CN104178566A - Multiplex fluorescence PCR (polymerase chain reaction) universal adapter for microsatellite detection, and detection method and application thereof - Google Patents
Multiplex fluorescence PCR (polymerase chain reaction) universal adapter for microsatellite detection, and detection method and application thereof Download PDFInfo
- Publication number
- CN104178566A CN104178566A CN201410345866.6A CN201410345866A CN104178566A CN 104178566 A CN104178566 A CN 104178566A CN 201410345866 A CN201410345866 A CN 201410345866A CN 104178566 A CN104178566 A CN 104178566A
- Authority
- CN
- China
- Prior art keywords
- joint
- micro
- satellite
- primer
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6853—Nucleic acid amplification reactions using modified primers or templates
- C12Q1/6855—Ligating adaptors
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a multiplex fluorescence PCR (polymerase chain reaction) universal adapter for microsatellite detection, which comprises an adapter 1, an adapter 2, an adapter 3 and an adapter 4, wherein the nucleotide sequences of the adapters 1-4 are disclosed as SEQ ID:1-4. The universal adapter has the advantages of high PCR amplification efficiency and no interference, and can not interfere with microsatellite primers to be amplified. The invention also discloses a method for carrying out microsatellite multiplex fluorescence PCR detection by using the multiplex fluorescence PCR universal adapter for microsatellite detection. In the multiplex PCR process, primer screening and typing experiments can be performed only after the four or three fluorescence adapters are synthesized. The method has the advantages of simple steps, short experimental period and low experimental cost.
Description
Technical field
The invention belongs to multiple fluorescence PCR technical field, be specifically related to a kind ofly can be used for the multiple fluorescence PCR universal joint that micro-satellite detects and utilize it to carry out the methods and applications that micro-satellite multiplex PCR detects.
Background technology
Micro-satellite (Microsatellite) claims again simple sequence to repeat (Simple Sequence Repeat, SSR), short series connection repeats (Short tandem repeats), SSLP (Simple sequence length polymorphism), it is a fragment in DNA molecular, become to join end to end to connect with the nucleotide sequence (being called core sequence, coresequence) of 1-6bp and repeat to be evenly distributed in the highly repetitive sequence in whole genome.General long tens to hundreds of bp.They are extensively distributed in various eukaryotic gene groups, and it is more even to distribute.The allelotrope of micro-satellite has that sudden change is fast, polymorphism is high, heterozygosity is large, information content is enriched, be codominance etc. and in experimental implementation material be easy to get and sample requirement is few, schedule of operation is simple and little, the available pcr amplification detection site of degree-of-difficulty factor and allelotrope band are easy to the features such as identification.Microsatellite marker is multiplex analyzes foundation and the assignment of genes gene mapping, the protection of germ plasm resource and the foundation of microsatellite DNA fingerprint base etc. of the genetic construction of biological heredity diversity, colony and the sibship of population, genetic map.The pcr amplification of microsatellite locus mainly adopts single to primer amplification and multiplex PCR amplification mode, adopts general primer or fluorescent dye primer according to its primer of the difference of detection technique.
Single to primer amplification use general primer, the site of only increasing in each PCR reaction system, is then used the method for gel electrophoresis to separate, and determines the allelotrope of amplification, and working method and plant and instrument are fairly simple, but efficiency is lower.
Multiplex PCR (multiplex PCR) can be by the amplification simultaneously in same reaction system of fluorescently-labeled multipair process primer, 2 pairs above can be increased to 20 pairs of micro-satellite primers simultaneously, by the difference amplified productions of distinguishing different loci different from mark fluorescent of object clip size scope.The somatotype that carries out micro-satellite multiplex PCR utilizes the genetic analyzer of ABI company to carry out more, can carry out 4 (FAM, JOE, NED and ROX) look or 5 looks (FAM, VIC, PET, NED and LIZ) fluorescence somatotype is (except mark in molecular weight marker uses 1 look fluorescence, actual 3 looks or the 4 look fluorescence of using), except utilizing the difference of clip size scope distinguishes, 3 couple overlapping clip size or 4 pairs of primers can also be distinguished by the fluorescence of mark different colours.Can increase like this primer number of multiplex PCR.The matching degree that multiplex PCR need to be in advance carries out amplification efficiency, combination to micro-satellite primers to be amplified is tested, once determine combination of primers, just can improve greatly subsequent experimental efficiency.Multiple PCR technique is the mainstream technology means of microsatellite marker somatotype in future, will promote greatly the application of microsatellite marker.
