CN109880913B

CN109880913B - Composite amplification kit for 38 human Y chromosome loci and application thereof

Info

Publication number: CN109880913B
Application number: CN201910170096.9A
Authority: CN
Inventors: 不公告发明人
Original assignee: Beijing Peoplespot Technology Co ltd
Current assignee: Beijing Peoplespot Technology Co ltd
Priority date: 2019-03-07
Filing date: 2019-03-07
Publication date: 2022-08-19
Anticipated expiration: 2039-03-07
Also published as: CN109880913A

Abstract

The invention relates to a composite amplification kit for 38 human Y chromosome loci and application thereof. The invention provides a composite amplification system of 38 loci of human Y chromosome, which comprises specific primers for amplifying 38 loci, wherein the 38 loci comprise 35 STR loci and 3 Indel loci. Grouping fluorescence labeling is carried out on the 38 pairs of specific primers by utilizing a six-color fluorescence labeling technology, and efficient, specific and sensitive amplification of 38 human Y chromosome loci is realized through design and optimization of primer sequences and working concentration. The detection result of the composite amplification system has high individual recognition capability and good data compatibility, so that the composite amplification system can be practically used for paternity test and individual recognition, the detection cost of human DNA typing is effectively reduced, and the detection working efficiency is improved.

Description

Composite amplification kit for 38 human Y chromosome loci and application thereof

Technical Field

The invention relates to the technical field of molecular genetics and biological detection, in particular to a composite amplification kit for 38 human Y chromosome loci and application thereof.

Background

Short Tandem Repeat Sequences (STRs), also known as microsatellites or Simple Sequence Repeats (SSRs), are DNA Tandem Repeat sequences widely existing in eukaryotic genomes, have core sequences of dozens to more than one hundred nucleotide Repeat sequences consisting of 2-6 base Repeat units, and are currently and generally applied genetic markers. STR loci are large in number, wide in distribution and high in polymorphism, the polymorphism mainly derives from the difference of the repetition times of a core sequence among individuals, and the difference follows Mendelian genetic rules in the genetic process. Therefore, STR amplification detection techniques are widely used for individual identification, genetic identification and population genetics research.

The Y-STR is a short tandem repeat sequence existing on a male Y chromosome, is unique to human males only on the Y chromosome, is inherited according to a paternal haplotype, has unique application value in forensic paternity test and individual identification, human ethology, human origin and evolution research, and has important application prospect in research work of noninvasive prenatal gene diagnosis.

At present, the Y-STR multiplex amplification technology is a main auxiliary means for forensic individual identification and paternity test, and plays an important role in cases of sexual invasion, mixed sample differentiation, family investigation and the like. Along with the development of the Y-STR detection technology, the construction of a Y-STR database is also paid more attention gradually, and a DNA database of the Y-STR is established in many countries by using the technology, namely, the Y-STR data of the criminals and the criminal suspects are analyzed and recorded into the database, so that the work of comparison, investigation and the like is facilitated.

The early Y-STR multiplex amplification technology can realize amplification of more than ten Y-STR loci in one reaction system, with the wide application and the increase of data comparison, the information provided by more than ten loci can not meet the requirements of current users, and manufacturers at home and abroad are also developing products containing more loci in many times, for example, an AmpFISTR Yfiler kit of ABI company in the United states can amplify 17 loci, and a Goldeye 26Y kit of cognitive technology (Beijing) Co., Ltd can amplify 26 loci, and the like.

With the wider application of DNA detection in bioassay technology, users have higher requirements on the number, information content and compatibility of loci contained in the kit, and in some genetic identification, more loci are required to provide more information. For example, when the paternity test and missing population comparison are performed, the probability of misjudgment may increase as the number of detected loci is smaller, and the correct judgment is often made by additionally detecting the Y-STR locus. At present, the common method is to select Y-STR detection kits of several companies to be used together, and achieve the purpose of multiple detection sites in a superposition mode, so as to make correct judgment. The existing Y-STR detection kit can not meet the requirement of simultaneously detecting 25 core loci and 15 preferred loci, and the identification capability needs to be improved.

In addition, new requirements for kit compatibility are also made in the construction of DNA databases. With the continuous expansion of the construction speed and scale of DNA databases in China, the data comparison function is more and more important. The data comparison is based on the data obtained by the STR multiplex amplification analysis, and the compatibility of each STR kit on loci is required. Therefore, the development of a Y-STR multiplex amplification kit that can amplify more loci, provide more information, and have better compatibility in one reaction is of great significance to meet the development of DNA identification technology and market needs.

Disclosure of Invention

In order to solve the technical problems of the prior art that the quantity of STR loci detected by multiplex amplification at the same time is limited, the compatibility of a kit is poor and the like, the invention provides a multiplex amplification kit capable of detecting 38Y chromosome loci at the same time and application thereof.

The 38Y chromosome loci simultaneously detected by multiplex amplification comprise 35 STR loci and 3 unique InDel of Chinese.

In one aspect, the present invention provides a locus molecular marker for typing human Y chromosomal DNA, wherein the molecular marker comprises the following 38 loci: DYS392, DYS533, DYS390, DYS593, DYS448, DYS460, DYS645, DYS393, DYS437, DYS549, DYS596, DYS635, DYS527a, DYS527b, DYS444, DYS643, DYS391, DYS576, DYS481, DYS19, DYS438, DYS449, dysf 387S1, DYS439, DYS389i, Y _ GATA _ H4, DYS389 ii, DYS570, DYS522, DYS456, DYS458, DYS627, DYS385a, DYS385b, DYS518, DYS557, rs199815934, rs771783753, rs 9551978.

In another aspect, the present invention provides a multiplex amplification kit for 38 loci of human Y chromosome, comprising amplification primers for 38 loci as locus molecular markers for Y chromosome DNA typing.

It will be understood by those skilled in the art that the product for multiplex amplification of the 38Y chromosome loci can be prepared in different forms as required, including but not limited to detection reagents, kits, detection or amplification systems, and all products that include amplification primers for the 38Y chromosome loci and are capable of performing multiplex amplification of the 38Y chromosome loci are within the scope of the present invention.

