color fluorescence spectrum calibration reagent, and a preparation method and application thereof, so as to at least solve the technical problems in the prior art.
According to a first aspect of the present disclosure, there is provided a method of preparing a four-color fluorescence spectrum calibration reagent, the four-color fluorescence being ROX, TAMRA, HEX and 6-FAM, respectively; the method comprises the following steps:
labeling ROX, TAMRA, HEX and 6-FAM on the forward primers of the fluorescent primer pair 1, the fluorescent primer pair 2, the fluorescent primer pair 3 and the fluorescent primer pair 4 respectively; wherein the sequence of the fluorescent primer pair 1 is shown in a sequence table SEQ ID NO. 1-2; the sequence of the fluorescent primer pair 2 is shown in a sequence table SEQ ID NO. 3-4; the sequence of the fluorescent primer pair 3 is shown in a sequence table SEQ ID NO. 5-6; the sequence of the fluorescent primer pair 4 is shown in a sequence table SEQ ID NO. 7-8;
respectively mixing the fluorescent primer pair 1, the fluorescent primer pair 2, the fluorescent primer pair 3 and the fluorescent primer pair 4 with a PCR amplification premixed solution and corresponding template DNA to carry out PCR amplification reaction to obtain four groups of amplified product fragments; wherein, the template DNA sequences corresponding to the fluorescent primer pair 1, the fluorescent primer pair 2 and the fluorescent primer pair 4 are shown in a sequence table SEQ ID NO. 9; the DNA sequence of the template corresponding to the fluorescent primer pair 3 is shown in a sequence table SEQ ID NO. 10;
the amplified product fragment is pretreated to obtain a calibration reagent.
In one embodiment, the reaction system of the PCR amplification reaction comprises, in 25. Mu.L: 12.5. Mu.L of PCR amplification premix solution, 2. Mu.L of template DNA, 1. Mu.L of forward primer, 1. Mu.L of reverse primer, and the balance of water.
In one embodiment, the PCR amplification reaction is performed as follows: pre-denaturation at 95℃for 3min; denaturation at 94℃for 15s, annealing at 60℃for 45s, extension for 25 cycles; final extension at 72℃for 10min; preserving at 25deg.C.
In one embodiment, the amplified product fragment is pre-treated to yield a calibration reagent comprising:
the four groups of amplified product fragments are respectively subjected to gel recovery treatment, and the concentration of each group of recovered products is determined;
the four groups of recovered products are mixed according to the molar ratio of 1:1:1 to obtain the calibration reagent.
In one embodiment, the length of the amplified product fragment after the PCR amplification reaction of the fluorescent primer pair 1 and the corresponding template DNA is 75bp.
In one embodiment, the length of the amplified product fragment after the PCR amplification reaction of the fluorescent primer pair 2 and the corresponding template DNA is 102bp.
In one embodiment, the length of the amplified product fragment after PCR amplification reaction of the fluorescent primer pair 3 and the corresponding template DNA is 129bp.
In one embodiment, the length of the amplified product fragment after the PCR amplification reaction of the fluorescent primer pair 4 and the corresponding template DNA is 141bp.
According to a second aspect of the present disclosure, there is provided a four-color fluorescence spectrum calibration reagent, obtained according to the above-described preparation method of the four-color fluorescence spectrum calibration reagent.
According to a third aspect of the present disclosure there is provided the use of a four-colour fluorescence spectrum calibration reagent in capillary electrophoresis fluorescence spectrum calibration.
The present disclosure provides a preparation method of a four-color fluorescence spectrum calibration reagent, which is used for preparing a spectrum calibration reagent of ROX, TAMRA, HEX and 6-FAM four-color fluorescence combination, by setting specific fluorescent primer pairs and respectively marking ROX, TAMRA, HEX and 6-FAM four kinds of fluorescence on forward primers of the four groups of fluorescent primer pairs; mixing each group of fluorescent primer pairs with the PCR amplification premixed solution and the corresponding template DNA for PCR amplification reaction to obtain amplified product fragments with corresponding sizes; the amplified product fragment is pretreated to prepare the spectrum calibration reagent. The spectrum calibration reagent is used for capillary electrophoresis fluorescence spectrum calibration, and the obtained DNA fragment detection spectrum has no overlapping peak and good calibration effect, so that the interpretation of the detection result is more accurate.
It should be understood that the description in this section is not intended to identify key or critical features of the embodiments of the disclosure, nor is it intended to be used to limit the scope of the disclosure. Other features of the present disclosure will become apparent from the following specification.
Drawings
The above, as well as additional purposes, features, and advantages of exemplary embodiments of the present disclosure will become readily apparent from the following detailed description when read in conjunction with the accompanying drawings. Several embodiments of the present disclosure are illustrated by way of example, and not by way of limitation, in the figures of the accompanying drawings, in which:
in the drawings, the same or corresponding reference numerals indicate the same or corresponding parts.
FIG. 1 is a schematic diagram showing a spectrum calibration result obtained by performing fluorescence spectrum calibration by using the four-color fluorescence spectrum calibration reagent prepared in example 1 of the present disclosure;
FIG. 2 shows a fluorescence spectrum of a detection sample corresponding to embodiment 2 of the present disclosure;
FIG. 3 is a schematic diagram showing a spectrum calibration result obtained by performing fluorescence spectrum calibration on the four-color fluorescence spectrum calibration reagent prepared in comparative example 1 of the present disclosure;
FIG. 4 is a schematic diagram showing a spectrum calibration result obtained by performing fluorescence spectrum calibration on the four-color fluorescence spectrum calibration reagent prepared in comparative example 2 of the present disclosure;
fig. 5 shows a fluorescence spectrum of a detection sample obtained by using a five-color fluorescence spectrum calibration reagent according to comparative example 3 of the present disclosure.
Detailed Description
In order to make the objects, features and advantages of the present disclosure more comprehensible, the technical solutions in the embodiments of the present disclosure will be clearly described in conjunction with the accompanying drawings in the embodiments of the present disclosure, and it is apparent that the described embodiments are only some embodiments of the present disclosure, but not all embodiments. Based on the embodiments in this disclosure, all other embodiments that a person skilled in the art would obtain without making any inventive effort are within the scope of protection of this disclosure.
There is currently a lack of spectroscopic calibration reagents for the four-color fluorescent combination of ROX, TAMRA, HEX and 6-FAM. Based on this, an embodiment of the present disclosure provides a method for preparing a four-color fluorescence spectrum calibration reagent.
Example 1
A method for preparing a four-color fluorescence spectrum calibration reagent, comprising:
s1, labeling ROX, TAMRA, HEX and 6-FAM on the forward primers of the fluorescent primer pair 1, the fluorescent primer pair 2, the fluorescent primer pair 3 and the fluorescent primer pair 4 respectively; wherein the sequence of the fluorescent primer pair 1 is shown in a sequence table SEQ ID NO. 1-2; the sequence of the fluorescent primer pair 2 is shown in a sequence table SEQ ID NO. 3-4; the sequence of the fluorescent primer pair 3 is shown in a sequence table SEQ ID NO. 5-6; the sequence of the fluorescent primer pair 4 is shown in a sequence table SEQ ID NO. 7-8.
Wherein the sequences of the forward primer and the reverse primer of the fluorescent primer pair 1 are respectively as follows:
forward primer (SEQ ID No. 1): TGCTGAAAATGACTGAATATAAACTTG;
reverse primer (SEQ ID NO. 2): GCTGTATCGTCAAGGCACTC;
after labeling ROX on the forward primer, the forward primer sequence is modified to:
ROX-TGCTGAAAATGACTGAATATAAACTTG。
the sequences of the forward primer and the reverse primer of the fluorescent primer pair 2 are as follows:
forward primer (SEQ ID No. 3): CTGATGGCGTAGGCAAGAG;
reverse primer (SEQ ID NO. 4): TGCATATTAAAACAAGATTTACCTCTAT;
after labeling the TAMRA on the forward primer, the forward primer sequence is modified to:
TAMRA-CTGATGGCGTAGGCAAGAG。
wherein the sequences of the forward primer and the reverse primer of the fluorescent primer pair 3 are respectively as follows:
forward primer (SEQ ID No. 5): TTCCTTTACTTACTACACCTCAGAT;
reverse primer (SEQ ID NO. 6): GATCCAGACAACTGTTCAAACT;
after labeling HEX on the forward primer, the forward primer sequence is modified to:
HEX-TTCCTTTACTTACTACACCTCAGAT。
wherein the sequences of the forward primer and the reverse primer of the fluorescent primer pair 4 are respectively as follows:
forward primer (SEQ ID No. 7): TGCTGAAAATGACTGAATATAAACTTG;
reverse primer (SEQ ID NO. 8): TGCATATTAAAACAAGATTTACCTCTAT;
after labeling the 6-FAM on the forward primer, the forward primer sequence is modified as:
6-FAM-TGCTGAAAATGACTGAATATAAACTTG。
s2, respectively mixing the fluorescent primer pair 1, the fluorescent primer pair 2, the fluorescent primer pair 3 and the fluorescent primer pair 4 with a PCR amplification premixed solution and corresponding template DNA to carry out PCR amplification reaction to obtain four groups of amplified product fragments; wherein, the template DNA sequences corresponding to the fluorescent primer pair 1, the fluorescent primer pair 2 and the fluorescent primer pair 4 are shown in a sequence table SEQ ID NO. 9; the DNA sequence of the template corresponding to the fluorescent primer pair 3 is shown in a sequence table SEQ ID NO. 10.
Specifically, the template DNA sequences corresponding to the fluorescent primer pair 1, the fluorescent primer pair 2 and the fluorescent primer pair 4 are as follows:
template DNA (SEQ ID No. 9):
GAGTTTGTATTAAAAGGTACTGGTGGAGTATTTGATAGTGTATTAACCTTATGTGTGACATGTTCTAATATAGTCACATTTTCATTATTTTTATTATAAGGCCTGCTGAAAATGACTGAATATAAACTTGTGGTAGTTGGAGCTGATGGCGTAGGCAAGAGTGCCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAGGTAAATCTTGTTTTAATATGCATATTACTGGTGCAGGACCATTCTTTGATACAGATAAAGGTTTCTCTGACCATTTTCATGAGT。
the template DNA sequence corresponding to the fluorescent primer pair 3 is as follows:
template DNA (SEQ ID No. 10):
