CN104178566B - A kind ofly can be used for multiple fluorescence PCR universal joint that micro-satellite detects and detection method and application - Google Patents
A kind ofly can be used for multiple fluorescence PCR universal joint that micro-satellite detects and detection method and application Download PDFInfo
- Publication number
- CN104178566B CN104178566B CN201410345866.6A CN201410345866A CN104178566B CN 104178566 B CN104178566 B CN 104178566B CN 201410345866 A CN201410345866 A CN 201410345866A CN 104178566 B CN104178566 B CN 104178566B
- Authority
- CN
- China
- Prior art keywords
- micro
- joint
- satellite
- primer
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6853—Nucleic acid amplification reactions using modified primers or templates
- C12Q1/6855—Ligating adaptors
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of multiple fluorescence PCR universal joint that can be used for micro-satellite and detect, comprise 4 joints, be respectively joint 1, joint 2, joint 3 and joint 4, is the nucleotide sequence of joint 1 ~ 4 as SEQ? shown in ID:1 ~ 4, this universal joint pcr amplification efficiency is high, do not interfere with each other, also can not produce interference to micro-satellite primers to be amplified.Also disclose a kind of utilize above-mentioned can be used for micro-satellite detect multiple fluorescence PCR universal joint carry out micro-satellite multiple fluorescence PCR detect method, only need synthesize 4 work, 3 fluorescent linker when the method carries out multiplex PCR and can carry out primer screening and typing assay, step is succinct, experimental period is short, and experimental cost is low.
Description
Technical field
The invention belongs to multiple fluorescence PCR technical field, be specifically related to a kind of can be used for micro-satellite detect multiple fluorescence PCR universal joint and utilize its carry out micro-satellite multiplex PCR detect methods and applications.
Background technology
Micro-satellite (Microsatellite) is also known as simple sequence repeats (SimpleSequenceRepeat, SSR), Short tandem repeatSTR (Shorttandemrepeats), SSLP (Simplesequencelengthpolymorphism), it is a fragment in DNA molecular, highly repetitive sequence in whole genome is evenly distributed in the nucleotide sequence of 1-6bp (being called core sequence, the coresequence) tandem sequence repeats that becomes to join end to end.General length tens to hundreds of bp.They are extensively distributed in various eukaryotic gene group, and distribution is more even.The allelotrope of micro-satellite has that sudden change is fast, polymorphism is high, heterozygosity is large, information content is abundant, in codominance etc. and in experimental implementation material be easy to get and sample requirement is few, schedule of operation simply and little, the available pcr amplification detection site of degree-of-difficulty factor and allelotrope band is easy to the features such as identification.Microsatellite marker is multiplex analyzes biological heredity diversity, the genetic construction of colony and the sibship of population, the foundation of genetic map and the assignment of genes gene mapping, the protection of germ plasm resource and the foundation etc. of microsatellite DNA fingerprint base.The pcr amplification of microsatellite locus mainly adopts single to primer amplification and multiplexed PCR amplification mode, and its primer of difference according to detection technique adopts general primer or fluorescent dye primer.
Single use general primer to primer amplification, a site of only increasing in each PCR reaction system, then uses the method for gel electrophoresis to be separated, determines the allelotrope of amplification, working method and plant and instrument fairly simple, but efficiency is lower.
Multiplex PCR (multiplexPCR) can increase multipair through fluorescently-labeled primer in same reaction system simultaneously, can by 2 to increasing, by the difference of the object clip size scope amplified production of distinguishing different loci different from mark fluorescent to 20 pairs of micro-satellite primers above simultaneously.The somatotype carrying out micro-satellite multiplex PCR utilizes the genetic analyzer of ABI company to carry out more, 4 (FAM, JOE can be carried out, NED and ROX) look or 5 look (FAM, VIC, PET, NED and LIZ) fluorescence somatotype is (except marking use 1 look fluorescence in molecular weight marker, actual use 3 looks or 4 look fluorescence), namely, except utilizing the difference of clip size scope and distinguishing, 3 couple of clip size overlap or 4 pairs of primers can also be distinguished by the fluorescence marking different colours.The primer number of multiplex PCR can be increased like this.Multiplex PCR needs to carry out amplification efficiency to micro-satellite primers to be amplified in advance, the matching degree of combination is tested, once determine combination of primers, just can improve subsequent experimental efficiency greatly.Multiple PCR technique is the mainstream technology means of microsatellite marker somatotype in the future, will promote the application of microsatellite marker greatly.