Preferably, the sequences of the amplification primers are shown in the following table:

amplification primer sequences for Table 138Y chromosomal loci

More preferably, the working concentration of the primers in the multiplex amplification kit during amplification is as follows: DYS392, 0.1. mu.M; DYS533, 0.06. mu.M; DYS390, 0.03. mu.M; DYS593, 0.05. mu.M; DYS448, 0.06. mu.M; DYS460, 0.05. mu.M; DYS645, 0.09. mu.M; DYS393, 0.06. mu.M; DYS437, 0.06. mu.M; DYS549, 0.09. mu.M; DYS596, 0.08. mu.M; DYS635, 0.08. mu.M; DYS527a and DYS527b, 0.05 μ M; DYS444, 0.1. mu.M; DYS643, 0.1. mu.M; DYS391, 0.05. mu.M; DYS576, 0.08. mu.M; DYS481, 0.3. mu.M; DYS19, 0.18. mu.M; DYS438, 0.25. mu.M; DYS449, 0.1. mu.M; DYF387S1, 0.11 μ M; DYS439, 0.11. mu.M; DYS389I, 0.1 μ M; y _ GATA _ H4, 0.1 μ M; DYS389 II, 0.20 μ M; DYS447, 0.26. mu.M; DYS570, 0.09. mu.M; DYS522, 0.13. mu.M; DYS456, 0.06. mu.M; DYS458, 0.06. mu.M; DYS627, 0.05 μ M; DYS385a and DYS385b, 0.09. mu.M; DYS518, 0.08. mu.M; DYS557, 0.12. mu.M; rs199815934, 0.06 μ M; rs771783753, 0.16 μ M; rs759551978, 0.08 μ M.

To achieve simultaneous rapid amplification of the 38 loci, a six-color fluorescent labeling system can be selected to perform fluorescent dye labeling of the amplification primers.

The specific fluorescent dye labeling method is as follows: dividing the amplification primers of the 38 loci into the following five groups, respectively marking the amplification primers of the five groups by using fluorescent dyes with five different colors, wherein the amplification primers of each group are marked by the fluorescent dye with the same color, and one amplification primer of each locus is marked by the fluorescent dye: a first group, DYS392, DYS533, DYS390, DYS593, DYS448, DYS460, DYS645, rs199815934, rs771783753, rs 759551978; a second group, DYS393, DYS437, DYS549, DYS596, DYS635, DYS527a, and DYS527b, DYS444, DYS 643; a third group, DYS391, DYS576, DYS481, DYS19, DYS438, DYS449, DYF387S 1; a fourth group, DYS439, DYS389I, Y _ GATA _ H4, DYS389 II, DYS447, DYS570, DYS 522; a fifth group, DYS456, DYS458, DYS627, DYS385a and DYS385b, DYS518, DYS 557.

The five fluorescent dye markers with different colors are respectively blue, green, yellow, red and purple fluorescein markers; preferably, the blue label is a 5-FAM or 6-FAM fluorescein molecule, the green label is a HEX or JOE fluorescein molecule, the yellow label is a TAMRA fluorescein molecule, the red label is a ROX fluorescein molecule, and the purple label is an NH618 fluorescein molecule.

The selection of the fluorescein molecule includes, but is not limited to, the specific fluorescein molecule described above, and one skilled in the art can select other fluorescein molecules having a spectrum similar to that of the fluorescein molecule described above, as desired.

More preferably, the five fluorescent dye labels with different colors are 6-FAM, HEX, TAMRA, ROX and NH618 respectively.

The fluorescent dye label is labeled at the 5' end of the primer.

The composite amplification kit further comprises amplification primers of an internal mass reference (IPC), and preferably, the primers of the internal mass reference are two pairs of primers shown as SEQ ID NO. 77-78 and SEQ ID NO. 79-80.

SEQ ID NO.77GTCGCCCTTATTCCCTTTTTTGC

SEQ ID NO.78CGTTTCTGGGTGAGCAAAAACAG

SEQ ID NO.79GCACTTTTAAAGTTCTGCTATGTGGC

SEQ ID NO.80TCCAGATTTATCAGCAATAAACCAGCC

In a preferred embodiment, the primer component of the multiplex amplification kit of the present invention is a mixture of the following primers: amplification primers of 38 loci shown as SEQ ID NO. 1-76 and two amplification primers of internal mass reference shown as SEQ ID NO. 77-80.

Preferably, the amplification primers for 38 loci are divided into the following five groups: the first group, IPC60, DYS392, DYS533, DYS390, DYS593, DYS448, DYS460, DYS645, rs199815934, rs771783753, rs759551978, IPC 500; a second group, DYS393, DYS437, DYS549, DYS596, DYS635, DYS527a, and DYS527b, DYS444, DYS 643; a third group, DYS391, DYS576, DYS481, DYS19, DYS438, DYS449, DYF387S 1; a fourth group, DYS439, DYS389I, Y _ GATA _ H4, DYS389 II, DYS447, DYS570, DYS 522; a fifth group, DYS456, DYS458, DYS627, DYS385a and DYS385b, DYS518, DYS 557.

The amplification reaction program of the composite amplification kit is as follows: root at 95-98 deg.c for 1-5 min; 26-35 cycles of 94-98 ℃ for 5-30 s, 58-62 ℃ for 30 s-1 min and 72 ℃ for 20 s-1 min; final extension at 60 deg.c for 5-30 min.

Preferably, the amplification reaction procedure is as follows: 2min at 95 ℃; 30 cycles of 94 ℃ for 5s, 60 ℃ for 45s and 72 ℃ for 45 s; final extension at 60 ℃ for 20 min.

When the 38 loci multiplex amplification kit is used for amplification, a 25-microliter amplification reaction system is as follows: 2.5 Xreaction premix 10. mu.l, 5 Xprimer mixture 5. mu.l, deionized water 8. mu.l, and template DNA 2. mu.l, wherein the primer mixture is the amplification primer mixture of 38 loci.

Preferably, the multiplex amplification kit provided by the invention further comprises magnesium ions, dNTPs, alleles at 38 loci, DNA polymerase, DNA standard and a fluorescent molecular weight internal standard.

It will be understood by those skilled in the art that the major components of Polymerase Chain Reaction (PCR) amplification include templates, primers, dNTPs, DNA polymerase, and DNA polymerase buffer, among others.

The DNA polymerase can be an antibody blocking modified or chemically modified hot-start DNA polymerase. Each amplification system (25ul) typically requires 2U to 4U of Taq DNA polymerase.

The reaction premix comprises dNTP, DNA polymerase and buffer solution of the DNA polymerase; the buffer for the DNA polymerase may include: 50mM KCI, 10mM Tris-HCI (pH8.3, 25 ℃ C.), 2.0mMMgCl ₂ 0.1mg/ml BSA (bovine serum albumin), etc. The skilled person can select separate reagents of dNTP, DNA polymerase and buffer matched with the dNTP and DNA polymerase according to actual needs, or select conventional reagent materials for PCR amplification which are prepared by mixing dNTP, DNA polymerase and buffer of DNA polymerase into a premixed solution, and the like, and the above selection is within the protection scope of the present invention.