TAAGAGGAAAGATGAAGTACTATGTTTTAAAGAATATTATATTACAGAATTATAGAAATTAGATCTCTTACCTAAACTCTTCATAATGCTTGCTCTGATAGGAAAATGAGATCTACTGTTTTCCTTTACTTACTACACCTCAGATATATTTCTTCATGAAGACCTCACAGTAAAAATAGGTGATTTTGGTCTAGCTACAGAGAAATCTCGATGGAGTGGGTCCCATCAGTTTGAACAGTTGTCTGGATCCATTTTGTGGATGGTA。
in one example, the PCR amplification reaction system comprises, in 25. Mu.L: 12.5. Mu.L of PCR amplification premix solution, 2. Mu.L of template DNA, 1. Mu.L of forward primer, 1. Mu.L of reverse primer, and the balance of water. Wherein the PCR amplification pre-mixed solution comprises a PCR buffer solution, dNTPs, taq DNA polymerase and magnesium ions.
The fluorescent primer pair 1 and the corresponding template DNA carry out PCR amplification reaction, and specifically comprises the following steps: after the PCR amplification premix solution of 12.5. Mu.L, the forward primer of 2. Mu. L, ROX labeled template DNA shown in SEQ ID NO.9 of 1. Mu.L, the reverse primer of 1. Mu.L and the ultrapure water of 8.5. Mu.L were uniformly mixed, a PCR amplification reaction was carried out to obtain an amplified product fragment, wherein the length of the amplified product fragment was 75bp.
The fluorescent primer pair 2 and the corresponding template DNA carry out PCR amplification reaction, and specifically comprises the following steps: after the PCR amplification premix solution of 12.5. Mu.L, the forward primer of 2. Mu. L, TAMRA labeled template DNA shown in SEQ ID NO.9 of 1. Mu.L, the reverse primer of 1. Mu.L and the ultrapure water of 8.5. Mu.L were uniformly mixed, a PCR amplification reaction was carried out to obtain an amplification product fragment, wherein the length of the amplification product fragment was 102bp.
The fluorescent primer pair 3 and the corresponding template DNA carry out PCR amplification reaction, and specifically comprises the following steps: after the PCR amplification premix solution of 12.5. Mu.L, the forward primer of 2. Mu. L, HEX labeled template DNA shown in SEQ ID NO.10 of 1. Mu.L, the reverse primer of 1. Mu.L and the ultrapure water of 8.5. Mu.L were uniformly mixed, a PCR amplification reaction was carried out to obtain an amplification product fragment, wherein the length of the amplification product fragment was 129bp.
The fluorescent primer pair 4 and the corresponding template DNA carry out PCR amplification reaction, and specifically comprises the following steps: after 12.5. Mu.L of the pre-mixed solution for PCR amplification, 2. Mu.L of the template DNA shown in SEQ ID NO.9, 1. Mu.L of the forward primer labeled with 6-FAM, 1. Mu.L of the reverse primer and 8.5. Mu.L of ultrapure water are uniformly mixed, a PCR amplification reaction is carried out to obtain an amplification product fragment, wherein the length of the amplification product fragment is 141bp.
The four PCR amplification reactions were all identical in procedure, and the amplification reaction procedure was: pre-denaturation at 95℃for 3min; denaturation at 94℃for 15s, annealing at 60℃for 45s, extension for 25 cycles; final extension at 72℃for 10min; preserving at 25deg.C.
S3, pretreating the amplified product fragment to obtain a calibration reagent.
In one example, the amplified product fragment is pre-treated to yield a calibration reagent comprising:
the four groups of amplified product fragments are respectively subjected to gel recovery treatment, and the concentration of each group of recovered products is determined;
the four groups of recovered products are mixed according to the molar ratio of 1:1:1 to obtain the calibration reagent.
The scheme is that a spectrum calibration reagent of a ROX, TAMRA, HEX and 6-FAM four-color fluorescence combination is prepared, and the ROX, TAMRA, HEX and 6-FAM four types of fluorescence are respectively marked on the forward primers of the four groups of fluorescence primer pairs by setting specific fluorescence primer pairs; mixing each group of fluorescent primer pairs with the PCR amplification premixed solution and the corresponding template DNA for PCR amplification reaction to obtain amplified product fragments with corresponding sizes; the amplified product fragment is pretreated to prepare the spectrum calibration reagent. The spectroscopic reagent is used in capillary electrophoresis fluorescence spectrum calibration. The obtained DNA fragment detection map has no overlapping peak and good calibration effect, so that the interpretation of the detection result is more accurate.
Example 2
An embodiment of the present disclosure further provides an application of the four-color fluorescence spectrum calibration reagent in capillary electrophoresis fluorescence spectrum calibration.
Fluorescent spectrum calibration was performed on 3500Dx sequencer of ABI company using the four-color fluorescent spectrum calibration reagent prepared in example 1, and the spectrum calibration result is shown in fig. 1.
According to the calibration chart shown in FIG. 1, the abscissa is the scanning times (Scan Number), the ordinate is the fluorescence Intensity (Intensity), the peaks corresponding to ROX, TAMRA, HEX and 6-FAM four-color fluorescence in the calibration chart are single peaks, the difference of the fluorescence Intensity values of different fluorescence labeled product fragments is small, and the fluorescence Intensity is about 3000.