Carrying out multiplex PCR is at present all carry out fluorescent mark to 5 ' end of all forward primers.Such as, one group is carried out simultaneously to the multiplex PCR system of 10 site amplifications, need the forward primer of 10 pairs of primers to carry out fluorescent mark respectively, this just needs synthesis 10 fluorescent dye primers.The synthesis expense of fluorescent primer is more much higher than general primer, and different according to mark fluorescent, every bar primer generally needs 300 ~ 500 yuan/2OD, and the cycle of synthesis is also longer than general primer many.If the primer of synthesis can not add multiplex PCR system in experimentation, then the fluorescent primer synthesized just can not be used for subsequent experimental.Determine one group of multiple PCR primer, only some can be used in experiment to the fluorescent dye primer of general synthesis, causes funds and waste of time.
Summary of the invention
First object of the present invention is to provide a kind of multiple fluorescence PCR universal joint that can be used for micro-satellite and detect, and this universal joint pcr amplification efficiency is high, does not interfere with each other, and also can not produce interference to micro-satellite primers to be amplified.
Second object of the present invention is that providing a kind of utilizes the above-mentioned multiple fluorescence PCR universal joint that can be used for the detection of micro-satellite to carry out the method for micro-satellite multiplex PCR detection, 4 only need be synthesized or 3 fluorescent linker can carry out primer screening and typing assay when the method carries out multiplex PCR, step is succinct, experimental period is short, and experimental cost is low.
Last object of the present invention is to provide the above-mentioned application of multiple fluorescence PCR universal joint in microsatellite locus context of detection that can be used for the detection of micro-satellite.
First object of the present invention is achieved through the following technical solutions: a kind of multiple fluorescence PCR universal joint, comprises 4 joints, is respectively joint 1, joint 2, joint 3 and joint 4, and the nucleotide sequence of joint 1 ~ 4 is as shown in SEQID:1 ~ 4.
The nucleotide sequence of its center tap 1-4 is as follows:
Joint 1:CACGACGTTGTAAAACGAC
Joint 2:CAGGAACTCAGTGTGACACTC
Joint 3:CGACAGACAGTAAGGTCTCTG
Joint 4:AGCTCGACCAGTGAGTCAG.
4 kinds of fluorescent labeled linker that the present invention uses are synthesized by ABI company, also can substitute with other homochromy fluorescence, these 4 joints design according to the plasmid sequence of bacterium, object is minimum with Eukaryotic sequence homology, non-specific amplification is avoided to disturb, during its multiplex PCR that can be applied in micro-satellite detects, also can be applicable in other multiplex PCRs.
4 kinds of joints can mark 4 kinds of fluorescence respectively, and fluorescence and joint can arbitrary combination, but can not repeat.Once selected, namely determine the corresponding relation of joint and fluorescence.If use 5 look fluorescing systems, above-mentioned 4 joints (corresponding FAM, VIC, PET, NED tetra-look fluorescence) can be used, if use 4 look fluorescing systems, can optional wherein 3 joints (corresponding FAM, JOE, NED three fluorescence).
Second object of the present invention is achieved through the following technical solutions: a kind of utilization above-mentionedly can be used for the multiple fluorescence PCR universal joint that microsatellite locus detects and carry out the method for micro-satellite detection, comprises the following steps:
(1) choose sample, extract the genomic dna of sample;
(2) joint-forward primer of multiple micro-satellite primers, reverse primer and fluorescent labeled linker is synthesized;
(3) joint-forward primer of each micro-satellite primers is mixed with reverse primer, then each micro-satellite primers is mixed, obtain mix primer, in mix primer, add fluorescent labeled linker, as the primer of multiplex PCR;
(4) join in PCR reaction system by the primer of multiplex PCR, carry out normal multiplexed PCR amplification, amplified production ABI genetic analyzer is analyzed, and obtains the AFLP system of each microsatellite locus of sample.