Further, the invention also provides a composite amplification method of 38 loci of human Y chromosome, which comprises the following steps:

(1) sample treatment: extracting the genome DNA of the sample as an amplification template or directly adopting an extraction-free sample as the amplification template;

(2) amplifying the sample genome DNA obtained in the step (1) by using an amplification primer with a sequence shown in SEQ ID NO. 1-76;

(3) detecting the fluorescent signal of the amplification product;

(4) fluorescence signal data was collected and analyzed to obtain DNA typing results for 38 loci.

Wherein the sample comprises one or more of blood, blood stain, semen stain, bone, hair, saliva stain, sweat, and amniotic fluid containing fetal cells; or human blood or oral cells collected by using any carrier of blood card, cotton swab and gauze.

Preferably, the amount of the DNA template in the sample is preferably 0.5ng to 4 ng.

The amplification reaction can be performed on various reaction thermal cyclers, such as ABI 9700, ABI 9600, ABI2720, Bio-Rad iCycler, Bio-Rad Cl000, and the like.

The amplification product is provided with a fluorescent dye label, the fluorescent label can emit a luminescent signal under laser excitation, and the fluorescent signal detection in the step (3) can be carried out electrophoresis and detection by a sequencer or a genetic analyzer and other instruments; wherein, the analysis sequencer includes but is not limited to ABI 377, 310DNA sequencer, the genetic analyzer includes but is not limited to ABI 3130, 3100genetic analyzer.

Specifically, when detection is performed on a sequencer or a genetic analyzer, an amplification product is mixed with a molecular weight internal standard (marker) and formamide according to a certain proportion, and the mixture enters an instrument capillary or gel for electrophoretic separation. The molecular weight internal standard is composed of a plurality of fluorescence labeling DNA segments with known lengths and is used for calculating the length of the PCR amplification product segment, thereby being capable of judging the gene typing and comparing with allele step.

The collected data such as fluorescence signals can be analyzed on data analysis software such as GeneMapper, GeneMarker, GeneScan and the like, and finally the STR genotyping map and data are obtained.

In addition, the invention also provides an amplification primer mixture, which comprises 38 pairs of primers with sequences shown as SEQ ID No. 1-76.

Furthermore, the invention provides the application of the molecular marker or the composite amplification kit or the amplification primer mixture in individual identification or paternity testing or in the construction of a database of human chromosomal DNA loci.

The design concept of the main technical scheme of the invention is as follows:

1. screening of 38Y chromosome locus combinations

The factors for selecting the target gene locus mainly include genetic polymorphism, compatibility with the existing detection kit, contribution of the newly added gene locus to improvement of individual recognition capability and the like. The inventor finally determines the following 38 combinations of Y chromosome loci by analyzing genetic polymorphisms of Y chromosomes of a plurality of loci for different individuals and fully analyzing loci utilized by the existing kit: DYS392, DYS533, DYS390, DYS593, DYS448, DYS460, DYS645, DYS393, DYS437, DYS549, DYS596, DYS635, DYS527a, DYS527b, DYS444, DYS643, DYS391, DYS576, DYS481, DYS19, DYS438, DYS449, DYS 387S1, DYS439, DYS389i, Y _ GATA _ H4, DYS389 ii, DYS570, DYS522, DYS456, DYS458, DYS627, DYS385a, DYS385b, DYS518, and DYS 557; InDel is rs771783753, rs759551978 and rs 199815934. The 38 loci comprise 20 core loci and 15 optimal loci required by the ministry of public security, and the mutation rate of the selected 3 InDel loci in the Chinese population is close to zero. Therefore, the kit of the present invention breaks through the maximum multiplex amplification that can be achieved at present while detecting the number of loci, and at the same time has significantly improved individual recognition ability and non-paternal discharge rate.

2. Development of six-color fluorescent labeling technology

Firstly, the factors such as the length of an amplified fragment are comprehensively considered, 38 loci are divided into five groups, each group is respectively marked by different fluorescein, amplification products of each locus in each group are separated according to the length difference, and two loci cannot be overlapped. According to the sequence characteristics of different locus sites, the invention obtains the following preferable groups through a large number of optimization experiments: a first group: DYS392, DYS533, DYS390, DYS593, DYS448, DYS460, DYS645, rs199815934, rs771783753, rs 759551978; second group: DYS393, DYS437, DYS549, DYS596, DYS635, DYS527a, and DYS527b, DYS444, DYS 643; third group: DYS391, DYS576, DYS481, DYS19, DYS438, DYS449, DYF387S 1; and a fourth group: DYS439, DYS389I, Y _ GATA _ H4, DYS389 II, DYS447, DYS570 and DYS 522; and a fifth group: DYS456, DYS458, DYS627, DYS385a, and DYS385b, DYS518, DYS 557. Based on the grouping, the sizes of 20 core gene loci can be controlled within 350bp, so that effective information of the core gene loci can be obtained, and the individual recognition rate is greatly enhanced. Specific primers were then designed for the 38 loci flanking their repeat sequences and Indel insertion/deletion sites, respectively. The basic principle of primer design is as follows: each primer anneals at a temperature near or above 60 ℃. The secondary results such as primer dimer, hairpin structure in the primer and the like and cross reaction can not be generated, and the length of the amplified product is between 65 and 500 bp. Amplification tests were performed and optimized for each pair of primers until a clear single amplified band was obtained.

Multiplex amplification assays are performed using primer pairs for each set of loci. After the group is determined to have no non-specific amplification phenomenon, no cross reaction and the like, the peak value balance of each segment in the group reaches more than 40 percent by continuously adjusting the concentration of each pair of primers.

Primers of five groups of loci are respectively marked by blue, green, yellow, red and purple fluorescein. Only one strand of each primer pair is labeled, with the label being at the 5' end of the primer. The blue label can be selected from 5-FAM (5-carboxyfluorescein), 6-FAM (6-carboxyfluorescein) or fluorescein molecules with similar spectra, the green label can be selected from HEX (hexachloro-6-methylfluorescein), JOE (6-carboxy-4, 5-dichloro-2, 7-dimethoxy fluorescein succinimidyl ester) or fluorescein molecules with similar spectra, the yellow label can be selected from TAMRA (4-methyl-6-carboxy-rhodamine) or fluorescein molecules with similar spectra, the red label can be selected from ROX (carboxy-X-rhodamine) or fluorescein molecules with similar spectra, and the purple label can be selected from NH618 (purchased from Suzhou New Hai Biotech, Ltd.), PUR or fluorescein molecules with similar spectra.