After the sequencer is calibrated, 20-25 ng/. Mu.L of tumor tissue formalin-fixed paraffin-embedded slice sample DNA of colorectal cancer patients is detected by adopting a human microsatellite instability (MSI) gene detection kit (multiple fluorescence PCR-capillary electrophoresis method) (Beijing Xin Nuomedi gene detection technology Co., ltd.) by adopting a fragment analysis method, DNA is taken as a template by the kit, DNA fragments with different numbers and different lengths and with different fluorescent labels are generated through PCR amplification, and then the result interpretation and analysis are carried out by utilizing the difference of fluorescent labels of all fragments and the relative molecular size by adopting a capillary electrophoresis method.
As shown in fig. 2, the upper graph is a graph corresponding to cancer tissue, the lower graph is a graph corresponding to paracancerous tissue, and according to the graph, it is obvious that ROX, TAMRA, HEX and 6-FAM four-color fluorescence have no overlapping peaks.
Comparative example 1
A method for preparing a four-color fluorescence spectrum calibration reagent, which is different from example 1: the amplified product fragment was subjected to pretreatment to obtain a calibration reagent, and the rest of the procedure was the same as in example 1.
Wherein the amplified product fragment is subjected to pretreatment to obtain a calibration reagent comprising:
the four groups of amplified product fragments are respectively subjected to gel recovery treatment, and the concentration of each group of recovered products is determined;
four sets of recovered products were obtained in a copy number ratio of 1:1:1:1 (i.e., molar ratio 10:8:6:5) to give a calibration reagent.
The 3500Dx sequencer of ABI company was subjected to spectral calibration using the four-color fluorescence spectrum calibration reagent prepared in comparative example 1, and the result of the spectral calibration is schematically shown in fig. 3.
As can be seen from the calibration results in FIG. 3, the peaks of ROX, TAMRA, HEX and 6-FAM four-color fluorescence in the calibration patterns are single peaks, but the fluorescence intensity values of the product fragments marked by different fluorescence are greatly different, so that the accuracy of the calibration results is affected.
Comparative example 2
A method for preparing a four-color fluorescence spectrum calibration reagent is different from example 1 in the procedure of PCR amplification reaction, and the other steps are the same as in example 1.
The PCR amplification reaction procedure was: pre-denaturation at 95℃for 3min; denaturation at 94℃for 15s, annealing at 60℃for 45s, extension for 45 cycles; final extension at 72℃for 10min; preserving at 25deg.C.
The 3500Dx of ABI company was subjected to spectral calibration using the four-color fluorescence spectrum calibration reagent prepared in comparative example 2, and a schematic diagram of the result of the spectral calibration is shown in fig. 4.
From the calibration results in fig. 4, it can be seen that the calibration patterns are bimodal and the fluorescence intensity values of the different fluorescence-labeled product fragments are greatly different, which affects the accuracy of the calibration results.
Comparative example 3
Use of a five-color fluorescence spectrum calibration reagent in capillary electrophoresis fluorescence spectrum calibration.
The five-color fluorescence spectrum calibration reagent is Dye Set G5 of ABI company, and the sequencing instrument is calibrated by using the calibration reagent.
After calibration of the sequencer, 20-25 ng/. Mu.L of tumor tissue formalin-fixed paraffin-embedded slice DNA samples of colorectal cancer patients were detected using a human microsatellite instability (MSI) gene detection kit (multiplex fluorescence PCR-capillary electrophoresis) (Beijing Xin Nuomedi Gene detection technology Co., ltd.).
FIG. 5 shows the patterns of the test sample, wherein the upper pattern is the pattern corresponding to the cancerous tissue, and the lower pattern is the pattern corresponding to the paracancerous tissue; according to the spectrum, the overlapping peaks of different fluorescence labeled product fragments can be seen, so that the interpretation of the result is affected.
It should be appreciated that various forms of the flows shown above may be used to reorder, add, or delete steps. For example, the steps recited in the present disclosure may be performed in parallel or sequentially or in a different order, provided that the desired results of the technical solutions of the present disclosure are achieved, and are not limited herein.
Furthermore, the terms "first," "second," and the like, are used for descriptive purposes only and are not to be construed as indicating or implying a relative importance or implicitly indicating the number of technical features indicated. Thus, a feature defining "a first" or "a second" may explicitly or implicitly include at least one such feature. In the description of the present disclosure, the meaning of "a plurality" is two or more, unless explicitly defined otherwise.
The foregoing is merely specific embodiments of the disclosure, but the protection scope of the disclosure is not limited thereto, and any person skilled in the art can easily think about changes or substitutions within the technical scope of the disclosure, and it is intended to cover the scope of the disclosure. Therefore, the protection scope of the present disclosure shall be subject to the protection scope of the claims.