Carrying out at present multiplex PCR is all that 5 ' end of all forward primers is carried out to fluorescent mark.For example, for one group of multiplex PCR system of carrying out 10 site amplifications simultaneously, the forward primer of 10 pairs of primers need to be carried out respectively to fluorescent mark, this just need to synthesize 10 fluorescent dye primers.The synthetic expense of fluorescent primer is more much higher than general primer, and according to mark fluorescent difference, every primer generally needs 300~500 yuan/2OD, and the synthetic cycle is also than long many of general primer.If primer synthetic in experimentation can not add multiplex PCR system, synthetic fluorescent primer just can not be used for subsequent experimental.Determine one group of multiple PCR primer, only some can be used in experiment to general synthetic fluorescent dye primer, causes funds and waste of time.
Summary of the invention
First object of the present invention is to provide a kind of multiple fluorescence PCR universal joint that micro-satellite detects that can be used for, and this universal joint pcr amplification efficiency is high, does not interfere with each other, and also can micro-satellite primers to be amplified not produced and be disturbed.
Second object of the present invention is to provide a kind of and utilizes the above-mentioned multiple fluorescence PCR universal joint that can be used for micro-satellite detection to carry out the method that micro-satellite multiplex PCR detects, when the method is carried out multiplex PCR, only need synthesize 4 or 3 fluorescence joints and can carry out primer screening and somatotype experiment, step is succinct, experimental period is short, and experimental cost is low.
Last object of the present invention is to provide the above-mentioned multiple fluorescence PCR universal joint of micro-satellite detection that can be used in the application of microsatellite locus context of detection.
First object of the present invention is achieved through the following technical solutions: a kind of multiple fluorescence PCR universal joint, comprise 4 joints, and be respectively joint 1, joint 2, joint 3 and joint 4, the nucleotide sequence of joint 1~4 is as shown in SEQID:1~4.
The nucleotide sequence of its center tap 1-4 is as follows:
Joint 1:CACGACGTTGTAAAACGAC
Joint 2:CAGGAACTCAGTGTGACACTC
Joint 3:CGACAGACAGTAAGGTCTCTG
Joint 4:AGCTCGACCAGTGAGTCAG.
4 kinds of fluorescent mark joints that the present invention uses are synthesized by ABI company, also can substitute with other homochromy fluorescence, these 4 joints are to design according to the plasmid sequence of bacterium, object is minimum with Eukaryotic sequence homology, avoid non-specific amplification to disturb, during its multiplex PCR that can be applied in micro-satellite detects, also can be applicable in other multiplex PCRs.
4 kinds of joints can be distinguished 4 kinds of fluorescence of mark, and fluorescence and joint can arbitrary combination, but can not repeat.Once selected, i.e. the corresponding relation of definite joint and fluorescence.If use 5 look fluorescing systems, can use above-mentioned 4 joints (corresponding FAM, VIC, PET, NED tetra-look fluorescence), if use 4 look fluorescing systems, can be optionally 3 joints (corresponding FAM, JOE, NED three fluorescence) wherein.
Second object of the present invention is achieved through the following technical solutions: a kind of method of utilizing the above-mentioned multiple fluorescence PCR universal joint that can be used for microsatellite locus detection to carry out micro-satellite detection, comprises the following steps:
(1) choose sample, extract the genomic dna of sample;
(2) joint-forward primer, reverse primer and the fluorescent mark joint of synthetic multiple micro-satellite primers;
(3) joint-forward primer of each micro-satellite primers is mixed with reverse primer, then each micro-satellite primers is mixed, obtain mix primer, in mix primer, add fluorescent mark joint, as the primer of multiplex PCR;
(4) primer of multiplex PCR is joined in PCR reaction system, carry out normal multiplex PCR amplification, amplified production is analyzed with ABI genetic analyzer, obtains the amplification collection of illustrative plates of each microsatellite locus of sample.
Multiplex PCR is that magnitude range and the fluorescence color based on amplification segment distinguished different loci, the nonoverlapping available fluorescence of the same race of segment magnitude range, there is overlapping just need to distinguishing with different fluorescence, the present invention will need the primer that mark fluorescent is identical to connect identical joint, avoid each primer to use fluorescent mark.Can determine according to the size of primer amplification fragment the joint (being corresponding fluorescence) of every pair of primer.
Wherein, the genomic dna that extracts sample in step (1) can adopt ordinary skill in the art means to extract, and preferably adopts MicroElute Genomic DNA Kit (OMEGA, USA) test kit to extract.
In step (2), synthetic multipair micro-satellite primers, can, for different samples, synthesize according to the technique means of this area routine here, preferably synthetic by Invitrogen Corp. (Guangzhou).
If combined in the past definite multiplex PCR in the present invention, fluorescence types originally and the corresponding relation of primer determine, the joint in the present invention is corresponding with fluorescence, so with primer pair should, if also undetermined multiplex PCR combination, can rebuild system.
Article 4, joint is according to the plasmid sequence design of bacterium.
The joint that fluorescent mark joint is synthesizing fluorescently labeled according to fluorescing system used, is preferably synthesized by ABI company.
In step (2) for 5 look fluorescing systems, described fluorescent mark joint is 4 fluorescent mark joints, described fluorescence is FAM, VIC, PET and NED tetra-look fluorescence, for 4 look fluorescing systems, described fluorescent mark joint is 3 fluorescent mark joints, and described fluorescence is FAM, JOE and NED three fluorescence.
Wherein the consumption of each fluorescent mark joint is good to be all mutually.
In step (2), before the forward primer of the same fluorescence of mark, connect same joint, to avoid each forward primer to need to carry out fluorescent mark.
The mixed in molar ratio of in step (3), the joint-forward primer of each micro-satellite primers and reverse primer being pressed to 1:40.
Described in step (3), the mole dosage of fluorescent mark joint is identical with the mole dosage of reverse primer.
When in step (3), the primer of each micro-satellite mixes, the ratio of primer can be determined by the amplification efficiency in multiplex PCR according to each primer, the reduction concentration that amplification efficiency is high, the raising concentration that amplification efficiency is low, object is to make the amplified production concentration of every pair of primer close.
In step (4), the reaction system of multiplex PCR is 10 μ L, comprises AB Multiplex PCR Master Mix5 μ L, mix primer 2 μ L, fluorescent mark joint 0.2 μ L, deionized water 1.8 μ L, DNA20ng.
In step (4) as long as the high resolving power electrophoresis system based on fluoroscopic examination all can, at present applicable instrument is the genetic analyzer of ABI company, ABI genetic analyzer can adopt ABI genetic analyzer 310,3130,3130xl, 3730 etc.
Last object of the present invention is achieved through the following technical solutions: above-mentioned multiple fluorescence PCR universal joint is in the application of the multiplex PCR context of detection of micro-satellite, specifically comprise above-mentioned multiple fluorescence PCR universal joint in multiplex PCR system amplified allele with separate aspect application.
Compared with prior art, tool of the present invention has the following advantages:
(1) cost significantly reduces, no matter how much weigh multiplex PCR or how many combination of primers, all only needs synthetic 4 or 3 fluorescent mark joints, carries out multiplex PCR experiment more, and saving funds are more;
(2) save time, the synthesis cycle of general fluorescent primer is that (ABI patent fluorescence synthesis cycle was longer in one week, reach several weeks), and general primer only needs 2 days, in the screening primer stage, only need to synthesize to screen with the general primer of joint sequence, after having screened, can test immediately, removed the time of resynthesis fluorescent primer after screening from;
(3) highly versatile, 4 joint sequence joints 1 of the present invention are bacterial plasmid universal primers, joint 2-4 is according to obtaining after other universal primer sequence transformations, low with eukaryotic gene group homology, reduce non-characteristic amplification, primer sequence is checking successful Application in dace and Mauremys mutica.
Brief description of the drawings
Fig. 1 is universal joint amplified allele and the separating resulting in dace multiplex PCR using in embodiment 1 in the present invention;
Fig. 2 is universal joint amplified allele and the separating resulting in Mauremys mutica multiplex PCR using in embodiment 2 in the present invention.
Embodiment
Further describe the present invention below in conjunction with the drawings and specific embodiments.
Embodiment 1
The multiple fluorescence PCR universal joint that can be used for micro-satellite detection adopting in the present embodiment, comprises 4 joints, is respectively joint 1, joint 2, joint 3 and joint 4, and the nucleotide sequence of joint 1~4 is as shown in SEQ ID:1~4.
Micro-satellite detects and is applied to eukaryote more, and the selection of universal joint is mainly considered with Eukaryotic DNA sequence dna similarity minimum, then selects the plasmid sequence of prokaryotic organism bacterium to carry out designed joint.In bacterial plasmid, had universal primer for cloning and sequencing, the present invention uses wherein a M13 universal primer, i.e. joint 1.The annealing temperature of utilizing primer5 software detection joint 1 is 51.8 DEG C, for the amplification efficiency that makes joint approaches, in plasmid complete sequence, find the primer that sequences Design annealing temperature is close as standard, by changing the base of primer, make its annealing temperature approach 51.8 DEG C, finally design joint 2-4, its annealing temperature is between 51.7 DEG C-52 DEG C, difference is very little, and differs greatly between 4 joint sequences, reduces phase mutual interference.
What the present embodiment provided utilizes the above-mentioned multiple fluorescence PCR universal joint that can be used for micro-satellite detection to carry out micro-satellite multiple fluorescence PCR detection method, and utilize above-mentioned 4 splice combinations amplified allele and the application separating in dace multiplex PCR system, comprise the following steps:
(1) sampling
Clip dace dorsal rags, is placed in dehydrated alcohol and soaks, and-20 DEG C save backup;
(2) extraction of genomic dna
Sample approximately 10~20mg of this fin ray, with MicroElute Genomic DNA Kit (OMEGA, USA) test kit extraction genomic dna, 1% agarose gel electrophoresis detects the integrity of DNA, and DNA is through NanoQ
tMmicrospectrophotometer (Bo Ao) detectable level, and be diluted to final concentration 20ng/ μ L with deionized water, be placed in-20 DEG C and save backup;
(3) micro-satellite primers is synthetic
Clear to band with dace 16, rich polymorphism, the primer of stability and high specificity carries out multiplex PCR system construction, primer is synthetic by Invitrogen Corp. (Guangzhou), 16 pairs of primers, add the forward primer sequence of joint, reverse primer sequence and fluorescent mark joint are in table 1, fluorescently-labeled joint is synthesized by ABI company, before pcr amplification, every pair of primer upstream and downstream is mixed according to 1:40 (amount of substance ratio), after mixing, form in proportion again mix primer on turbine mixer, the ratio of primer will be determined by the amplification efficiency in multiplex PCR according to each primer, the reduction concentration that amplification efficiency is high, the raising concentration that amplification efficiency is low, object is to make the amplified production concentration of every pair of primer close,
16 pairs of dace micro-satellite primers sequence signatures of table 1 and blending ratio
The present embodiment adopts 5 look fluorescing systems, and wherein fluorescence of the same colour is taken by mark in molecular weight marker, so can be exactly 4 kinds of fluorescence for mark joint, be respectively PET, VIC, NED and FAM.
(4) multiplex PCR system construction
Multi-PRC reaction system is 10 μ L, wherein comprise: AB Multiplex PCR Master Mix5 μ L, mix primer (containing upstream and downstream) 2 μ L, concentration is 10 μ M, fluorescent mark joint 0.2 μ L (wherein the consumption of every fluorescent mark joint is identical), concentration is 100 μ M, deionized water 1.8 μ L, DNA20ng;
Amplification program is: 94 DEG C of denaturation 5min; 94 DEG C of sex change 30s, 61 DEG C of annealing 45s, 72 DEG C are extended 70s, 24 circulations; 94 DEG C of sex change 30s, 53 DEG C of annealing 40s, 72 DEG C are extended 70s, 8 circulations, 72 DEG C are extended 10min again.
In mix primer, the ratio of each primer sees the above table 1.
(5) result
Utilize 4 fluorescence joints of the present invention successfully to carry out multiplex PCR, 16 microsatellite locus that simultaneously increase in dace microsatellite marker, amplification is shown in Fig. 1.
Embodiment 2
4 the multiple fluorescence PCR universal joints that can be used for micro-satellite detection that adopt in the present embodiment are with embodiment 1.
What the present embodiment provided utilize above-mentioned can be used for that multiple fluorescence PCR universal joint that micro-satellite detects carries out the method for multiplex PCR amplification and in Mauremys mutica multiplex PCR system amplified allele specific as follows with the application in separating:
(1) sampling
Extract 10~20 μ L Mauremys mutica blood, be placed in the centrifuge tube that 200 μ L buffer TL (MicroElute Genomic DNA Kit test kit, OMEGA, USA) is housed, ice chest is preserved (for extracting DNA the same day);
(2) extraction of genomic dna
With MicroElute Genomic DNA Kit test kit extraction genomic dna, 1% agarose gel electrophoresis detects the integrity of DNA, and DNA is through NanoQ
tMmicrospectrophotometer (Bo Ao) detectable level, and be diluted to final concentration 20ng/ μ L with deionized water, be placed in-20 DEG C and save backup;
(3) micro-satellite primers is synthetic
10 pairs of micro-satellite primers of, rich polymorphism clear with Mauremys mutica band, stability and high specificity carry out multiplex PCR system construction, primer is synthetic by Invitrogen Corp. (Guangzhou), the 10 pairs of primers, add joint sequence forward primer (upstream primer), reverse primer (downstream primer) and fluorescent mark joint in table 2, fluorescently-labeled joint is synthesized by ABI company, before pcr amplification, every pair of primer upstream and downstream is mixed according to 1:40 (mol ratio), after mixing, form in proportion again mix primer on turbine mixer;
10 pairs of Mauremys mutica micro-satellite primers sequence signatures of table 2 and blending ratio
The present embodiment adopts 5 look fluorescing systems, and wherein fluorescence of the same colour is taken by mark in molecular weight marker, so can be exactly 4 kinds of fluorescence for mark joint, be respectively PET, VIC, NED and FAM.
(4) multiplex PCR system construction
Multi-PRC reaction system is 10 μ L, wherein comprises: AB Multiplex PCR Master Mix5 μ L, mix primer (containing upstream and downstream primer) 2 μ L, fluorescent mark joint 0.2 μ L, deionized water 1.8 μ L, DNA1 μ L.
Amplification program is: 94 DEG C of denaturation 5min; 94 DEG C of sex change 30s, 57.5 DEG C of annealing 40s, 72 DEG C are extended 40s, 22 circulations; 94 DEG C of sex change 30s, 53 DEG C of annealing 40s, 72 DEG C are extended 30s, 8 circulations, 72 DEG C are extended 10min again, 4 DEG C of preservations.
In mix primer, the ratio of each primer is in table 2.
(5) result
Utilize 4 fluorescence joints of the present invention successfully to carry out multiplex PCR, 10 microsatellite locus that simultaneously increase in Mauremys mutica, amplification is shown in Fig. 2.
Conclusion: 4 universal joints provided by the invention can be successfully applied to the multiplex PCR of microsatellite marker, joint itself can not produce and disturb the amplification of each primer, between joint, also can not interfere with each other, in dace (fish) and Mauremys mutica (Reptilia), be verified.Splice combinations provided by the invention and using method are that a kind of amplification efficiency is high, and micro-satellite amplification technique of highly versatile can be used widely in eukaryote.
Present most of instrument all uses 5 look fluorescing systems at present, and 4 look fluorescing systems are older types, progressively eliminates at present, and the present invention also can adopt 4 look fluorescing systems to carry out, and will not enumerate herein.
Above-described embodiment is preferably embodiment of the present invention; but embodiments of the present invention are not restricted to the described embodiments; other any do not deviate from change, the modification done under spirit of the present invention and principle, substitutes, combination, simplify; all should be equivalent substitute mode, be included in protection scope of the present invention.
Claims (10)
1. can be used for the multiple fluorescence PCR universal joint that micro-satellite detects, it is characterized in that: comprise 4 joints, be respectively joint 1, joint 2, joint 3 and joint 4, the nucleotide sequence of joint 1~4 is as shown in SEQ ID:1~4.
2. the multiple fluorescence PCR universal joint that can be used for micro-satellite detection according to claim 1, is characterized in that: for 5 look fluorescing systems, select 4 joints, for 4 look fluorescing systems, select 3 joints in 4 joints.
3. the multiple fluorescence PCR universal joint that can be used for micro-satellite detection according to claim 2, is characterized in that: the fluorescence arbitrary combination that described 4 joints can be different from 4 kinds.
4. utilize the multiple fluorescence PCR universal joint that micro-satellite detects that can be used for described in claim 1 to carry out a micro-satellite multiple fluorescence PCR detection method, it is characterized in that comprising the following steps:
(1) choose sample, extract the genomic dna of sample;
(2) joint-forward primer, reverse primer and the fluorescent mark joint of synthetic multiple micro-satellite primers;
(3) joint-forward primer of each micro-satellite primers is mixed with reverse primer, then each micro-satellite primers is mixed, obtain mix primer, in mix primer, add fluorescent mark joint, as the primer of multiplex PCR;
(4) primer of multiplex PCR is joined in PCR reaction system, carry out normal multiplex PCR amplification, amplified production is analyzed with ABI genetic analyzer, obtains the amplification collection of illustrative plates of each microsatellite locus of sample.
5. the multiple fluorescence PCR universal joint that can be used for micro-satellite detection according to claim 4 carries out micro-satellite multiple fluorescence PCR detection method, it is characterized in that: in step (2) for 5 look fluorescing systems, described fluorescent mark joint is 4 fluorescent mark joints, described fluorescence is FAM, VIC, PET and NED tetra-look fluorescence, for 4 look fluorescing systems, described fluorescent mark joint is 3 fluorescent mark joints, and described fluorescence is FAM, JOE and NED three fluorescence.
6. the multiple fluorescence PCR universal joint that can be used for micro-satellite detection according to claim 4 carries out micro-satellite multiple fluorescence PCR detection method, it is characterized in that: in step (2), before the forward primer of the same fluorescence of mark, connect same joint, to avoid each forward primer to need to carry out fluorescent mark.
7. according to claim 4ly can be used for the multiple fluorescence PCR universal joint that micro-satellite detects and carry out micro-satellite multiple fluorescence PCR detection method, it is characterized in that: in step (3) by the joint-forward primer of each micro-satellite primers and reverse primer by the mixed in molar ratio of 1:40.
8. the multiple fluorescence PCR universal joint that can be used for micro-satellite detection according to claim 4 carries out micro-satellite multiple fluorescence PCR detection method, it is characterized in that: described in step (3), the mole dosage of fluorescent mark joint is identical with the mole dosage of reverse primer.
9. the multiple fluorescence PCR universal joint that can be used for micro-satellite detection according to claim 4 carries out micro-satellite multiple fluorescence PCR detection method, it is characterized in that: in step (4), the reaction system of multiplex PCR is 10 μ L, comprise AB Multiplex PCR Master Mix5 μ L, mix primer 2 μ L, fluorescent mark joint 0.2 μ L, deionized water 1.8 μ L, DNA20ng.
10. the multiple fluorescence PCR universal joint of micro-satellite detection that can be used for claimed in claim 1 is in the application of the multiplex PCR context of detection of micro-satellite.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410345866.6A CN104178566B (en) | 2014-07-18 | 2014-07-18 | A kind ofly can be used for multiple fluorescence PCR universal joint that micro-satellite detects and detection method and application |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410345866.6A CN104178566B (en) | 2014-07-18 | 2014-07-18 | A kind ofly can be used for multiple fluorescence PCR universal joint that micro-satellite detects and detection method and application |
Publications (2)
Publication Number | Publication Date |
---|---|
CN104178566A true CN104178566A (en) | 2014-12-03 |
CN104178566B CN104178566B (en) | 2016-01-20 |
Family
ID=51959907
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201410345866.6A Expired - Fee Related CN104178566B (en) | 2014-07-18 | 2014-07-18 | A kind ofly can be used for multiple fluorescence PCR universal joint that micro-satellite detects and detection method and application |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN104178566B (en) |
Cited By (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104946748A (en) * | 2015-06-01 | 2015-09-30 | 中国科学院西北高原生物研究所 | Universal SNP typing probe in gramineous plants |
CN106834545A (en) * | 2017-03-13 | 2017-06-13 | 苏州市立医院 | Detection of high risk human papillomavirus kit and detection method |
CN107190098A (en) * | 2017-07-27 | 2017-09-22 | 四川省自然资源科学研究院 | The triple PCR system detection method of a set of giant panda microsatellite locus |
CN107760767A (en) * | 2017-09-27 | 2018-03-06 | 山东省农业科学院生物技术研究中心 | A kind of wheat anti gibberellic disease multi-fluorescence SSR marker detection method |
CN108624661A (en) * | 2018-05-16 | 2018-10-09 | 天津农学院 | A method of ssr analysis being carried out to tetraploid alfalfa using multiplex PCR fluorescent labelling techniques |
CN109182546A (en) * | 2018-10-19 | 2019-01-11 | 广东省生物资源应用研究所 | For the SSR fluorescent dye primer of pangolin paternity test and application |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102352411A (en) * | 2011-09-29 | 2012-02-15 | 苏州大学 | Multiplex polymerase chain reaction (PCR) amplification method and reagent kit |
-
2014
- 2014-07-18 CN CN201410345866.6A patent/CN104178566B/en not_active Expired - Fee Related
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102352411A (en) * | 2011-09-29 | 2012-02-15 | 苏州大学 | Multiplex polymerase chain reaction (PCR) amplification method and reagent kit |
Non-Patent Citations (2)
Title |
---|
M.J.BLACKET ET.AL: "Universal primers for fluorescent labelling of PCR fragments-an efficient and cost-effective approach to genotyping by fluorescence.", 《MOLECULAR ECOLOGY RESOURCES》 * |
M.VENKATESAN ET.AL: "Using fluorescently-labeled M13-tailed primers to isolate 45 novel microsatellite loci from the arboviral vector culex tarsalis.", 《MED VET ENTOMOL》 * |
Cited By (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104946748A (en) * | 2015-06-01 | 2015-09-30 | 中国科学院西北高原生物研究所 | Universal SNP typing probe in gramineous plants |
CN104946748B (en) * | 2015-06-01 | 2018-10-19 | 中国科学院西北高原生物研究所 | General SNP typing probes in a kind of grass |
CN106834545A (en) * | 2017-03-13 | 2017-06-13 | 苏州市立医院 | Detection of high risk human papillomavirus kit and detection method |
CN107190098A (en) * | 2017-07-27 | 2017-09-22 | 四川省自然资源科学研究院 | The triple PCR system detection method of a set of giant panda microsatellite locus |
CN107760767A (en) * | 2017-09-27 | 2018-03-06 | 山东省农业科学院生物技术研究中心 | A kind of wheat anti gibberellic disease multi-fluorescence SSR marker detection method |
CN107760767B (en) * | 2017-09-27 | 2021-04-20 | 山东省农业科学院生物技术研究中心 | Wheat scab-resistant multiple-fluorescence SSR (simple sequence repeat) marker detection method |
CN108624661A (en) * | 2018-05-16 | 2018-10-09 | 天津农学院 | A method of ssr analysis being carried out to tetraploid alfalfa using multiplex PCR fluorescent labelling techniques |
CN109182546A (en) * | 2018-10-19 | 2019-01-11 | 广东省生物资源应用研究所 | For the SSR fluorescent dye primer of pangolin paternity test and application |
CN109182546B (en) * | 2018-10-19 | 2021-11-30 | 广东省科学院动物研究所 | SSR fluorescence labeling primer for paternity test of pangolin scales and application thereof |
Also Published As
Publication number | Publication date |
---|---|
CN104178566B (en) | 2016-01-20 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN104178566B (en) | A kind ofly can be used for multiple fluorescence PCR universal joint that micro-satellite detects and detection method and application | |
CN1896284B (en) | Method for identifying allelic gene type | |
CN109880912B (en) | Composite amplification kit for 44 human Y chromosome loci and application thereof | |
CN109880913B (en) | Composite amplification kit for 38 human Y chromosome loci and application thereof | |
CN107201408A (en) | A kind of method that exploitation sisal hemp SSR primers are sequenced based on transcript profile | |
CN108103164A (en) | A kind of method that copy number variation is detected using multi-fluorescence competitive PCR | |
CN104480202B (en) | A kind of Fructus Luffae reference gene and application thereof | |
CN102586456A (en) | Method for detecting copy number variations through multiple competitive polymerase chain reaction (PCR) | |
CN110863056A (en) | Method, reagent and application for accurately typing human DNA | |
CN110777211B (en) | Composite amplification system based on Y-STR locus and Y-indel locus and primer combination used by same | |
CN107841566B (en) | Composite amplification system for rapidly mutating short tandem repeat sequence of Y chromosome, kit and application | |
CN108642208A (en) | A kind of Cinnamomum and its general SSR molecular marker of relative genus plant and its development approach and application | |
CN115725749A (en) | Mouse source cell STR detection kit, method and application | |
CN105463093A (en) | Primer, kit and amplification method for fish mitochondria whole genome amplification | |
CN111718999B (en) | Multiple amplification system and detection kit for mouse short tandem repeat sequence | |
CN101985659A (en) | Kit for testing schizophrenia related gene and preparation method thereof | |
SG174036A1 (en) | Multiplex analysis of nucleic acids | |
CN102943109B (en) | Method for detecting copy number variation based on multiple internal controls in series | |
CN109136390A (en) | It is a kind of at the same identify chicken, duck, sheep Species origin PCR-STR method | |
CN108517364A (en) | Forensic medicine composite detection kit based on 56 Y chromosome SNP genetic markers | |
CN108060212B (en) | DNA typing identification kit | |
CN110551830A (en) | Human Y-STR locus fluorescence labeling kit and detection method | |
CN114561477B (en) | Bovine STR composite amplification detection kit, primer composition and application thereof | |
CN111321139A (en) | Composition for cat genotyping and application thereof | |
CN108384886A (en) | The screening technique of detection primer group, kit and its application and Medicago ruthenica self-compatible genotype of Medicago ruthenica SSR marker |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160120 Termination date: 20160718 |
|
CF01 | Termination of patent right due to non-payment of annual fee |