And finally, carrying out composite amplification on the five groups of 38 loci, adjusting the primer concentration of each locus according to the peak height condition of a product, and determining the optimal working concentration of 38 pairs of primers in a primer mixture through a large amount of optimization and screening, so that the integral peak value balance of each locus reaches more than 30%.

The invention has the beneficial effects that:

(1) the invention establishes a composite amplification system for simultaneously amplifying 38Y chromosome loci comprising 35Y-STR loci and 3Y-InDel for the first time, realizes the simultaneous high-efficiency, specific and sensitive amplification of 38 loci by ingenious primer sequence and use concentration design and improved six-color fluorescence labeling technology, and is the most of loci capable of being simultaneously amplified by the currently reported human DNA typing technology;

(2) the combination of 38Y chromosome loci provided by the invention obviously improves the individual identification capability of detection;

(3) the combination of 38Y chromosome loci provided by the invention integrates all loci adopted by the current DNA typing detection reagent at home and abroad, has good analysis data compatibility, can be compatible with all existing data in the DNA database at present in China, has high compatibility with new generation products, and overcomes the problem of data compatibility of the detection reagent in the prior art;

(4) the genetic information of 38Y chromosome loci provided by the invention is higher than the information quantity obtained by simultaneously using 2-3 similar products in the prior art, so that the labor, time and material costs are saved by more than 50% no matter in the links of PCR amplification and genetic analyzer detection, and the detection working efficiency is improved;

(5) the composite amplification kit provided by the invention has strong material detection adaptability, and one kit can amplify samples of various detection materials of human blood or oral cells, which are collected by any carrier such as filter paper, FTA card, cotton swab, gauze and the like, and human genome DNA extracted by any method of a Chelex method, a magnetic bead extraction method or an organic extraction method;

(6) the composite amplification system provided by the invention has stronger amplification specificity and wider temperature tolerance range, and can ensure that different PCR amplification instruments can obtain better amplification results.

Drawings

FIG. 1 is a typing map of 38 loci detected from a 9948 cell line DNA sample in example 3 using the multiplex amplification system of the present invention.

FIG. 2 is a typing map of 38 loci obtained by amplification in comparative example 1 using the primer sequences in Table 4 in place of the primer sequences in Table 1.

FIG. 3 is a typing map of 38 loci amplified using the primer sequences in Table 1 in comparative example 1.

FIG. 4 is a typing map of 38 loci amplified after adjustment of primer concentration in comparative example 2.

FIG. 5 is a typing map of 38 loci obtained by amplification without adjustment of primer concentration in comparative example 2.

FIG. 6 is an AllelicLadder map of the multiplex amplification kit provided by the present invention.

FIG. 7 is a typing map of 38 loci of the suspected father identified by the genetic relationship in example 4.

FIG. 8 is a typing map of 38 loci of suspected son identified by genetic relationship in example 4.

FIG. 9 is a typing map of 38 loci of test material 1 in the database construction in example 5.

FIG. 10 is a typing map of 38 loci of sample 2 in the database construction in example 5.

Detailed Description

The preferred embodiments of the present invention will be described in detail with reference to the following examples. It is to be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the present invention. Various modifications and alterations of this invention will become apparent to those skilled in the art without departing from the spirit and scope of this invention.

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

EXAMPLE development of 138 Complex amplification kits for Y chromosome loci

1. Multiplex amplification primer design for 38Y chromosome loci

For a composite amplification system, especially for the composite amplification system of 38 loci in the invention, the requirements for specificity, secondary structure, stability of combination with a target sequence, amplification efficiency and the like of a primer sequence are extremely high, and through continuous amplification-optimization-amplification cyclic experiments, 38 pairs of amplification primers for specifically and efficiently amplifying 38 loci are obtained, and the specific sequences of the amplification primers are shown as SEQ ID No. 1-SEQ ID No.76 (Table 1).

The 38 pairs of primers shown in table 1 were fluorescently labeled with different colors in the following grouping of the corresponding loci: a first group: IPC60, DYS392, DYS533, DYS390, DYS593, DYS448, DYS460, DYS645, rs199815934, rs771783753, rs759551978, IPC 500; second group: DYS393, DYS437, DYS549, DYS596, DYS635, DYS527a, and DYS527b, DYS444, DYS 643; third group: DYS391, DYS576, DYS481, DYS19, DYS438, DYS449, DYF387S 1; and a fourth group: DYS439, DYS389I, Y _ GATA _ H4, DYS389 II, DYS447, DYS570 and DYS 522; a fifth group: DYS456, DYS458, DYS627, DYS385a, and DYS385b, DYS518, DYS 557.

Groups 1-5 were labeled with blue, green, yellow, red and violet fluorescein, respectively. Only one strand of each primer pair is labeled, with the label being at the 5' end of the primer. Blue marker selection 6-FAM, green marker selection HEX, yellow marker selection TAMRA, red marker selection ROX fluorescein molecule, purple marker selection NH 618.

2. Optimization of primer concentration in multiplex amplification reaction system

For a composite amplification system for simultaneously amplifying 38 loci, in order to realize higher amplification equilibrium degree, the concentration ratio of 38 pairs of primers in the composite amplification system is continuously adjusted, the amplification equilibrium degree is gradually improved, and the following optimal primer concentrations are finally obtained: DYS392, 0.1. mu.M; DYS533, 0.06. mu.M; DYS390, 0.03. mu.M; DYS593, 0.05. mu.M; DYS448, 0.06. mu.M; DYS460, 0.05. mu.M; DYS645, 0.09. mu.M; DYS393, 0.06. mu.M; DYS437, 0.06. mu.M; DYS549, 0.09. mu.M; DYS596, 0.08. mu.M; DYS635, 0.08. mu.M; DYS527a and DYS527b, 0.05 μ M; DYS444, 0.1. mu.M; DYS643, 0.1. mu.M; DYS391, 0.05. mu.M; DYS576, 0.08 μ M; DYS481, 0.3 μ M; DYS19, 0.18. mu.M; DYS438, 0.25. mu.M; DYS449, 0.1. mu.M; DYF387S1, 0.11 μ M; DYS439, 0.11. mu.M; DYS389I, 0.1 μ M; y _ GATA _ H4, 0.1 μ M; DYS389 II, 0.20 μ M; DYS447, 0.26. mu.M; DYS570, 0.09. mu.M; DYS522, 0.13. mu.M; DYS456, 0.06. mu.M; DYS458, 0.06. mu.M; DYS627, 0.05 μ M; DYS385a and DYS385b, 0.09. mu.M; DYS518, 0.08. mu.M; DYS557, 0.12. mu.M; rs199815934, 0.06 μ M; rs771783753, 0.16 μ M; rs759551978, 0.08 μ M; IPC60, 0.005. mu.M; IPC500, 0.01. mu.M.