Claims (8)

1. A preparation method of a four-color fluorescence spectrum calibration reagent, which is characterized in that the four-color fluorescence is ROX, TAMRA, HEX and 6-FAM respectively; the method comprises the following steps:
labeling ROX, TAMRA, HEX and 6-FAM on the forward primers of the fluorescent primer pair 1, the fluorescent primer pair 2, the fluorescent primer pair 3 and the fluorescent primer pair 4 respectively; wherein the sequence of the fluorescent primer pair 1 is shown in a sequence table SEQ ID NO. 1-2; the sequence of the fluorescent primer pair 2 is shown in a sequence table SEQ ID NO. 3-4; the sequence of the fluorescent primer pair 3 is shown in a sequence table SEQ ID NO. 5-6; the sequence of the fluorescent primer pair 4 is shown in a sequence table SEQ ID NO. 7-8;
respectively mixing the fluorescent primer pair 1, the fluorescent primer pair 2, the fluorescent primer pair 3 and the fluorescent primer pair 4 with a PCR amplification premixed solution and corresponding template DNA to carry out PCR amplification reaction to obtain four groups of amplified product fragments; wherein, the template DNA sequences corresponding to the fluorescent primer pair 1, the fluorescent primer pair 2 and the fluorescent primer pair 4 are shown in a sequence table SEQ ID NO. 9; the DNA sequence of the template corresponding to the fluorescent primer pair 3 is shown in a sequence table SEQ ID NO. 10; the PCR amplification reaction is carried out by the following steps: 95 ℃ for 3min;94 ℃,15s,60 ℃,45s,25 cycles; 72 ℃ for 10min; preserving at 25 ℃;
the four groups of amplified product fragments are respectively subjected to gel recovery treatment, and the concentration of each group of recovered products is determined;
the four groups of recovered products are mixed according to the molar ratio of 1:1:1 to obtain the calibration reagent.
2. The method according to claim 1, wherein the reaction system of the PCR amplification reaction comprises, in 25. Mu.L: 12.5. Mu.L of PCR amplification premix solution, 2. Mu.L of template DNA, 1. Mu.L of forward primer, 1. Mu.L of reverse primer, and the balance of water.
3. The method according to claim 1, wherein the length of the amplified product fragment after PCR amplification reaction of the fluorescent primer set 1 and the corresponding template DNA is 75bp.
4. The method according to claim 1, wherein the length of the amplified product fragment after PCR amplification reaction of the fluorescent primer set 2 and the corresponding template DNA is 102bp.
5. The method according to claim 1, wherein the length of the amplified product fragment after PCR amplification reaction of the fluorescent primer set 3 and the corresponding template DNA is 129bp.
6. The method according to claim 1, wherein the length of the amplified product fragment after PCR amplification reaction of the fluorescent primer set 4 and the corresponding template DNA is 141bp.
7. A four-color fluorescence spectrum calibration reagent prepared according to the method of any one of claims 1-6.
8. Use of a four-color fluorescence spectrum calibration reagent prepared according to the method of any one of claims 1-6 in capillary electrophoresis fluorescence spectrum calibration.
CN202311781949.5A 2023-12-22 2023-12-22 Four-color fluorescence spectrum calibration reagent and preparation method and application thereof Active CN117448425B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202311781949.5A CN117448425B (en) 2023-12-22 2023-12-22 Four-color fluorescence spectrum calibration reagent and preparation method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202311781949.5A CN117448425B (en) 2023-12-22 2023-12-22 Four-color fluorescence spectrum calibration reagent and preparation method and application thereof