Multiplex PCR distinguishes different loci based on the magnitude range of am-plified fragments and fluorescence color, the nonoverlapping available fluorescence of the same race of segment magnitude range, overlapping just needs is had to distinguish with different fluorescence, the primer needing mark fluorescent identical is connected identical joint by the present invention, avoids each primer to use fluorescent mark.The joint (namely corresponding fluorescence) of often pair of primer can be determined according to the size of primer amplification fragment.
Wherein, the genomic dna extracting sample in step (1) can adopt ordinary skill in the art means to extract, and preferably adopts MicroEluteGenomicDNAKit (OMEGA, USA) test kit to extract.
The multipair micro-satellite primers of synthesis in step (2), here can for different samples, and the technique means according to this area routine is synthesized, and is preferably synthesized by Invitrogen Corp. (Guangzhou).
If the multiplex PCR combination for determining in the past in the present invention, fluorescence types originally and the corresponding relation of primer are determined, the joint in the present invention and fluorescence are corresponding, and then should with primer pair, if also undetermined multiplex PCR combination, can rebuild system.
Article 4, joint designs according to the plasmid sequence of bacterium.
The joint that fluorescent labeled linker is synthesizing fluorescently labeled according to fluorescing system used, is preferably synthesized by ABI company.
For 5 look fluorescing systems in step (2), described fluorescent labeled linker is 4 fluorescent labeled linker, described fluorescence is FAM, VIC, PET and NED tetra-look fluorescence, for 4 look fluorescing systems, described fluorescent labeled linker is 3 fluorescent labeled linker, and described fluorescence is FAM, JOE and NED three fluorescence.
Wherein the consumption of each bar fluorescent labeled linker is good to be all mutually.
Before the forward primer of the same fluorescence of mark, connect same joint in step (2), need to avoid each forward primer to carry out fluorescent mark.
In step (3), the joint-forward primer of each micro-satellite primers and reverse primer are pressed the mixed in molar ratio of 1:40.
Described in step (3), the mole dosage of fluorescent labeled linker is identical with the mole dosage of reverse primer.
When in step (3), the primer of each micro-satellite mixes, the ratio of primer can be determined according to the amplification efficiency of each primer in multiplex PCR, the reduction concentration that amplification efficiency is high, the raising concentration that amplification efficiency is low, object is the amplified production concentration comparable making often pair of primer.
In step (4), the reaction system of multiplex PCR is 10 μ L, comprises ABMultiplexPCRMasterMix5 μ L, mix primer 2 μ L, fluorescent labeled linker 0.2 μ L, deionized water 1.8 μ L, DNA20ng.
Step (4) as long as in based on fluoroscopic examination high resolving power electrophoresis system all can, the instrument be suitable at present is the genetic analyzer of ABI company, ABI genetic analyzer can adopt ABI genetic analyzer 310,3130,3130xl, 3730 etc.
Last object of the present invention is achieved through the following technical solutions: above-mentioned multiple fluorescence PCR universal joint in the application of the multiplex PCR context of detection of micro-satellite, specifically comprise above-mentioned multiple fluorescence PCR universal joint multiplex PCR system allelic amplification be separated in application.
Compared with prior art, tool of the present invention has the following advantages:
(1) cost significantly reduces, and no matter how much weighs multiplex PCR or how many combination of primers, all only need synthesize 4 or 3 fluorescent labeled linker, and it is more to carry out multiplex PCR experiment, saves funds more;
(2) save time, the synthesis cycle of general fluorescent primer is that (ABI patent fluorescence synthesis cycle was longer in one week, reach a few week), and general primer only needs 2 days, in the screening primer stage, only the general primer that need synthesize with joint sequence screens, and can test immediately after having screened, and eliminates the time of the rear resynthesis fluorescent primer of screening;
(3) highly versatile, 4 joint sequence joints 1 of the present invention are bacterial plasmid universal primers, joint 2-4 obtains according to after the transformation of other universal primer sequence, low with eukaryotic gene group homology, reduce the amplification of non-characteristic, primer sequence is checking also successful Application in dace and Mauremys mutica.
Accompanying drawing explanation
Fig. 1 uses the universal joint in the present invention to increase and separating resulting at dace multiplex PCR allelic in embodiment 1;
Fig. 2 uses the universal joint in the present invention to increase and separating resulting at Mauremys mutica multiplex PCR allelic in embodiment 2.
Embodiment
The present invention is further described below in conjunction with the drawings and specific embodiments.
Embodiment 1
The multiple fluorescence PCR universal joint that can be used for the detection of micro-satellite adopted in the present embodiment, comprise 4 joints, be respectively joint 1, joint 2, joint 3 and joint 4, the nucleotide sequence of joint 1 ~ 4 is as shown in SEQID:1 ~ 4.
Micro-satellite detects and is applied to eukaryote more, and the selection of universal joint is mainly considered with Eukaryotic DNA sequence dna similarity minimum, then selects the plasmid sequence of prokaryotic organism bacterium to carry out designed joint.Had universal primer in bacterial plasmid for cloning and sequencing, the present invention uses wherein a M13 universal primer, i.e. joint 1.The annealing temperature of primer5 software detection joint 1 is utilized to be 51.8 DEG C, for making the amplification efficiency of joint close, in plasmid complete sequence, the close primer of sequences Design annealing temperature is found as standard, by changing the base of primer, making its annealing temperature close to 51.8 DEG C, finally designing joint 2-4, its annealing temperature is between 51.7 DEG C-52 DEG C, difference is very little, and differs greatly between 4 joint sequences, reduces and mutually disturbs.
What the present embodiment provided utilizes the above-mentioned multiple fluorescence PCR universal joint that can be used for the detection of micro-satellite to carry out micro-satellite multiple fluorescence PCR detection method, and utilize above-mentioned 4 splice combinations in the amplification of dace multiplex PCR system allelic and the application be separated, comprise the following steps:
(1) sample
Clip dace dorsal rags, is placed in dehydrated alcohol and soaks, and-20 DEG C save backup;
(2) extraction of genomic dna
Sample this fin ray about 10 ~ 20mg, extract genomic dna with MicroEluteGenomicDNAKit (OMEGA, USA) test kit, 1% agarose gel electrophoresis detects the integrity of DNA, and DNA is through NanoQ
tMmicrospectrophotometer (Bo Ao) detectable level, and be diluted to final concentration 20ng/ μ L with deionized water, be placed in-20 DEG C and save backup;
(3) micro-satellite primers synthesis
Clear with dace 16 pairs of bands, rich polymorphism, the primer of stability and high specificity carries out multiplex PCR system construction, primer is synthesized by Invitrogen Corp. (Guangzhou), 16 pairs of primers, add the forward primer sequence of joint, reverse primer sequences and fluorescent labeled linker are in table 1, fluorescently-labeled joint is synthesized by ABI company, before pcr amplification, often pair of primer upstream and downstream is mixed according to 1:40 (amount of substance ratio), turbine mixer forms mix primer after mixing more in proportion, the ratio of primer will be determined according to the amplification efficiency of each primer in multiplex PCR, the reduction concentration that amplification efficiency is high, the raising concentration that amplification efficiency is low, object is the amplified production concentration comparable making often pair of primer,
Table 116 pair dace micro-satellite primers sequence signature and blending ratio
The present embodiment adopts 5 look fluorescing systems, and wherein fluorescence of the same colour is taken by mark in molecular weight marker, so can be exactly 4 kinds of fluorescence for mark joint, be respectively PET, VIC, NED and FAM.
(4) multiplex PCR system construction
Multi-PRC reaction system is 10 μ L, wherein comprise: ABMultiplexPCRMasterMix5 μ L, mix primer (containing upstream and downstream) 2 μ L, concentration is 10 μMs, fluorescent labeled linker 0.2 μ L (wherein the consumption of every bar fluorescent labeled linker is identical), concentration is 100 μMs, deionized water 1.8 μ L, DNA20ng;
Amplification program is: 94 DEG C of denaturation 5min; 94 DEG C of sex change 30s, 61 DEG C of annealing 45s, 72 DEG C extend 70s, 24 circulations; 94 DEG C of sex change 30s, 53 DEG C of annealing 40s, 72 DEG C extend 70s, and 8 circulations, 72 DEG C extend 10min again.
In mix primer, the ratio of each primer sees the above table 1.
(5) result
Utilize 4 fluorescent linker of the present invention successfully to carry out multiplex PCR, increase 16 microsatellite locus in dace microsatellite marker simultaneously, and amplification is shown in Fig. 1.
Embodiment 2
4 the multiple fluorescence PCR universal joints that can be used for the detection of micro-satellite adopted in the present embodiment are with embodiment 1.
What the present embodiment provided utilize above-mentioned can be used for multiple fluorescence PCR universal joint that micro-satellite detects carry out multiplexed PCR amplification method and the amplification of Mauremys mutica multiplex PCR system allelic be separated in application specific as follows:
(1) sample
Extract 10 ~ 20 μ L Mauremys mutica blood, be placed in the centrifuge tube that 200 μ LbufferTL (MicroEluteGenomicDNAKit test kit, OMEGA, USA) is housed, ice chest preserves (extracting DNA for the same day);
(2) extraction of genomic dna
Extract genomic dna with MicroEluteGenomicDNAKit test kit, 1% agarose gel electrophoresis detects the integrity of DNA, and DNA is through NanoQ
tMmicrospectrophotometer (Bo Ao) detectable level, and be diluted to final concentration 20ng/ μ L with deionized water, be placed in-20 DEG C and save backup;
(3) micro-satellite primers synthesis
Clear with Mauremys mutica band, rich polymorphism, stability and high specificity 10 pairs of micro-satellite primers carry out multiplex PCR system construction, primer is synthesized by Invitrogen Corp. (Guangzhou), 10 pairs of primers, the forward primer (upstream primer) adding joint sequence, reverse primer (downstream primer) and fluorescent labeled linker are in table 2, fluorescently-labeled joint is synthesized by ABI company, before pcr amplification, often pair of primer upstream and downstream is mixed according to 1:40 (mol ratio), turbine mixer forms mix primer after mixing more in proportion;
Table 210 pair Mauremys mutica micro-satellite primers sequence signature and blending ratio
The present embodiment adopts 5 look fluorescing systems, and wherein fluorescence of the same colour is taken by mark in molecular weight marker, so can be exactly 4 kinds of fluorescence for mark joint, be respectively PET, VIC, NED and FAM.
(4) multiplex PCR system construction
Multi-PRC reaction system is 10 μ L, wherein comprises: ABMultiplexPCRMasterMix5 μ L, mix primer (containing upstream and downstream primer) 2 μ L, fluorescent labeled linker 0.2 μ L, deionized water 1.8 μ L, DNA1 μ L.
Amplification program is: 94 DEG C of denaturation 5min; 94 DEG C of sex change 30s, 57.5 DEG C of annealing 40s, 72 DEG C extend 40s, 22 circulations; 94 DEG C of sex change 30s, 53 DEG C of annealing 40s, 72 DEG C extend 30s, and 8 circulations, 72 DEG C extend 10min again, 4 DEG C of preservations.
In mix primer, the ratio of each primer is in table 2.
(5) result
Utilize 4 fluorescent linker of the present invention successfully to carry out multiplex PCR, increase 10 microsatellite locus in Mauremys mutica simultaneously, and amplification is shown in Fig. 2.
Conclusion: 4 universal joints provided by the invention can be successfully applied to the multiplex PCR of microsatellite marker, joint itself can not produce interference to the amplification of each primer, also can not interfere with each other between joint, be verified in dace (fish) and Mauremys mutica (Reptilia).Splice combinations provided by the invention and using method are that a kind of amplification efficiency is high, and micro-satellite amplification technique of highly versatile, can be used widely in eukaryote.
Current present most of instrument all uses 5 look fluorescing systems, and 4 look fluorescing systems are older types, progressively eliminate at present, and the present invention also can adopt 4 look fluorescing systems to carry out, and will not enumerate herein.
Above-described embodiment is the present invention's preferably embodiment; but embodiments of the present invention are not restricted to the described embodiments; change, the modification done under other any does not deviate from spirit of the present invention and principle, substitute, combine, simplify; all should be the substitute mode of equivalence, be included in protection scope of the present invention.
Claims (7)
1. can be used for the multiple fluorescence PCR universal joint that micro-satellite detects, it is characterized in that: comprise 4 joints, be respectively joint 1, joint 2, joint 3 and joint 4, the nucleotide sequence of joint 1 ~ 4 is as shown in SEQID:1 ~ 4.
2. the multiple fluorescence PCR universal joint that can be used for micro-satellite and detect according to claim 1, is characterized in that: for 5 look fluorescing systems, selects 4 joints, for 4 look fluorescing systems, select 3 joints in 4 joints.
3. the multiple fluorescence PCR universal joint that can be used for micro-satellite and detect according to claim 2, is characterized in that: the fluorescence arbitrary combination that described 4 joints can be different from 4 kinds.
4. utilize the multiple fluorescence PCR universal joint that can be used for the detection of micro-satellite described in claim 1 to carry out a micro-satellite multiple fluorescence PCR detection method, it is characterized in that comprising the following steps:
(1) choose sample, extract the genomic dna of sample;
(2) joint-forward primer of multiple micro-satellite primers, reverse primer and fluorescent labeled linker is synthesized;
(3) joint-forward primer of each micro-satellite primers is mixed with reverse primer, then each micro-satellite primers is mixed, obtain mix primer, in mix primer, add fluorescent labeled linker, as the primer of multiplex PCR;
(4) join in PCR reaction system by the primer of multiplex PCR, carry out normal multiplexed PCR amplification, amplified production ABI genetic analyzer is analyzed, and obtains the AFLP system of each microsatellite locus of sample;
Before the forward primer of the same fluorescence of mark, connect same joint in step (2), need to avoid each forward primer to carry out fluorescent mark;
In step (3), the joint-forward primer of each micro-satellite primers and reverse primer are pressed the mixed in molar ratio of 1:40;
Described in step (3), the mole dosage of fluorescent labeled linker is identical with the mole dosage of reverse primer.
5. the multiple fluorescence PCR universal joint that can be used for the detection of micro-satellite according to claim 4 carries out micro-satellite multiple fluorescence PCR detection method, it is characterized in that: for 5 look fluorescing systems in step (2), described fluorescent labeled linker is 4 fluorescent labeled linker, described fluorescence is FAM, VIC, PET and NED tetra-look fluorescence, for 4 look fluorescing systems, described fluorescent labeled linker is 3 fluorescent labeled linker, and described fluorescence is FAM, JOE and NED three fluorescence.
6. the multiple fluorescence PCR universal joint that can be used for the detection of micro-satellite according to claim 4 carries out micro-satellite multiple fluorescence PCR detection method, it is characterized in that: in step (4), the reaction system of multiplex PCR is 10 μ L, comprise ABMultiplexPCRMasterMix5 μ L, mix primer 2 μ L, fluorescent labeled linker 0.2 μ L, deionized water 1.8 μ L, DNA20ng.
7. the application of multiple fluorescence PCR universal joint in the multiplex PCR context of detection of micro-satellite that can be used for the detection of micro-satellite according to claim 1.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410345866.6A CN104178566B (en) | 2014-07-18 | 2014-07-18 | A kind ofly can be used for multiple fluorescence PCR universal joint that micro-satellite detects and detection method and application |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410345866.6A CN104178566B (en) | 2014-07-18 | 2014-07-18 | A kind ofly can be used for multiple fluorescence PCR universal joint that micro-satellite detects and detection method and application |
Publications (2)
Publication Number | Publication Date |
---|---|
CN104178566A CN104178566A (en) | 2014-12-03 |
CN104178566B true CN104178566B (en) | 2016-01-20 |
Family
ID=51959907
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201410345866.6A Expired - Fee Related CN104178566B (en) | 2014-07-18 | 2014-07-18 | A kind ofly can be used for multiple fluorescence PCR universal joint that micro-satellite detects and detection method and application |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN104178566B (en) |
Families Citing this family (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104946748B (en) * | 2015-06-01 | 2018-10-19 | 中国科学院西北高原生物研究所 | General SNP typing probes in a kind of grass |
CN106834545A (en) * | 2017-03-13 | 2017-06-13 | 苏州市立医院 | Detection of high risk human papillomavirus kit and detection method |
CN107190098A (en) * | 2017-07-27 | 2017-09-22 | 四川省自然资源科学研究院 | The triple PCR system detection method of a set of giant panda microsatellite locus |
CN107760767B (en) * | 2017-09-27 | 2021-04-20 | 山东省农业科学院生物技术研究中心 | Wheat scab-resistant multiple-fluorescence SSR (simple sequence repeat) marker detection method |
CN108624661A (en) * | 2018-05-16 | 2018-10-09 | 天津农学院 | A method of ssr analysis being carried out to tetraploid alfalfa using multiplex PCR fluorescent labelling techniques |
CN109182546B (en) * | 2018-10-19 | 2021-11-30 | 广东省科学院动物研究所 | SSR fluorescence labeling primer for paternity test of pangolin scales and application thereof |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102352411A (en) * | 2011-09-29 | 2012-02-15 | 苏州大学 | Multiplex polymerase chain reaction (PCR) amplification method and reagent kit |
-
2014
- 2014-07-18 CN CN201410345866.6A patent/CN104178566B/en not_active Expired - Fee Related
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102352411A (en) * | 2011-09-29 | 2012-02-15 | 苏州大学 | Multiplex polymerase chain reaction (PCR) amplification method and reagent kit |
Non-Patent Citations (2)
Title |
---|
Universal primers for fluorescent labelling of PCR fragments-an efficient and cost-effective approach to genotyping by fluorescence.;M.J.BLACKET et.al;《Molecular ecology resources》;20120124;456-463 * |
Using fluorescently-labeled M13-tailed primers to isolate 45 novel microsatellite loci from the arboviral vector culex tarsalis.;M.Venkatesan et.al;《Med vet entomol》;20110220;204-208 * |
Also Published As
Publication number | Publication date |
---|---|
CN104178566A (en) | 2014-12-03 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN104178566B (en) | A kind ofly can be used for multiple fluorescence PCR universal joint that micro-satellite detects and detection method and application | |
CN1896284B (en) | Method for identifying allelic gene type | |
CN109880912B (en) | Composite amplification kit for 44 human Y chromosome loci and application thereof | |
WO2001094634A2 (en) | Methods and devices for multiplexing amplification reactions | |
CN109880913B (en) | Composite amplification kit for 38 human Y chromosome loci and application thereof | |
CN108103164A (en) | A kind of method that copy number variation is detected using multi-fluorescence competitive PCR | |
CN102586456A (en) | Method for detecting copy number variations through multiple competitive polymerase chain reaction (PCR) | |
CN110777211B (en) | Composite amplification system based on Y-STR locus and Y-indel locus and primer combination used by same | |
US20150072344A1 (en) | Barcoded Universal Marker Indicator (BUMI) Tags | |
CN115725749A (en) | Mouse source cell STR detection kit, method and application | |
CN108642208A (en) | A kind of Cinnamomum and its general SSR molecular marker of relative genus plant and its development approach and application | |
CN105463093A (en) | Primer, kit and amplification method for fish mitochondria whole genome amplification | |
CN107893120B (en) | Primer group for detecting motion gene SNP, application and product thereof, and detection method and application for detecting motion gene SNP | |
CN111718999A (en) | Multiplex amplification system and detection kit for mouse short tandem repeat sequences | |
SG174036A1 (en) | Multiplex analysis of nucleic acids | |
CN107937493B (en) | Hairpin modified primer for allele PCR | |
CN110540988A (en) | Composite amplification system for identifying whether body fluid to be detected is non-blood, menstrual blood or peripheral blood and primer combination used by same | |
CN102943109B (en) | Method for detecting copy number variation based on multiple internal controls in series | |
CN108517364A (en) | Forensic medicine composite detection kit based on 56 Y chromosome SNP genetic markers | |
EP3315612B1 (en) | Set of primers and method for detecting and identifying mussel species of the genus mytilus | |
Zhang et al. | Identification of cashmere and wool by DNA barcode | |
CN111575386B (en) | Fluorescent composite amplification kit for detecting human Y-SNP locus and application thereof | |
CN107201396A (en) | Detect the CAPS marks of paddy rice Semi-dwarf gene sd-1 allele | |
CN105779570A (en) | Method for detecting SNP sites | |
CN105506123B (en) | A kind of method and application detecting single base mutation |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160120 Termination date: 20160718 |
|
CF01 | Termination of patent right due to non-payment of annual fee |