The 38Y chromosome locus multiplex amplification kit consists of the components shown in Table 2.

TABLE 2 composition of multiplex amplification kit

Example establishment of 238 Complex amplification System and procedure for Y chromosome loci

The annealing temperature and cycle number were optimized for the amplification primers of 38 loci, resulting in an optimal reaction program: keeping the temperature at 95 ℃ for 2 minutes; heat preservation at 94 ℃ for 5 seconds, at 60 ℃ for 45 seconds and at 72 ℃ for 45 seconds, and the step is operated for 30 cycles; preserving the heat for 20 minutes at the temperature of 60 ℃; keeping the temperature at 4-10 ℃.

EXAMPLE 3 genotyping of 9948 cell line Using multiplex amplification kit

The kit provided by the invention is used for carrying out composite amplification on 38Y chromosome loci on a 9948 cell strain. A template DNA derived from 9948 cell line was extracted by the chelex-100 method. The amplification reactions were performed on an ABI 9700 thermal cycler, the electrophoresis and detection were performed on an ABI 3130 genetic analyzer, and the data analysis was performed using GeneMapper IDX v1.2 software. The reagent materials used, such as the allelic ladder (ladder), are commercially available and are conventional materials commonly used by those skilled in the art.

1. DNA was extracted by the chelex-100 method (refer to Forensic DNA Protocol, Human Press, 1998):

(1) mu.l of the cultured 9948 cell line was taken in a 500. mu.l centrifuge tube.

(2) The chelex solution was mixed by shaking to suspend the chelex sufficiently, and 195. mu.l of 5% chelex-100(l00-200mesh, available from Bio-Rad) was added to each tube, followed by 5. mu.l of proteinase K (20mg/ml, available from Kuh-Biochemical Co., Ltd.).

(3) The sample was shaken and after being incubated on a thermostatic metal bath at 56 ℃ for 2 hours, the sample was taken out and shaken for 2 minutes.

(4) Boiling for 8-10 min, and centrifuging at 13000rpm for 3 min.

(5) About 150. mu.l of the supernatant was carefully aspirated, transferred to a new tube, and 1. mu.l of the 10. mu.l PCR reaction was used as a template.

2. Polymerase Chain Reaction (PCR) amplification

(1) Taking the buffer solution and the primer mixture, preparing a mixed solution according to the following table, shaking, uniformly mixing, subpackaging into PCR reaction tubes, adding the template DNA, and preparing into a 25 mu l reaction system (table 3).

TABLE 3PCR amplification reaction System

Wherein the primer mixture is a mixture of 38 pairs of primers with sequences shown as SEQ ID NO. 1-76; the reaction premix comprises: 50mM KCI, lO mM Tris-HCI (pH8.3, 25 ℃), 2.O mM MgCl ₂ 0.1mg/ml BSA (bovine serum albumin) and 0.2mM each of dNTPs. dNTPs are an equimolar mixture of four deoxyribonucleotides (dATP, dTTP, dCTP, dGTP), and Taq DNA polymerase required for the reaction, the Taq DNA polymerase used is hot start DNA polymerase, antibody blocking modification or chemical modification is possible, and 2U to 4U of Taq DNA polymerase is required for each amplification system (25 ul).

(2) A thermal cycler (ABI 9700 PCR) was set up according to the following reaction conditions, and a PCR reaction tube was placed in the apparatus to start amplification of gene fragments. Keeping the temperature at 95 ℃ for 2 minutes; keeping the temperature at 94 ℃ for 5 seconds, keeping the temperature at 60 ℃ for 45 seconds, keeping the temperature at 72 ℃ for 45 seconds, and running for 30 cycles; keeping the temperature at 60 ℃ for 20 minutes, and keeping the temperature at 4-10 ℃ until the sample is taken out.

3. After the amplification reaction is completed, the reaction tube is taken out, and electrophoresis and detection are performed by using an ABI 3130 genetic analyzer.

(1) A mixture was prepared from (0.5. mu.l of molecular weight internal standard + 10. mu.l of deionized formamide) × (number of samples).

(2) Mixing, subpackaging, adding 10 μ l each tube, adding 1 μ l of amplification product and allelic ladder (ladder), centrifuging briefly, and collecting the liquid to the bottom of the tube of the centrifuge tube.

(3) The samples were denatured at 95 ℃ for 4 minutes and then rapidly cooled on ice for 4 minutes to completely denature the DNA and maintain the denatured state.

(4) The sample was placed in the sample tray of a gene analyzer, the instrument parameters (sample injection voltage 3kV, sample injection time 4 seconds) were set, and the electrophoresis detection was started.

(5) After about 50 minutes, the electrophoresis was terminated and the experimental data were analyzed by GeneMapper software to obtain a pattern and typing results. The result is shown in figure 1, the sequence information of the 38Y chromosome loci of the 9948 cell strain obtained by using the kit provided by the invention is consistent with the information in the database, and the kit provided by the invention is proved to be capable of realizing one-time accurate detection of the 38Y chromosome loci.

Comparative example 1 amplification Using primers of different sequences

The primers of both loci, DYS392 and DYS533, were replaced with the primer sequences in table 4, respectively, and the same sample was typed before and after the sequence change of 38Y chromosome loci using the multiplex amplification system and procedure in examples 1 and 2 and the detection method in example 3, and fig. 2 is a sample typing result of replacing the primers of the corresponding loci in table 1 with the primers in table 4; FIG. 3 is the typing results of samples using the primers in Table 1. The results show that the primer pairs in table 4 used for replacement cause adverse effects in the DNA typing process, are not suitable for the primer combination of the present invention, and indicate that the adjustment of the primer sequence significantly affects the detection efficiency of the kit.

TABLE 4 primer sequences used in comparative example 1

Genetic loci	Forward primer	Reverse primer
			DYS392	TAGAGGCAGTCATCGCTGAG	GACCTACCAATCCCATTGCAT
DYS533	CTATCTATATCTGTCTA	ACAATAGAAGATGATAGATG

Comparative example 2 Effect of variation in primer concentration

The primer concentrations at the DYS389 II locus were respectively replaced with the primer concentrations shown in Table 5, and the 38Y chromosome loci were typed using the composite amplification system and procedure of examples 1 and 2 and the detection method of example 3 with the same sample after varying the primer concentrations at the specific loci, and the results are shown in FIG. 4, which shows that when the primer concentration at the DYS389 II locus is decreased, the corresponding peak heights are decreased compared to that before the primer concentration at DYS389 II was adjusted (FIG. 5).