Publications (2)

Publication Number Publication Date
CN117448425A CN117448425A (en) 2024-01-26
CN117448425B true CN117448425B (en) 2024-03-19

Family

ID=89589544

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202311781949.5A Active CN117448425B (en) 2023-12-22 2023-12-22 Four-color fluorescence spectrum calibration reagent and preparation method and application thereof

Country Status (1)

Country Link
CN (1) CN117448425B (en)

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2192198A1 (en) * 2008-12-01 2010-06-02 Biotype AG Novel combination of fluorescent dyes for the detection of nucleic acids
CN102260671A (en) * 2011-07-18 2011-11-30 公安部物证鉴定中心 Five-color fluorescent matrix standard substance and preparation method as well as special primer composition thereof
CN107976478A (en) * 2017-11-21 2018-05-01 南京溯远基因科技有限公司 A kind of more dyestuff collection method for nucleic acid analysis and its application based on Capillary Electrophoresis
CN110438223A (en) * 2018-05-03 2019-11-12 同济大学苏州研究院 Detect primer, probe and its kit and detection method of Kras point mutation
CN110885883A (en) * 2018-11-21 2020-03-17 广州易锦生物技术有限公司 DNA reference standard and application thereof
CN113736779A (en) * 2021-09-26 2021-12-03 公安部第一研究所 Eight-color fluorescence spectrum calibration reagent and preparation method thereof