TABLE 5 primer concentrations used in comparative example 2

Genetic loci	Concentration of primer pair
		DYS389Ⅱ	0.1μM

Example 4 paternity testing Using multiplex amplification kit

The kit of the invention is used for carrying out composite amplification of the method for directly amplifying 38Y chromosome gene loci blood cards on 2 blood card samples from suspected fathers and son. The amplification reaction was performed on an ABI 9700 thermal cycler; the electrophoretic detection is carried out on an ABI 3130XL genetic analyzer; data analysis used GeneMapper IDX v1.2 software. The reagent materials used, such as the allelic ladder (ladder), are commercially available and are conventional materials commonly used by those skilled in the art.

1. Blood slices from suspected father and son blood card samples are punched by using punching machines with the diameter of 1.2mm respectively, and the positions where the blood slices are punched need to be selected to fully permeate the blood and be completely and naturally dried. And placing the punched blood slices as templates in a PCR amplification tube for later use.

2. Polymerase Chain Reaction (PCR) amplification

(1) Taking the buffer solution and the primer mixture, preparing a mixed solution according to the following table marks, shaking, mixing uniformly, subpackaging into PCR reaction tubes, adding a blood card template, and preparing into a 10 mu l reaction system (table 6).

TABLE 6PCR amplification reaction System

Wherein the primer mixture is a mixture of 38 pairs of primers with sequences shown as SEQ ID NO. 1-76; the reaction premix comprises: 50mM KCI, l0mM Tris-HCI (pH8.3, 25 ℃), 2.0mM MgCl2, 0.1mg/ml BSA (bovine serum albumin) and 0.2mM each of dNTPs. dNTP is four kinds of deoxyribonucleotides (dATP, dTTP, dCTP, dGTP) and the like molar mixture, and reaction required Taq DNA polymerase, the Taq DNA polymerase used is hot start DNA polymerase, antibody blocking modification or chemical modification can be carried out, and each amplification system (10 mu l) needs 1U to 2U of hot start Taq DNA polymerase.

(2) A thermal cycler (ABI 9700 PCR) was set up according to the following reaction conditions, and the PCR reaction tube was placed in the thermal cycler to start gene fragment amplification. The amplification procedure was as follows: keeping the temperature at 95 ℃ for 2 minutes; heat preservation is carried out for 30 cycles at 94 ℃ for 5 seconds, 60 ℃ for 45 seconds and 72 ℃ for 45 seconds; keeping the temperature at 60 ℃ for 20 minutes, and keeping the temperature at 4-10 ℃ until the sample is taken out.

3. After the amplification reaction is finished, taking out the PCR reaction tube, and carrying out electrophoresis detection by using an ABI 3130XL genetic analyzer.

(2) Mixing, packaging 10 μ l each tube, and adding 1 μ l each amplification product. Another 1. mu.l of the allele-trapping step (ladder) (shown in FIG. 6) was added to the tube containing the amplification product, followed by flash centrifugation.

(3) The sample was denatured at 95 ℃ for 4 minutes and then rapidly cooled on ice for 4 minutes to completely denature the DNA and maintain the denatured state.

(4) The sample was placed in the sample tray of the gene analyzer, the instrument parameters (injection voltage 3kV, injection time 4 seconds) were set, and the electrophoretic detection was started.

(5) After about 50 minutes, the electrophoresis is finished, the GeneMapper software is used for analyzing experimental data, the experimental results are shown in figure 7 (suspected father) and figure 8 (suspected son), the typing information of the 38Y chromosome loci of the suspected father and son obtained by the method is compared, and the fact that the typing of the suspected father and son on the 38Y chromosome loci is consistent is found, and the genetic rule is met. And by combining the actual situation, the genetic relationship judgment supporting the suspected parent and child as the parent and child can be made.

Example 5 judicial identification Using multiplex amplification kit

The invention is used for carrying out composite amplification of 38Y chromosome gene loci on 2 blood card samples commonly used in the market. PCR amplification is carried out by adopting a blood card direct amplification method. The amplification reactions were performed on an ABI 9700 thermal cycler, the electrophoresis and detection were performed on an ABI 3130 genetic analyzer, and the data analysis was performed using GeneMapperIDX v1.2 software. The reagent materials used, such as the allelic ladder (ladder), are commercially available and are conventional materials commonly used by those skilled in the art.

1.2 blood card sample blood slices are respectively punched by a puncher with the diameter of 1.2mm, and the positions for punching the blood slices are required to be fully permeated with the blood samples and be completely air-dried. And placing the punched blood card serving as a template into a PCR amplification tube for later use.

2. Polymerase Chain Reaction (PCR) amplification

(1) Taking a buffer solution and a primer mixture, preparing a mixed solution according to the following table, shaking, uniformly mixing, subpackaging into PCR reaction tubes, adding a blood card template, and preparing into a 10-microliter reaction system (table 7).

TABLE 7 PCR amplification reaction System

Wherein the primer mixture is a mixture of 38 pairs of primers with sequences shown as SEQ ID NO. 1-76; the reaction premix comprises: 50mM KCI, l0mM Tris-HCI (pH8.3, 25 ℃), 2.0mM MgCl2, 0.1mg/ml BSA (bovine serum albumin) and 0.2mM each of dNTPs. dNTP is equimolar mixture of four kinds of deoxyribonucleotides (dATP, dTTP, dCTP and dGTP) and Taq DNA polymerase required for reaction, the Taq DNA polymerase used is hot-start Taq DNA polymerase, and antibody blocking modification or chemical modification can be carried out, and 1U to 2U of hot-start Taq DNA polymerase is required for each amplification system (10 mu.l).

(1) A mixture was prepared by mixing (0.5. mu.l of an internal molecular weight standard + 10. mu.l of deionized formamide) × (the number of samples).

(5) After about 50 minutes, the electrophoresis was terminated and the experimental data were analyzed using GeneMapper software. The results of the test material 1 and the test material 2 are respectively shown in fig. 9 and fig. 10, and the typing information of 38Y chromosome loci of the sample is constructed by using the Y chromosome STR database obtained by the kit provided by the invention, and the typing result is derived and recorded into the database.

It will be appreciated by persons skilled in the art that the foregoing description is only an example of the invention and that the scope of the invention as claimed is not limited solely to the specific embodiments disclosed herein. Any equivalent embodiments are to be considered within the scope of the present invention. Indeed, various modifications and variations of the present invention are possible in light of the above teachings, and it is intended that such modifications and variations be included within the scope of the appended claims.

Sequence listing

<110> Kyoto cognitive technology (Beijing) Ltd

Composite amplification kit for <120> 38 human Y chromosome loci and application thereof

<160> 76

<170> SIPOSequenceListing 1.0

<210> 1

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

aagaaggaaa acaaattttt ttcttg 26

<210> 2

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

aaacagaggg atcattaaac ctacc 25

<210> 3

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aactatataa ctatgtatta tctatc 26

<210> 4

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atgtatttat tcatgatcag ttcttaac 28

<210> 5

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cagacttcaa tatcacagaa catcg 25

<210> 6

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ctgagacagt gtatccgcca tg 22

<210> 7

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

aggaagcaga ccttacattg atagaagatc 30

<210> 8

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ttcttacttc ctataaacac atcaaagctg 30

<210> 9

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

atgagacttc catgggagag gcaaggat 28

<210> 10

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

atttcctcat atttctggcc ggtctg 26

<210> 11

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

tgcctatcat ttattatgta tttgtctatt at 32

<210> 12

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

tagcaagcac aagaatacca g 21

<210> 13

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

aggtacagtt ctttggtttt ggttac 26

<210> 14

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ctcccaagaa ttggtctaca caaggta 27

<210> 15

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

tgtgacatac caatcatttc tacagttatc 30

<210> 16

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

tgattgactg taatccatgt actttgtcc 29

<210> 17

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

attagttttt taggtgacaa ggtagattta c 31

<210> 18

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

agtatttgct gattatattc ccaatataag 30

<210> 19

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

tgcaagtaga tgaaaatagc atcttccc 28

<210> 20

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

agcaaaactt ttcctataga agcaaagata atg 33

<210> 21

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

tttgctcctc attcaccttt agcc 24

<210> 22

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

atggcctata atctaactaa ataaagtc 28

<210> 23

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

ctgggactat gggcgtgagt gcatg 25

<210> 24

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

tatagataga tagataacca cag 23

<210> 25

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

tggtaatctg aaataataag gtagacat 28

<210> 26

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

gttcagaata gtctctaaag g 21

<210> 27

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

agtggttcac agaaataaag aattc 25

<210> 28

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

atagatatga aacttctctt cttcctc 27

<210> 29

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 29

atgcccaatg gaatgctctc ttggcttctc 30

<210> 30

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 30

ttgagtgatg gaccaaggct ccatctc 27

<210> 31

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 31

aagatcgcaa acatagcact tcagc 25

<210> 32

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 32

ggaagattag ccacaacata agta 24

<210> 33

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 33

tcaacataga atgaaaggtg tgaacc 26

<210> 34

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 34

tcataaaatt cttcactcca gtc 23

<210> 35

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 35

tgcaccagtc actgtatttg ccaaag 26

<210> 36

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 36

ataagtagga gctaacctct gaggatg 27

<210> 37

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 37

atctattcat tcaatcatac acccatat 28

<210> 38

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 38

ggtaggcagg cagataggca ga 22

<210> 39

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 39

ctgaggagtt caatctcagc caa 23

<210> 40

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 40

gagtaataag cgtatttgtc ttggct 26

<210> 41

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 41

aaggaatgtg gctaacgctg ttcag 25

<210> 42

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 42

acaattcatt gcagattctt ggtccacaga 30

<210> 43

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 43

ttcactatga ctactgagtt tctgttatag 30

<210> 44

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 44

ttgctggtca atctctgcac ctggaaa 27

<210> 45

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 45

caactgaaaa gctctcgtgt ttaatattg 29

<210> 46

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 46

aacaagagtg aaactccatt tcaaatag 28

<210> 47

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 47

tcaagcctgt tctatgaata ttttc 25

<210> 48

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 48

aatcccagct actcaggagg 20

<210> 49

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 49

agtcgtggtg gtaagtgcat tttatc 26

<210> 50

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 50

acagcactct actggagtct gtaagtgg 28

<210> 51

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 51

atagatacat aggtggagac agatagatg 29

<210> 52

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 52

ttcttttacc catcatctct ttacttatac 30

<210> 53

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 53

aactctcatc tgtattatct atg 23

<210> 54

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 54

attatccctg agtagcagaa g 21

<210> 55

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 55

tgatactttc agcacatcac 20

<210> 56

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 56

aggataaatc acctatctat gtatc 25

<210> 57

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 57

aactctcatc tgtattatct atg 23

<210> 58

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 58

attatccctg agtagcagaa g 21

<210> 59

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 59

gatgtgtagc catctatctg tctcacatc 29

<210> 60

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 60

tcacagcatg gcttggtttt atac 24

<210> 61

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 61

ttattttaga tagaaatatt gacaat 26

<210> 62

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 62

agcatagtca agaaaccaga caac 24

<210> 63

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 63

aatcattcat aatgcacccc tcag 24

<210> 64

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 64

tactggcagc agtgtgactt cttag 25

<210> 65

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 65

gaccttgtga taatgtaaga taga 24

<210> 66

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 66

ggacagaact aatggaatat c 21

<210> 67

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 67

actgcagact gagcaacagg aatg 24

<210> 68

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 68

acctcggcct cccaaagttc tgg 23

<210> 69

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 69

actccaccct aggtgacagc gcagg 25

<210> 70

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 70

tacttcctcc ctccctcctc c 21

<210> 71

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 71

agagctagac accatgccaa acaacaac 28

<210> 72

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 72

aaataatcta tctattccaa ttacatag 28

<210> 73

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 73

tgggcaacac aagtgaaact gcttctcg 28

<210> 74

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 74

tgtgctttgt gagtatattt tc 22

<210> 75

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 75

ttttttctgt gccaagccta catataata 29

<210> 76

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 76

attttggtgt ttagactagt g 21

Claims

1. A composite amplification kit for 38 loci of human Y chromosome is characterized by comprising amplification primers for 38 loci of human Y chromosome;

the sequence of the amplification primer is shown as SEQ ID NO. 1-76: wherein, DYS392 and SEQ ID NO. 1-2; DYS533 and SEQ ID NO. 3-4; DYS390 and SEQ ID NO. 5-6; DYS593 and SEQ ID NO. 7-8; DYS448 and SEQ ID NO. 9-10; DYS460 and SEQ ID NO. 11-12; DYS645 and SEQ ID NO. 13-14; DYS393 and SEQ ID NO. 15-16; DYS437, SEQ ID NO. 17-18; DYS549 and SEQ ID NO. 19-20; DYS596 and SEQ ID NO. 21-22; DYS635 and SEQ ID NO. 23-24; DYS527a, DYS527b and SEQ ID NO. 25-26; DYS444 and SEQ ID NO. 27-28; DYS643, SEQ ID NO. 29-30; DYS391 and SEQ ID NO. 31-32; DYS576 and SEQ ID NO. 33-34; DYS481 and SEQ ID NO. 35-36; DYS19 and SEQ ID NO. 37-38; DYS438 and SEQ ID NO. 39-40; DYS449, SEQ ID NO. 41-42; DYF387S1 and SEQ ID NO. 43-44; DYS439 and SEQ ID NO. 45-46; DYS389I, SEQ ID NO. 47-48; y _ GATA _ H4 and SEQ ID NO. 49-50; DYS389 II and SEQ ID NO. 51-52; DYS447, SEQ ID NO. 53-54; DYS570, SEQ ID NO. 55-56; DYS522, SEQ ID NO. 57-58; DYS456, SEQ ID NO. 59-60; DYS458 and SEQ ID NO. 61-62; DYS627 and SEQ ID NO. 63-64; DYS385a, DYS385b and SEQ ID NO. 65-66; DYS518 and SEQ ID NO. 67-68; DYS557, SEQ ID NO. 69-70; rs199815934 and SEQ ID NO. 71-72; rs771783753, SEQ ID NO. 73-74; rs759551978, SEQ ID NO. 75-76.

2. The multiplex amplification kit of claim 1, wherein the primers in the multiplex amplification kit are used at the following working concentrations during amplification: DYS392, 0.1. mu.M; DYS533, 0.06. mu.M; DYS390, 0.03. mu.M; DYS593, 0.05. mu.M; DYS448, 0.06. mu.M; DYS460, 0.05. mu.M; DYS645, 0.09. mu.M; DYS393, 0.06. mu.M; DYS437, 0.06. mu.M; DYS549, 0.09. mu.M; DYS596, 0.08. mu.M; DYS635, 0.08. mu.M; DYS527a and DYS527b, 0.05. mu.M; DYS444, 0.1. mu.M; DYS643, 0.1. mu.M; DYS391, 0.05. mu.M; DYS576, 0.08. mu.M; DYS481, 0.3 μ M; DYS19, 0.18. mu.M; DYS438, 0.25. mu.M; DYS449, 0.1. mu.M; DYF387S1, 0.11 μ M; DYS439, 0.11. mu.M; DYS389I, 0.1. mu.M; y _ GATA _ H4, 0.1 μ M; DYS389 II, 0.20 μ M; DYS447, 0.26. mu.M; DYS570, 0.09. mu.M; DYS522, 0.13. mu.M; DYS456, 0.06. mu.M; DYS458, 0.06. mu.M; DYS627, 0.05 μ M; DYS385a and DYS385b, 0.09. mu.M; DYS518, 0.08. mu.M; DYS557, 0.12. mu.M; rs199815934, 0.06 μ M; rs771783753, 0.16 μ M; rs759551978, 0.08 μ M.

3. The multiplex amplification kit according to any one of claims 1 to 2, wherein the amplification primers carry a fluorescent dye label.

4. The multiplex amplification kit of claim 3, wherein the amplification primers for 38 loci are divided into five groups, and the five groups of amplification primers are labeled with five fluorescent dyes of different colors, respectively, wherein the amplification primers in each group are labeled with the fluorescent dye of the same color, and one amplification primer is labeled with the fluorescent dye for each locus: a first group, DYS392, DYS533, DYS390, DYS593, DYS448, DYS460, DYS645, rs199815934, rs771783753, rs 759551978; a second group, DYS393, DYS437, DYS549, DYS596, DYS635, DYS527a, and DYS527b, DYS444, DYS 643; a third group, DYS391, DYS576, DYS481, DYS19, DYS438, DYS449, DYF387S 1; a fourth group, DYS439, DYS389I, Y _ GATA _ H4, DYS389 II, DYS447, DYS570, DYS 522; a fifth group, DYS456, DYS458, DYS627, DYS385a and DYS385b, DYS518, DYS 557.

5. The multiplex amplification kit of claim 4, wherein said five different fluorescent dye labels are blue, green, yellow, red and violet fluorescent labels, respectively.

6. The multiplex amplification kit of claim 5, wherein the blue label is a 5-FAM or 6-FAM fluorescein molecule, the green label is a HEX or JOE fluorescein molecule, the yellow is a TAMRA fluorescein molecule, the red is a ROX fluorescein molecule, and the purple is a NH618 or PUR fluorescein molecule.

7. The multiplex amplification kit of claim 6, wherein said five fluorescent dye labels of different colors are 6-FAM, HEX, TAMRA, ROX, NH618, respectively.

8. The multiplex amplification kit according to any one of claims 1 to 2, wherein the amplification reaction procedure is as follows: 1min to 5min at the temperature of 95 ℃ to 98 ℃; 26-35 cycles of 94-98 ℃ for 5-30 s, 58-62 ℃ for 30 s-1 min and 72 ℃ for 20 s-1 min; final extension at 60 deg.c for 5-30 min.

9. The multiplex amplification kit according to claim 8, wherein the amplification reaction procedure is as follows: 2min at 95 ℃; 30 cycles of 94 ℃ for 5s, 60 ℃ for 45s and 72 ℃ for 45 s; final extension at 60 ℃ for 20 min.

10. The multiplex amplification kit according to any one of claims 1 to 2, wherein a 25. mu.l amplification reaction system is as follows: 2.5 Xreaction premix 10. mu.l, 5 Xprimer mix 5. mu.l, deionized water 8. mu.l, template DNA 2. mu.l, wherein the primer mix is the amplification primer mix for the 38 loci.

11. The multiplex amplification kit of any one of claims 1 to 2, further comprising magnesium ions, dntps, an allelic ladder of 38 loci, DNA polymerase, DNA standards, and a fluorescent molecular weight internal standard.

12. A method for multiplex amplification of 38 loci of human Y chromosome using the multiplex amplification kit of any one of claims 1 to 11, comprising the steps of:

(2) amplifying the sample genome DNA obtained in the step (1) by using an amplification primer with a sequence shown as SEQ ID NO. 1-76;

(3) detecting the fluorescent signal of the amplification product;

13. The multiplex amplification method of claim 12, wherein said sample comprises one or more of blood, blood spots, semen spots, bone, hair, saliva spots, sweat, and amniotic fluid containing fetal cells; the extraction-free sample comprises human blood or oral cells collected by one or more carriers of a blood card, a cotton swab and gauze.

14. A primer mixture for amplifying 38 loci of human Y chromosome is characterized by comprising 38 pairs of primers with sequences shown as SEQ ID NO. 1-76.

15. Use of the multiplex amplification kit of any one of claims 1 to 11 or the primer mixture of claim 14 for individual identification or paternity testing.

16. Use of the multiplex amplification kit of any one of claims 1 to 11 or the primer mixture of claim 14 for the construction of databases or DNA pedigrees of human chromosomal DNA loci.