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2192198A1 (en) * 2008-12-01 2010-06-02 Biotype AG Novel combination of fluorescent dyes for the detection of nucleic acids
CN102260671A (en) * 2011-07-18 2011-11-30 公安部物证鉴定中心 Five-color fluorescent matrix standard substance and preparation method as well as special primer composition thereof
CN107976478A (en) * 2017-11-21 2018-05-01 南京溯远基因科技有限公司 A kind of more dyestuff collection method for nucleic acid analysis and its application based on Capillary Electrophoresis
CN110438223A (en) * 2018-05-03 2019-11-12 同济大学苏州研究院 Detect primer, probe and its kit and detection method of Kras point mutation
CN110885883A (en) * 2018-11-21 2020-03-17 广州易锦生物技术有限公司 DNA reference standard and application thereof
CN113736779A (en) * 2021-09-26 2021-12-03 公安部第一研究所 Eight-color fluorescence spectrum calibration reagent and preparation method thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Influence of fluorophor dye labels on the migration behavior of polymerase chain reaction – amplified short tandem repeats during denaturing capillary electrophoresis;Fluorophor-specific，等;Electrophoresis;20010831;第22卷;第2691–2700页 *

Also Published As

Publication number Publication date
CN117448425A (en) 2024-01-26

Similar Documents

Publication Publication Date Title
EP2370596B1 (en) Novel combination of fluorescent dyes for the detection of nucleic acids
WO2000031306A9 (en) Multiplex amplification of short tandem repeat loci
EP0777747A1 (en) Nucleotide sequencing method
CN109880911B (en) Composite amplification kit for 25 human chromosome loci and application thereof
Shimizu et al. Universal fluorescent labeling (UFL) method for automated microsatellite analysis
CN108753965B (en) Composite amplification detection system for microsatellite unstable state and application thereof
CN109880913B (en) Composite amplification kit for 38 human Y chromosome loci and application thereof
Tsukada et al. Multiplex short tandem repeat typing in degraded samples using newly designed primers for the TH01, TPOX, CSF1PO, and vWA loci
Bottero et al. Differentiation of five tuna species by a multiplex primer-extension assay
CN104178566B (en) A kind ofly can be used for multiple fluorescence PCR universal joint that micro-satellite detects and detection method and application
van den Boom et al. Mass spectrometric analysis of cytosine methylation by base-specific cleavage and primer extension methods
CN111893192B (en) Mixed detection material analysis micro haplotype composite amplification system and construction and haplotype frequency
CN117448425B (en) Four-color fluorescence spectrum calibration reagent and preparation method and application thereof
CN107893120B (en) Primer group for detecting motion gene SNP, application and product thereof, and detection method and application for detecting motion gene SNP
Tun et al. Simultaneous detection of multiple STR loci on sex chromosomes for forensic testing of sex and identity
CN113416769B (en) Method, composition and use for detecting microsatellite instability of non-control sample based on next generation sequencing technology
CN110343763A (en) A kind of mankind's microsatellite instability state MSI detection site and detection method and application
CN108517364A (en) Forensic medicine composite detection kit based on 56 Y chromosome SNP genetic markers
JP4336877B2 (en) Method for detecting β3 adrenergic receptor mutant gene and nucleic acid probe and kit therefor
DE10104937A1 (en) fluorescence polarization
CN113957176A (en) Detection reagent, reaction system and kit for identifying new coronavirus variant strain and wild strain and application
EP0552545A1 (en) Detection of polymorphisms in simple sequence repeats using oligonucleotide ligation
CN112176068B (en) Composite amplification system based on 29Y-STR loci and primer combination used by same
CN116640854B (en) Marker, method and primer probe composition for analyzing microsatellite instability
CN110577985A (en) Method for detecting DNA methylation

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant