CN117417987A

CN117417987A - Primer pair for quantitatively detecting size distribution of PG13 cell DNA fragment and detection method

Info

Publication number: CN117417987A
Application number: CN202310839665.0A
Authority: CN
Inventors: 袁小铃; 杨志行; 李康凯; 张琪梦; 程丹妮
Original assignee: Huzhou Shenke Biotechnology Co ltd
Current assignee: Huzhou Shenke Biotechnology Co ltd
Priority date: 2023-07-10
Filing date: 2023-07-10
Publication date: 2024-01-19

Abstract

The invention relates to the field of biological detection, in particular to a primer pair and a detection method for quantitatively detecting the size distribution of PG13 cell DNA fragments. The primer pairs at least comprise 3primer pairs; the forward primer and the reverse primer of each primer pair are respectively specifically combined with a segment shown in SEQ ID NO. 1 on the genomic DNA of the PG13 cells; the length of the amplified products obtained by amplifying each group of primer pairs is respectively 100-199bp, 200-399bp and 399 bp. The method can be used for analyzing the size distribution of PG13 residual DNA fragments in biological product intermediate products and finished products, is beneficial to improving the process and the product quality, and is used for controlling and releasing the product quality. The PCR detection method using the primer pair has the advantages of simple and quick operation, high sensitivity and strong specificity.

Description

Primer pair for quantitatively detecting size distribution of PG13 cell DNA fragment and detection method

Technical Field

The invention relates to the field of biological detection, in particular to a primer pair for detecting and quantifying the size distribution of PG13 cell DNA fragments and a detection method.

Background

In recent years, with rapid development of genetic modification techniques, genetically modified cell therapy products have become a research hotspot in the medical field. In 2021, 2 months, CDE issued "guidelines for non-clinical research and evaluation of genetically modified cell therapy products (trial)" and defined as "genetically modified cell therapy products refer to living cell products that have been genetically modified (e.g., regulated, repaired, replaced, added or deleted, etc.) to alter their biological properties, intended for use in treating human diseases, such as genetically modified immune cells (e.g., T cells, NK cells, dendritic cells, macrophages, etc.), and genetically modified stem cells (e.g., hematopoietic stem cells, multipotent induced stem cells, etc.), etc.

The retrovirus vector can integrate exogenous genes of about 7.5kb into target cell genome and stably and permanently express, and has wide application in the fields of gene therapy and cell therapy. In the production of retroviruses, PG13 is one of its common stable packaging cell lines. In 1991, A.DUSTY MILLER et al constructed a retroviral packaging cell line PG13 expressing the Moroni murine leukemia virus (MoMLV) gag-pol protein and the gibbon ape leukemia virus envelope (GaLV-env) protein based on mouse fibroblast NIH 3T3, which produced high titers (greater than 10) ⁶ CFU/mL), broad host range (rat, hamster, cow, cat, dog, monkey, and human). It has been shown that the retroviral vector produced by the PG13 cell line has a high avidity for human peripheral blood lymphocytes, which may be related to the high affinity of GaLV-env of the retroviral vector for the gibbon ape leukemia virus receptor (GLVR-1) expressed in human T lymphocytes. The retroviral vector produced by PG13 can be used for preparing cell therapy products such as Car-T, TCR-T and the like.

However, in the production process of retroviral vectors, residual DNA of PG13 host cells increases the biosafety risks such as tumorigenicity, immunogenicity, etc. of intermediate products and finished products, and the larger the DNA fragment, the higher the biosafety risk. Studies have shown that the fragment length of a functional gene is at least 200bp. Therefore, from the standpoint of product quality control, the content and distribution of the residual DNA fragments of PG13 host cells need to be monitored. There is a strong interest in the amount of residual DNA and the size distribution of the residual fragments in vaccines by regulatory authorities at home and abroad. For different host cells, administration modes and frequencies, the content of the host residual DNA generally allowed is between 100pg and 10 ng/dose, and the maximum bearable amount is 10 ng/dose; the requirement for a DNA size fragment is then less than the length of one functional gene. The FDA is required to test the distribution of the amount and fragment size of the residual DNA in the finished product and explicitly indicate in the new product production guidance for human gene therapy that the fragment of the residual DNA is less than 200bp. The national institute of pharmaceutical administration (NMPA) biological product pharmacy department indicates in the guidelines of pharmaceutical research and evaluation technology for Gene therapy products (manuscript of opinion), that the residual DNA fragment should be less than 200bp.

The methods for detecting the distribution of DNA fragments mainly include capillary electrophoresis (capillary electrophoresis, CE) and quantitative PCR (qPCR). The CE method is an analysis method for realizing separation according to the mobility (migration velocity per unit electric field strength) and/or distribution behavior of each component in a sample by using an elastic quartz capillary as a separation channel and a high-voltage direct-current electric field as a driving force, and the detection sensitivity is about 1 to 5pg/μl according to the difference of instruments and reagents, and is generally used for qualitative analysis. The qPCR method is a technique for quantitatively analyzing the concentration of nucleic acid in an unknown sample in a DNA amplification reaction based on the number of cycles (Ct value) and standard curve concentration that have been undergone when a fluorescent signal in each reaction tube reaches a set threshold value. Compared with the CE method, the qPCR method has higher sensitivity (the sensitivity can reach fg grade), can quantitatively analyze and identify the species of the DNA, and is written in the relevant section of exogenous DNA residual quantity measuring method of Chinese pharmacopoeia and United states pharmacopoeia.

In summary, there is a need in the biological industry for a sensitive, stable, and efficient method for analyzing host cell residual DNA fragments in PG13 cell matrix biological products, but no related report has been made. 2021, wang Juntao et al disclose a "PG 13 host cell DNA residue detection kit and detection method" for detecting the DNA residue in products expressed or produced by PG13 cells. The method uses a short sequence B2 sequences of a domestic rat which plays a similar role to a human transposon sequence (human Alu transposon element) as a target sequence for detecting the host DNA of PG13 cells, and the fragment length is 150bp-200bp. Therefore, the target cannot design a large fragment detection system or reflect the distribution condition of the residual DNA fragments.

In order to solve the problem that a sensitive, stable and efficient method is lacking in the prior art, the invention provides a primer pair or a method for analyzing host cell residual DNA fragments in PG13 cell matrix biological products, and the invention provides a primer pair and a method for quantitatively detecting the size distribution of the PG13 cell DNA fragments. The invention aims to provide a primer pair, a method and a kit for quantitatively detecting the size distribution of PG13 residual DNA fragments based on a Real-time quantitative PCR (Real-time qPCR) technology, which are used for analyzing the size distribution of PG13 residual DNA fragments in biological product intermediates and finished products.

Reference is made to:

Miller A D,Garcia J V,Suhr N V,et al.Construction and properties of retrovirus packaging cells based on gibbon ape leukemia virus.[J].Journal of Virology,1991,65(5):2220-2224.DOI:10.1016/0166-0934(91)90062-5.

Bunnell B A,Muul LM,Donahue R E,et al.High-Efficiency Retroviral-Mediated Gene Transfer into Human and Nonhuman Primate Peripheral Blood Lymphocytes[J].Proceedings of the National Academy of Sciences,1995,92(17):7739-7743.DOI:10.1073/pnas.92.17.7739.

Lam J S,Reeves M E,Cowherd R,et al.Improved gene transfer into human lymphocytes using retroviruses with the gibbon ape leukemia virus envelope.[J].Human Gene Therapy,1996,7(12):1415.DOI:10.1089/hum.1996.7.12-1415.

Lamers C H J,Willemsen R A,Luider B A,et al.Protocol for gene transduction and expansion of human T lymphocytes for clinical immunogene therapy of cancer[J].Cancer Gene Therapy,2002,9(7):613-623.DOI:10.1038/sj.cgt.7700477.

Omori F,Juopperi T,Chan C K,et al.Retroviral-mediated transfer and expression of the multidrug resistance protein 1gene(MRP1)protect human hematopoietic cells from antineoplastic drugs.[J].Journal of Hematotherapy&Stem Cell Research,1999,8(5):503.DOI:10.1089/152581699319957.

the national pharmacopoeia Committee the pharmacopoeia of the people's republic of China, 2020 edition of three parts [ M ], beijing: chinese medical science and technology Press 2020.PHARMACOPEIA U S.General Chapter, <1130>Nucleic Acid-Based Techniques-Approaches for Detecting Trace Nucleic Acids (Residual Dna Testing) (Doc ID: GUID-373A1D1F-60DD-40E4-A922-1 BDCC0C1AAF9_1_en-US) [ J ]. USP-NF, rockville, MD: united States Pharmacopeia,2022.

The national drug administration drug review center, the gene therapy product pharmaceutical research and evaluation technical guidelines (solicited opinion manuscript) [ Z ].2020.

The national drug administration drug review center, the non-clinical study and evaluation technology guidelines (trial) for genetically modified cell therapy products (solicited opinion manuscript) [ Z ].2021.

Wang Juntao, cheng Yu, zhang Jinling, wang Mingjun. PG13 host cell DNA residue detection kit and detection method: 202111257347.0[ P ] 2021-10-27.

Disclosure of Invention

The invention provides a primer pair and a detection method for quantitatively detecting the size distribution of PG13 cell DNA fragments, aiming at overcoming the defect that a sensitive, stable and efficient method is lacking in the prior art and being used for quantitatively analyzing host cell residual DNA fragments in PG13 cell matrix biological products.

In order to achieve the aim of the invention, the invention is realized by the following technical scheme:

in a first aspect, the present invention provides a primer pair for quantitatively detecting the size distribution of a PG13 cell DNA fragment, comprising at least 3primer pairs; wherein:

the forward primer and the reverse primer of each primer pair are respectively specifically combined with a segment shown in SEQ ID NO. 1 on the genomic DNA of the PG13 cells;

the length of the amplified products obtained by amplifying each group of primer pairs is respectively 100-199bp, 200-399bp and 399 bp.

Preferably, the primer pair is selected from the following primer pairs:

a first primer pair, wherein the forward primer is combined with 342-390 th site of the sequence shown in SEQ ID NO. 1 on PG13 cell genome DNA; the reverse primer is combined with 432-479 bits of a sequence shown in SEQ ID NO. 1 on PG13 cell genome DNA, and the length of an amplified product obtained by amplifying the primer pair is 108-128bp;

a second primer pair, wherein the forward primer is combined with 342-390 th site of the sequence shown in SEQ ID NO. 1 on PG13 cell genome DNA; the reverse primer is combined with 529-573 bits of a sequence shown in SEQ ID NO. 1 on the PG13 cell genome DNA, and the length of an amplified product obtained by amplifying the primer pair is 202-222bp;

a third primer pair, wherein the forward primer is combined with 339-390 th site of the sequence shown in SEQ ID NO. 1 on PG13 cell genome DNA; the reverse primer is combined with the 820 th to 860 th positions of the sequence shown in SEQ ID NO. 1 on the PG13 cell genome DNA, and the length of an amplified product obtained by amplifying the primer pair is 492 to 512bp.

Preferably, the primer pair is selected from the following primer pairs:

a first primer pair, wherein the forward primer is combined with the 352 th to 380 th positions of the sequence shown in SEQ ID NO. 1 on the PG13 cell genome DNA; the reverse primer is combined with 442-469 th site of the sequence shown in SEQ ID NO. 1 on PG13 cell genome DNA, and the length of an amplified product obtained by amplifying the primer pair is 118bp;

the second primer pair, wherein the forward primer is combined with the 352-380 th bit of the sequence shown in SEQ ID NO. 1 on the PG13 cell genome DNA; the reverse primer is combined with 539-563 of a sequence shown in SEQ ID NO. 1 on PG13 cell genome DNA, and the length of an amplified product obtained by amplifying the primer pair is 212bp;

the third primer pair, wherein the forward primer is combined with the 349-380 th bit of the sequence shown in SEQ ID NO. 1 on the PG13 cell genome DNA; the reverse primer is combined with 830-850 th bit of the sequence shown in SEQ ID NO. 1 on PG13 cell genome DNA, and the length of an amplified product obtained by amplifying the primer pair is 502bp.

Preferably, the forward primer of the first primer pair is shown as SEQ ID NO. 3, and the reverse primer is shown as SEQ ID NO. 4;

the forward primer of the second primer pair is shown as SEQ ID NO. 3, and the reverse primer is shown as SEQ ID NO. 5;

the forward primer of the third primer pair is shown as SEQ ID NO. 2, and the reverse primer is shown as SEQ ID NO. 6.

In a second aspect, the invention also provides a combination of primer pairs for quantitative detection of the size distribution of PG13 cell DNA fragments,

the primers are as described above and comprise at least the following combinations:

the first primer pair + the second primer pair;

the first primer pair+the third primer pair;

the second primer pair+the third primer pair;

the first primer pair+the second primer pair+the third primer pair.

In a third aspect, the present invention also provides a detection reagent for quantitative detection of residual DNA of PG13 cells, the detection reagent comprising a primer pair or a combination of primer pairs as described in any one of the above.

Preferably, the detection reagent further includes a probe.

Preferably, the probe is shown as SEQ ID NO. 7, and the sequence shown as SEQ ID NO. 7 is combined with 401-423 of the sequence shown as SEQ ID NO. 1 on the PG13 cell genome DNA.

The detection reagent can be obtained by combining the forward primer, the reverse primer and the probe, and the following preferred combinations are presented herein.

Preferably, the detection reagent combination 1: the forward primer is shown as SEQ ID NO. 3; the reverse primer is shown as SEQ ID NO. 4, the probe is shown as SEQ ID NO. 7, and the length of an amplified product obtained by amplifying the detection reagent is 118bp.

Preferably, the detection reagent combination 2: the forward primer is shown as SEQ ID NO. 3; the reverse primer is shown as SEQ ID NO. 5, the probe is shown as SEQ ID NO. 7, and the length of an amplified product obtained by amplifying the detection reagent is 212bp.

Preferably, detection reagent combination 3: the forward primer is shown as SEQ ID NO. 2; the reverse primer is shown as SEQ ID NO. 6, the probe is shown as SEQ ID NO. 7, and the length of an amplified product obtained by amplifying the detection reagent is 502bp.

Preferably, the probe end in the detection reagent is labeled with a fluorescence reporter group FAM and a non-fluorescence quenching group MGB.

In a fourth aspect, the invention also provides a detection kit for quantitatively detecting residual DNA of PG13 cells, which comprises the primer pair or the combination of primer pairs or the detection reagent.

Preferably, the detection kit further comprises a PG13 DNA quantitative reference.

In a fifth aspect, the present invention also provides a method for quantitatively detecting residual DNA of PG13 cells, the method comprising: and performing qPCR on the sample to be detected by using the primer pair or the combination of the primer pairs or the detection reagent or the detection kit, and detecting a qPCR amplification product.

In a sixth aspect, the invention also provides the use of the primer pair, the detection reagent or the detection kit, for detecting whether the PG13 cell residual DNA and the fragment size distribution thereof exist in the object to be detected.

Preferably, based on the above-mentioned uses, the present invention can also be used for quantitative detection of PG13 cell-remaining DNA fragments in a test object.

Preferably, the object to be tested is selected from any one of recombinant proteins prepared based on PG13 cell matrix culture, rAAV vectors, subunit vaccines, recombinant virus-like particles (VLPs) and the like.

The invention has the following beneficial effects:

(1) The invention aims to provide a primer pair, a method and a kit for quantitatively detecting the size distribution of PG13 residual DNA fragments by adopting a real-time fluorescent quantitative PCR (real-time qPCR) technology, which are used for analyzing the size distribution of PG13 residual DNA fragments in biological product intermediates and finished products, are beneficial to improving the process and the product quality, and are used for controlling and releasing the product quality.

(2) The PCR detection method using the primer pair is simple and quick to operate, and only 4 hours are needed from the time of obtaining a sample to the time of giving a detection report; the sensitivity is high, and the quantitative limit can reach 300fg/rxn;

(3) The specificity is strong, and the interfering DNA such as CHO cells, vero cells, human cells, NS0& SP 2/0 cells, E.coli cells, pichia pastoris and the like can be distinguished.

Drawings

FIG. 1 is an amplification curve of the standard curve of the system 1 in example 1 of the present invention.

FIG. 2 is a graph showing the linear relationship of the standard curve of system 1 in example 1 of the present invention.

FIG. 3 is an amplification curve of the standard curve of the system 2 in example 1 of the present invention.

FIG. 4 is a graph showing the linear relationship of the standard curve of system 2 in example 1 of the present invention.

FIG. 5 is an amplification curve of the standard curve of system 3 in example 1 of the present invention.

FIG. 6 is a graph showing the linear relationship of the standard curve of system 3 in example 1 of the present invention.

FIG. 7 is a specific test amplification curve of the detection system in example 2 of the present invention.

FIG. 8 is an amplification curve of the limit of quantitation test of system 1 in example 3 of the present invention.

FIG. 9 is an amplification curve of the limit of quantitation test of system 2 in example 3 of the present invention.

FIG. 10 is an amplification curve of the limit of quantitation test of system 3 in example 3 of the present invention.

FIG. 11 is an amplification curve of the standard curve and the limit of quantitation test for System 1 on ABI7500 in example 4 of the present invention.

FIG. 12 is an amplification curve of the standard curve and the limit of quantitation test for System 2 on ABI7500 in example 4 of the present invention.

FIG. 13 is an amplification curve of the standard curve and the limit of quantitation test for System 3 on ABI7500 in example 4 of the present invention.

FIG. 14 is an amplification curve of the standard curve and limit of quantitation test for System 1 on LC480 in example 4 of the present invention.

FIG. 15 is an amplification curve of the standard curve and limit of quantitation test for System 2 on LC480 in example 4 of the present invention.

FIG. 16 is a standard curve and amplification curve for the limit of quantitation test for system 31 on LC480 in example 4 of the present invention.

FIG. 17 is an amplification curve of three fragment detection of a simulated sample in example 5 of the present invention.

FIG. 18 is an amplification curve of comparative system 4.

FIG. 19 is an amplification curve of comparative system 5.

FIG. 20 is an amplification curve of comparative system 6.

FIG. 21 is an amplification curve of comparative system 7.

FIG. 22 is an amplification curve of comparative system 8.

FIG. 23 is an amplification curve of comparative system 9.

FIG. 24 is an amplification curve of system 10 as a comparison.

FIG. 25 is an amplification curve of comparative system 11.

FIG. 26 is an amplification curve of comparative system 12.

Detailed Description

The invention is further described below in connection with specific embodiments. Those of ordinary skill in the art will be able to implement the invention based on these descriptions. In addition, the embodiments of the present invention referred to in the following description are typically only some, but not all, embodiments of the present invention. Therefore, all other embodiments, which can be made by one of ordinary skill in the art without undue burden, are intended to be within the scope of the present invention, based on the embodiments of the present invention.

Primer pairs of the invention

The term "primer" as used herein has the meaning conventionally understood by those skilled in the art. The PG13 cell residual DNA specific primer of the invention is not designed for the exogenous gene itself or the viral vector itself, but is designed for the sequence shown in SEQ ID NO. 1 of the PG13 cell residual DNA. In other words, the primers of the present invention can specifically bind to the sequence shown in SEQ ID NO. 1 of PG13 cell genomic DNA.

Wherein the sequence shown in SEQ ID NO. 1 of PG13 cell genome DNA is specifically shown as follows. SEQ ID NO. 1 is a long scattered repeat on the mouse genome (long interspersed nuclear elements, LINE). By bioinformatic analysis, the sequence length of SEQ ID NO. 1 is 3274bp, and the copy number on the genome of the mouse is 2.8E4 times.

GATGTTGAACATTTTTTCAAGTGTTTCTCTGCCATTCGGTATTCCTCAGGTGAGAATTCTTTGTTCAGCTCTGAGCCCCATTTTTTAATGGGGATATTTGATTTTTTGGAGTCCACCTTCTTGAGTTCTTTATATATATTGGATATTAGTCCCCTATCCGATTTGGGATAGGTAAAGATCCTTTCCCAATATTTGGTGGCCTTTTTGTCTTATTGACAGTGTCTTTTGCTTTGCAGAAGCTTTGCAATTTTATTAGGTTCCATTTATCGATTCTTGATCTTACAGCACAAGCCATTGCTGTTCTATTCAGGAATTTTTCCCCTTTACCCATATCTTCGAGGCTTTTCCCTACTTTCTCCTCTGTAAGTTTCAGTGTCTCTGGTTTTATGTGGAGTTCCTTAATCCACTTAGATTTGACCTTAGTACAAGGAGATAGGAATGGATCAATTCGCATTCTTCTACATGATAACAGCCAGTTGTGCCAGCACCATTTGTTAAAAATGCTGTCTTTTTTCCACTGGATGGTTTTAGCTCCCTTGTCAAAGATCAGGTGACCATAGGTGTGTGGATTCATCTCTGGGTCTTCAATTCTGTTACATTGGTCTACTTGTCTGTCACTATACCAGTACCATGCAGTTTTGATCACAATTGCTCTGTAGTACAGTTTTAGGTCCGGCATAGTGATTCCACCAGAGGTTCTTTTATCCTTGAGAAGAGTTTTTGCTATCCTCGTTTTTTTGTTATTCCAGATGAATCTGCCGATTGCCCTTTCTAATTCGTTGAAGAATTGAGTTGGAATTTTGATGGGGATTTCATTGAATCTGTAGATTGCTTTTGGCAAGCTAGCCATTTTTACAATGTTGATCCTGCCAATCCATGAGCATGGGAGATCTTTCCATCTTCTGAAATCTTCTTTAATTTCTTTCTTTAGAGACTTGAAGTTCTTATCATACAGATATTTCACTTCTTAATTAGAGTCACGCCAATGTATTTTATATTATTTGTGACTATTGAGAAGGGTGTTGTTTCCCTAATTTCTTTCTCAGCCTGTTTATCCTTTGTGTACAGAAAGGCCATTGACTTATTTGAGTTAATTTTATATCCAGCTACTTCATTGAAGCTGTTTATCATGCTTAGGATTTCTCTGGTGGAATTTTTAGGGTCACTTATATATATTATCATATCATCTGCAAAAAGTGATAATTTGACTTCTTCCTTTCCAATTTGTATCCCCTTGATCTCCTTTTGTTTTCTAATTGCTCTGGCTAGGACTTCAAGTACAATGTTGAATAGGTAGGGCGAGAGTGGACAGACTTGTCTAGTACCTGATTTTAGTGGGATTGCTTCCAGCTTCTCACCATTTACTTTGATGTTGGCTATTGGTTTCCTGTAGATTGCTTTTATCATGTTTAGGTATGGGCTTTGAATTCCTGATCTTTCCAAGACTTTTATCATGAATGGGTGTTGGATTTTGTCAAATGCTTTCTCAGCATCTAACGAGATGATCATGTGATTTTTGTCTTTGAGTTTGTTTATATACTGGATTACATTGATGGATTTTCGTATATTGAACCATACCTGTATCCCTGGGATGAAACCTACTTTGTCAGGATGGATGATTGTTTTGATGTGTTCTTGGATTCAGTTAGCAAGAAATTTATTGAGGATTTTTGCATCGATATTCATAAGGGAAATTGGTCTGAAGATCTCTATCTTTGTTGGGTTTTTTTGTGCTTTAGGTATCAGAGTAATTGTGGCTTCATAGAATGAGTTTGGTAGAGTACCTTCCGTTTCTATTTTGTGGAATGGTTTGTGAAGAACTGGAATTAGGTCTTCTTTGAAGGTCTGATAGAACTCTGCACTAAACCCATCTGGTCCTGGGCTTTTTTGGGCTTGGAGACTATTAATGACTGCTTCTATTACTTTAGGGGATATAGGTCGGTTTAGGTAATTAATCTGATCCTGATCTAACTTTGGTACCTGGTATCTGTCTAGAAATTTGTCTATTTCAAACAGATTTTCCAGTTTTGTTGAGTATAGCCTTTTGTAGAAGGATCTGATGGTGTTTTGGATTTCTTCAGGATCTGTTCTTATGTGTCCCTTTTCATTTCTGATTTTGTTAATTAGGATGCTTTCCCTGTGCCCTCTAGTGAGTCTGGCTAAGGGTTTATCAATCTTCTTGATTTTCTCAAAGAACCAGCTCCTTGATTGGTTTATTCTTTGAATAGTTCATCTTGTTTCCACTTGGTTGATTTCCACCCTGAGTTTGATTATTTCCTACCTTCTACTTCTCTTGGGTGAATTTGCTTCCTTTTGTTCTAGAGCTTTTAGGTGTGTTGCCAAGCTGCTAATGTATGCTCTCTCTTGTTTCCTTTTGGAGGCACTCAGAGCTATGAGTTTTCCTCTTAGGAATATTTTCATTGTGTCCCATAATTTTGGGTATGTTGTGGCTTCATTTTCATTAAACTCCAAAAAGTCCTTAATTTCTTTCTTTATTCCTTCCTTGACCAAGGTATCATTGAGAAGAGTGTTGTTCAGTTTCCACGTGAATGTTGGCTTTCTATTATTTATGTTGTTATTGAAGATCAGCCTTAGTCCATGGTGATCTGATAGGATGCATGGGACAATTTCAATATTTTTGTATATGTTGACGCTTGTTTTGTGACCAATTATGTGGTAAATTTTGGAGAAGGTACCATGAGTTGCTGAGAAGAAGATATATTCTTTTGTTTTAGGATAAAATGTTCTGTAGATATCTGTCAAGTCCATTTGTTTCATCACTTCTGTTAGTTTCACTGTGTCCCTGTTTAGTTTCTGTTTCCATGATCTTTCCATTGGTGAAAGTGGTGTGTTGAAGTCTCCCACTATTATTGTGTGTGGTGCAATGTGTGCTTTGAGCTTTACTACAGTTTCTTTAATGAATTTGGCTGCCCTTGTATTTGGAGCATAGATATTCAGAATTGAGAGTTCCTCTTGGAGGATTTTACCTTTGATGAGTATGAAGTTCCCTTCCTTGTCTTTTTTGATTATTTTGTTTTGGAAGTCGATTTTGATAGATATTAGAATGGGTACTCGAGCTTGTTTATTTATACCATTTGCTTGGAAAATTGTTTTCCAGCCTTTCATTCTGAGGTAGTGTCTATCTTTATCTCTGAGATGAGTTTCCTGTAAGCAGCAAAATCTTGGGTCTTGTTTGTGTAGCCAGTTTGTTAATCTATGTCTTTTTATTGGGGAGTTCAGTCCATTGATATTAAGAGATATTAAGGAAAAGTAA。

In view of the teachings of the present invention and the common general knowledge in the art, one skilled in the art will appreciate that a variety of primer pairs can be designed for the sequence shown in SEQ ID NO. 1. Thus, the primer pair of the present invention is not limited to the primer pair specifically mentioned in the examples.

In a specific embodiment, the forward primer is as shown in any one of SEQ ID NOS.2-3.

The sequence shown in SEQ ID NO. 2 is specifically: CTACTTTCTCCTCTGTAAGTTTCAGTGTCTCT, which binds to positions 349-380 of the sequence shown in SEQ ID NO. 1 on PG13 cell genomic DNA.

The sequence shown in SEQ ID NO. 3 is specifically: CTTTCTCCTCTGTAAGTTTCAGTGTCTCT, which binds to positions 352-380 of the sequence shown in SEQ ID NO. 1 on the genomic DNA of PG13 cells.

In a specific embodiment, the reverse primer is as set forth in any one of SEQ ID NOS.4-6.

The sequence shown in SEQ ID NO. 4 specifically comprises: TTATCATGTAGAAGAATGCGAATTGATC, which binds to positions 442-469 of the sequence shown in SEQ ID NO. 1 on PG13 cell genomic DNA.

The sequence shown in SEQ ID NO. 5 is specifically: CACCTATGGTCACCTGATCTTTGAC which binds to positions 539-563 of the sequence shown in SEQ ID NO. 1 on PG13 cell genomic DNA.

The sequence shown in SEQ ID NO. 6 is specifically: ATGGCTAGCTTGCCAAAAGCA which binds to the PG13 cell genomic DNA at positions 830-850 of the sequence shown in SEQ ID NO. 1.

In specific embodiments, the primer pair is selected from the following primer pairs:

the forward primer of the first primer pair is shown as SEQ ID NO. 3, and the reverse primer is shown as SEQ ID NO. 4;

Combination of primer pairs:

the primer pair is shown as the first primer pair, the second primer pair, the third primer pair and the fourth primer pair, and at least comprises the following combination:

the first primer pair + the second primer pair;

the first primer pair+the third primer pair;

the second primer pair+the third primer pair;

the first primer pair+the second primer pair+the third primer pair.

The probe of the invention:

the term "probe" as used herein has the meaning conventionally understood by those skilled in the art, i.e., a small single-stranded DNA or RNA fragment, for detecting a nucleic acid sequence complementary thereto.

In view of the teachings of the present invention and the common general knowledge in the art, it will be appreciated by those skilled in the art that, knowing the primer pair, the skilled artisan can autonomously design a probe based on the template sequence between the forward primer and the reverse primer binding site and detect the technical effect of the probe and the primer pair. In particular embodiments, one of ordinary skill in the art can specifically design probes as desired, which can be in the liquid phase or immobilized on a solid phase; can be bound before amplification or after amplification. Therefore, the probe of the present invention is not limited to the probes specifically disclosed in the examples. The primer set of the present invention is not limited to use in pairing with the probes specifically disclosed in examples.

In a specific embodiment, the probe of the invention has a sequence shown in SEQ ID NO. 7.

The sequence shown in SEQ ID NO. 7 is specifically:

FAM-AATCCACTTAGATTTGACCTTAG-MGB, which binds to positions 401-423 of the sequence shown in SEQ ID NO. 1 on PG13 cell genomic DNA.

The detection reagent of the invention:

the invention also provides a detection reagent for quantitatively detecting the PG13 cell residual DNA, which comprises the primer pair, the probe and other components required for PCR implementation, such as qPCR reaction buffer, IPC MIX, DNA diluent and DNA quantitative reference.

In a specific embodiment:

the primer pair comprises the first primer pair, the second primer pair and the third primer pair.

The probe has a sequence shown as SEQ ID NO. 7.

The first primer pair, the second primer pair and the third primer pair are combined with the probe, and the following preferred combinations are presented in the present application.

In a specific embodiment, the detection reagent of the present invention has a detection sensitivity of 300fg/rxn.

0078 the present invention also provides a kit for detecting residual DNA of PG13 cells, comprising a container, the primer pair of the present invention and a probe in the container, based on the primer pair or the detection reagent of the present invention.

In a specific embodiment, the reagent of the present invention further comprises: qPCR reaction buffer, IPC MIX, DNA dilutions, DNA quantitative references.

The invention further provides a method for detecting PG13 cell residual DNA on the basis of the primer pair or the detection reagent, which comprises the step of performing qPCR detection on a sample to be detected by using the primer pair or the detection reagent.

The invention will be further illustrated with reference to specific examples, it being understood that these examples are intended to be illustrative of the invention only and are not intended to limit the scope of the invention, and that experimental methods without specific conditions noted in the examples below are generally carried out under conventional conditions or under conditions suggested by the manufacturer, percentages and parts being by weight unless otherwise indicated.

Materials, instruments and methods for use in the present invention

[ Material ]

qPCR reaction buffer (product number NNB 001), IPC MIX (product number NNC 070), DNA dilution (product number NND 001), PG13Primer & Probe MIX-118 (product number NNC 083) composed of the Primer pair of the invention and the Probe of the invention, PG13Primer & Probe MIX-212 (product number NNC 084), PG13Primer & Probe MIX-502 (product number NNC 085), PG13 DNA quantitative reference (product number NNA 049), CHO DNA quantitative reference (product number NNA 001), vero DNA quantitative reference (product number NNA 010), human DNA quantitative reference (product number NNA 003), E.coli DNA quantitative reference (product number NNA 002), pichia pastoris DNA quantitative reference (product number NNA 007), NS0& SP 2/0DNA quantitative reference (product number NNA 021) are all from the biological technology Co-Ltd of Huzhou Shen Ke.

Other primer probes were synthesized in the hippocampus biotechnology limited in lake.

The sequences of the primer set of the present invention and the probe of the present invention are shown in Table 1 below.

TABLE 1

Combining primer pairs with probes resulted in several different systems as shown in Table 2 below.

TABLE 2

System numbering	Combination mode	Product size
			System 1	SEQ ID NO:3、SEQ ID NO:4、SEQ ID NO:7	118
System 2	SEQ ID NO:3、SEQ ID NO:5、SEQ ID NO:7	212
			System 3	SEQ ID NO:2、SEQ ID NO:6、SEQ ID NO:7	502

。

[ Instrument ]

Real-time fluorescent PCR detection system: the brand is Huzhou Shen Ke, and the model is SHENTER-96S (SHENTER-96S for short).

Real-time fluorescent quantitative PCR system: the brand is Applied Biosystems, and the model is 7500 (ABI 7500 for short).

Real-time fluorescent quantitative PCR system: the brand is Roche, model is LightCycler480 II (abbreviated as "LC 480").

[ EXAMPLES ]

Example 1 Linear Range

[ METHOD ] A method for producing a polypeptide

1. Preparing standard curve samples and template-free control (NTC) samples

Standard curve samples: the PG13 DNA quantitative reference was subjected to 10-fold gradient dilution with a DNA dilution solution to prepare DNA solutions of 300 PG/. Mu.L, 30 PG/. Mu.L, 3 PG/. Mu.L, 0.3 PG/. Mu.L, and 0.03 PG/. Mu.L.

NTC sample: DNA dilution.

2. Preparing a PCR reaction system

Preparing a PCR reaction system

System 1 (reaction volume 30 μl): 20. Mu.L qPCR reaction (15.9. Mu. L qPCR Reaction Buffer +2.8. Mu.L PG13Primer & Probe MIX-118+1.3. Mu.L IPC MIX) +10. Mu.L template (standard curve sample or NTC sample).

System 2 (reaction volume 30. Mu.L): 20. Mu.L qPCR reaction (15.9. Mu. L qPCR Reaction Buffer +2.8. Mu.LPG 13Primer & Probe MIX-212+1.3. Mu.L IPC MIX) +10. Mu.L template (standard curve sample or NTC sample).

System 3 (reaction volume 30. Mu.L): 20. Mu.L qPCR reaction (15.9. Mu. L qPCR Reaction Buffer +2.8. Mu.LPG 13Primer & Probe MIX-502+1.3. Mu.L IPC MIX) +10. Mu.L template (standard curve sample or NTC sample).

PCR reaction procedure

PCR amplification was performed on SHENTKE-96S.

The procedure is as follows: pre-denaturation at 95℃for 10min; 15s at 95 ℃, 30s at 60 ℃, 1min at 72 ℃ 30s,40 cycles; the reaction volume was 30. Mu.L.

4. Data analysis and result determination data analysis: after amplification, the threshold line was 0.05, and R of the standard curve was read ² Amplification efficiency, and the detected Ct value for each sample.

And (3) result judgment: correlation coefficient R of standard curve equation ² The amplification efficiency is between 83.3% and 110% and is larger than 0.980.

The detection Ct value of St1 is between 13.50 and 15.50, and the Ct value of the template-free control (NTC) is not detected or is more than or equal to 35.00.

[ experimental results ]

On SHENTKE-96S, the standard curves of three groups of detection systems were amplified, and the correlation coefficient (R ² ) And amplification efficiency (En). The results show that the linear range of the three groups of detection systems is 3 ng/rxn-300 fg/rxn (rxn is abbreviated as reaction and is the same as the following), and the standard curve R ² More than or equal to 0.990, wherein En is 83.3-110.0%, NTC Ct is more than or equal to 35.00, and VIC Ct is less than or equal to 32.00.

The amplification curves and the linear relation diagrams of the standard curves of the systems 1-3 are shown in fig. 1-6, and table 3 is a linear range test result table of four different fragment detection systems.

TABLE 3 Linear Range test results for three different segment detection systems

TABLE 3 results of linear Range test for three groups of detection systems

Example 2-specificity:

[ Experimental procedures ]

1. Preparing a positive control DNA sample, an interference DNA sample and an NTC sample

Positive control DNA sample: the PG13 DNA quantitative reference with the stock concentration of 30 ng/. Mu.L was subjected to 10-fold gradient dilution with DNA dilution to prepare a positive control DNA sample of 300 PG/. Mu.L.

Interfering DNA samples: and respectively carrying out 10-time gradient dilution on the CHO DNA quantitative reference product, the Vero DNA quantitative reference product, the Human DNA quantitative reference product, the E.coli DNA quantitative reference product, the Pichia pastoris DNA quantitative reference product and the NS0& SP 2/0DNA quantitative reference product with the stock solution concentration of 30 ng/. Mu.L by using DNA diluent to prepare 6 300 pg/. Mu.L interference DNA samples.

NTC sample: DNA dilution.

2. Preparing a PCR reaction system

System 1 (reaction volume 30 μl): 20. Mu.L qPCR reaction (15.9. Mu. L qPCR Reaction Buffer +2.8. Mu.L PG13Primer & Probe MIX-118+1.3. Mu.L IPC MIX) +10. Mu.L template (interfering DNA sample or NTC sample). Each sample was 3 replicates.

System 2 (reaction volume 30. Mu.L): 20. Mu.L qPCR reaction (115.9. Mu. L qPCR Reaction Buffer +2.8. Mu.LPG 13Primer & Probe MIX-212+1.3. Mu.L IPC MIX) +10. Mu.L template (interfering DNA sample or NTC sample). Each sample was 3 replicates.

System 3 (reaction volume 30. Mu.L): 20. Mu.L qPCR reaction (115.9. Mu. L qPCR Reaction Buffer +2.8. Mu.LPG 13Primer & Probe MIX-502+1.3. Mu.L IPC MIX) +10. Mu.L template (interfering DNA sample or NTC sample). Each sample was 3 replicates.

PCR reaction procedure

PCR amplification was performed on SHENTKE-96S.

4. Data analysis and result determination

After amplification, the threshold line was 0.05, and the detection Ct value of each sample was read.

The NTC sample should have a Ct value of no detectable or > 35.00. If the Ct value of the interference DNA sample is not detected or is more than or equal to 35.00, the interference DNA sample is proved to have no interference to a detection system, otherwise, certain interference exists.

[ experimental results ]

The interference of six common engineering cells/engineering bacteria CHO, vero, human, NS0& SP 2/0, E.coli and Pichia pastoris genome DNA on three groups of PG13 residual DNA fragment analysis section detection systems is evaluated. Wherein, the concentration of the interfering engineering cell/engineering bacteria DNA is 3ng/rxn. The results show that the FAM Ct of NS0& SP 2/0 is consistent with PG13, which shows that the system has poor anti-interference effect on NS0& SP 2/0 because PG13 and NS0& SP 2/0 belong to the species of mice, and the amplification target selected by the PG13 system has high similarity with NS0& SP 2/0; the FAM signals of the other five interfering DNAs are not detected or the Ct value is more than or equal to 35.00, which indicates that the FAM signals have small interference on the established three groups of systems.

The results of the specificity test of the detection system of the present invention are shown in Table 4, and the amplification curve of the specificity test of the detection system of the present invention is shown in FIG. 7.

TABLE 4 results of the specific tests of the detection systems of the invention

Example 3-limit of quantitation:

[ Experimental procedures ]

1. Preparing a standard curve sample, a quantitative limit sample and an NTC sample

Standard curve samples, quantitative limit samples: the PG13 DNA quantitative reference was subjected to 10-fold gradient dilution with a DNA dilution solution to prepare DNA solutions of 300 PG/. Mu.L, 30 PG/. Mu.L, 3 PG/. Mu.L, 0.3 PG/. Mu.L, and 0.03 PG/. Mu.L. Wherein the 0.03pg/μl sample volume should be greater than 150 μl.

NTC sample: DNA dilution.

2. Preparing a PCR reaction system

System 1 (reaction volume 30 μl): 20. Mu.L qPCR reaction (15.9. Mu. L qPCR Reaction Buffer +2.8. Mu.L PG13Primer & Probe MIX-118+1.3. Mu.L IPC MIX) +10. Mu.L template (standard curve, limit of quantitation or NTC sample). The standard curve samples and NTC samples were 2 replicates per group, limiting the number of samples to 10 replicates.

System 2 (reaction volume 30. Mu.L): 20. Mu.L qPCR reaction (15.9. Mu. L qPCR Reaction Buffer +2.8. Mu.LPG 13Primer & Probe MIX-212+1.3. Mu.L IPC MIX) +10. Mu.L template (standard curve, limit of quantitation sample or NTC sample). The standard curve samples and NTC samples were 2 replicates per group, limiting the number of samples to 10 replicates.

System 3 (reaction volume 30. Mu.L): 20. Mu.L qPCR reaction (15.9. Mu. L qPCR Reaction Buffer +2.8. Mu.LPG 13Primer & Probe MIX-502+1.3. Mu.L IPC MIX) +10. Mu.L template (standard curve, limit of quantitation sample or NTC sample). The standard curve samples and NTC samples were 2 replicates per group, limiting the number of samples to 10 replicates.

PCR reaction

PCR amplification was performed on SHENTKE-96S.

4. Data analysis and result determination

Substituting the detection Ct value of the quantitative limit sample into a standard curve to calculate the detection concentration of each hole, and calculating the variation Coefficient (CV) and the variation of the detection concentration of the quantitative limit sample with 10 compound holes, wherein the calculation formula is as follows:

[ experimental results ]

And amplifying standard curves (3 ng/rxn-300 fg/rxn) of three groups of detection systems, simultaneously measuring detection Ct values (10 complex holes) of the groups at the template quantity of 300fg/rxn, substituting the detection Ct values into the standard curves to calculate detection concentrations of all holes, and calculating variation Coefficients (CV) and deviation of the detection concentrations of the 10 complex holes. The standard curve results used for the limit of quantitation are shown in Table 5. The amplification curves in decibels for the limit of quantification tests for systems 1, 2 and 3 are shown in FIGS. 8, 9 and 10. The result shows that CV and deviation of the detection concentration of 300fg/rxn of each system are less than or equal to 30.0 percent, which accords with the design and development requirements, and the quantitative limit of each system can reach 300fg/rxn.

TABLE 5 quantitative limit detection results of the detection system of the present invention

Example 4-durability:

the applicability of the detection system of the invention on quantitative PCR instruments of different brands and models is tested. Both the Coefficient of Variation (CV) and the variation of the limit of the amount are required to be less than 30%.

[ Experimental procedures ]

While example 2-Experimental procedure in the specialization. PCR amplification was performed on ABI7500 and LC480 instruments.

[ experimental results ]

Standard curve 300fg/rxn (St 5) 10 complex wells of three sets of systems were amplified on ABI7500 and LC480 instruments and the correlation coefficients of the standard curves were calculated (R ² ) CV and deviation of detection concentration from amplification efficiency (En) and 10-well St5 were analyzed for a range of Ct values of the VIC signal. The results show that the amplification performance of the three groups of established systems on two instruments meets the requirements of linear range and quantitative limit, and the systems are applicable.

ABI7500 results (FAM and VIC threshold lines are 0.1)

The linear range test results of the detection system of the present invention on ABI7500 are shown in Table 6, and the quantitative limit test results of the detection system of the present invention on ABI7500 are shown in Table 7. Wherein: the standard curve and the amplification curve for the limit of quantification test for system 1 on ABI7500 are shown in fig. 11, respectively. The standard curve of system 21 on ABI7500 and the amplification curve of the limit of quantification test are shown in FIG. 12, respectively. The standard curve and the amplification curve for the limit of quantification test for System 3 on ABI7500 are shown in FIG. 13, respectively.

TABLE 6 Linear Range test results of the detection systems of the invention on ABI7500

TABLE 7 quantitative limit detection results of the detection system of the present invention on ABI7500

The results of the linear range test of the inventive detection system on LC480 (FAM noise line/threshold line each 3.000 and vic noise line/threshold line each 8.000) are shown in table 8, and the quantitative limit test of the inventive detection system on LC480 is shown in table 9. Wherein: the standard curve and the amplification curve for the limit of quantitation test for system 1 on LC480 are shown in figure 14, respectively. The standard curve and the amplification curve for the limit of quantitation test for System 2 on LC480 are shown in FIG. 15, respectively. The standard curve and the amplification curve for the limit of quantitation test for system 3 on LC480 are shown in figure 16, respectively.

TABLE 8 results of the linear Range test of the detection systems of the invention on LC480

TABLE 9 quantitative limit detection results of the detection systems of the invention on LC480

Example 5-simulated sample test:

[ Experimental procedures ]

PG13 gDNA (30 ng/. Mu.L) was digested with Benzonase at a concentration of 1U/mL for 10min to simulate the residual DNA of host cells of varying fragment sizes in the actual sample (Benzonase was used to cleave the DNA fragments in the actual process). And after digestion is finished, inactivating the DNA for 5 minutes at 80 ℃ to prepare a DNA dispersion distribution simulation sample. The theoretical final concentration of DNA was 3 ng/. Mu.L.

The simulated samples were subjected to three fragment residual DNA detection, and the percentage of 200+bp, 500+bp and DNA removal rate were calculated.

[ experimental results ]

The residual DNA detection of three fragments is carried out on a 10-fold diluted simulated sample (PG 13 gDNA enzyme-digested sample: 1U/mL,10 min), and the average detection concentration and the percentage show the trend that the larger the fragments are, the lower the numerical value is, so that the method meets the expectations. DNA removal rates of 118bp, 212bp and 502bp were 20.4%, 23.8% and 30.9% respectively, indicating that Benzonse was able to cleave large fragment DNA into small fragments. The detection results of the detection system of the invention on the simulated sample are shown in table 10, and fig. 17 is an amplification curve of the detection of three fragments of the simulated sample.

TABLE 10 detection results of the detection system of the invention on the simulated samples

[ comparative example ]

Primer probe sequences, combination modes and product sizes used by other detection systems are shown as follows:

in a specific comparative embodiment, the target sequence used in the comparative example is specifically shown in SEQ ID NO. 8. SEQ ID NO. 8 is also a LINE sequence which is found by the inventor by self through a letter analysis, the length is 3251bp, and the copy number on the genome of the mouse is 2.8E4 times.

The target sequence shown in SEQ ID NO. 8 specifically comprises:

TTACTTTTCCTTGATATCTCTTAATATCAATGGACTTAATTCCCCAATAAAAAGACATAGACTAACAGATTGGATACACAAACAGGACCCAACATTTTGCTGCTTACAGGAAACACATCTCATGGAAAAAGATATAAACTACCTCAGGATGAAAGGCTGGAAAACAATTTTCCAACCAAACGGTGTGAAGAAACTAGCTGGAGTCGCCATCCTAATATCGAATAAAATCGACTTCCAACCCAAGTTATCAAAAAAAGACAAGGAGGGGCACTTCATACTCATCAAAGGTAAAATCCTCCAAAACGAACTCTCAATTCTGAATATCTATGCTCCAAATGCAAGGCCAGCCACACTCATTAAAGAAACTTTAGTAAAGCTCAAAGCACACATTGCACCTACCACAATAATAGTGGGAGACTTCAACACCCCACTCTCATCAATGGACAGATCTTGAAAACAGAAACTAAACAGAGACACATGGACACTAACAGAAGTTATGAAGCAAATGGATTTAACAGATATCTACAGAACATTTTATCCTAAAACAAAAGGATATACGTTCTACTCAGCAACTTATGGTACCCTCTCCAAAATTTACTATATAATTGGTCACAAAATGGGCCTCAAGAGGTTAAAAAAAATGAAATTGTCCCATGCATCCTATCATGGACTAAGGCTGATATTCAATAACAATATAAAGAATACAAAGCCAACATTCATGTGGAAACTGAACACTCTCCTCAATGGTACCTTGGTCAAGGAAGAAATAATGAAAGAAATTGAAGACTTTTTAGAGTTTAATGAAAATGAAGCCAAAACATACCCAAACTTATGAGACACAATGAAAGCATTCCTAAGAGGAAAACTCATAGCTCTGAGTGCCTCTAAAAAGAAGCTAGAGAGAGCATACACTAGCATCTTGACAACACACATAGAAGCTATAGAACAAAAGGAAGCAAATTCACCAAAGAGGAGTAGACAGCAGGAAATAATCAAACTCAGGGGTGAAATCAACCAAGTAGAAACAAAAAGAACTATTCAAAGAACCAACCAAATCAGAAGCTGGTTCTTTGAGAAAATCAACACGATAGAGAAACCCTTAGCCAGACTAACTAGACAGCACAGGAACAGCATCCTAGTTAACAAAATTAGAAATGAAACAGGAGACATAACAACAGATCTTGAGGAAATCCAAAACACCATCAGATTCTTCTAAAAAAGGCTATAAACTAGAAAACCTGGATGAAATGGACAAATTTCTAGACAGATACCAACATACCAAAGATAAGTCAGGATCAGATTAATGACCTGAACAGTCCTATATCCCCTAAAGAAGTAGAAGCAGTCATTAATAGTCTCCCAACCCAAAAAAGCCCAGGACCAGATGGGTTTAGTGCAGAGTTTTATCAGACCTTCAAAAAAGACATAATTCCAGTAATTCTCAAACTATTCCATAAAATAGAAACGGAATGTACTCTACCCAGTTCATTCTACGAAGCCATAATTACTCTGATACCTAAACCACATAAAAAACCCATCAAAGATAGAGAACTTCAGACCAGTTTCCCTTATAATATTGATGTGAAAATACTCAATAAAATTCTCACTACCCAAATCCAAGAACACATCAAAGCAATCATCCATCATGACCACTTAGGCTTCATTCCCGGGATGGTTAAATCCACAGAAATCCATCAAGGTAATCCACTATATTAACAAACTCAAAGACAAACACCACATGATCATCTCATTAGATGCTGAGAAAGCATTTGACAAAATCCAACACACATTCATGATAAAAGTCTTGGAAAGACCAGGAATTCAAGGCCTATACCTAAACAGAATAAAAGCAATACACAGCAAACAAGTAGCCAACATCAAACGAAATATAGAGAATCTCCAAGCAATCCCACTAAAATCAGGCACTAGACAAGGCTGCCCAACGTTCTCCCTACCTATTCAATATAGTACTTGAAGTCCTAGCCAGAGCAAATAGACAACCAAAGGAGGACAAGGGAATATAAATTGGATAGGAGGAAGTCAAAATATCACTATTTGAAGATGACATGATAGTATATATAAGTGACCATAAAAATCCCACCAGAGAACTCTTAAACCTGATAAACAGCTTCAGTGAAGTAGCTAGATATAACATTAACTCAAACAAATCAATGGCCTTTCTCTACACAAGGATAAACAGGCTGAGAAAAAAATTGGAGAAACAACACCCTTCAAAATAATCACAAATAATATAAAATACCTTGGTGTGACTCTAATTGAGGAAGTGAAGATCTGTAGGATAAGAACTTCAAGTCTCTGAAGAAAGAAATCAAAGAAGATCTCAGAAGATGGAAAGATCTCCCATGATCATTGATTGGGACGATTAATATAGTAAAAATGGCTATCTTGCCAGAAAGCAATCTACAGATTCAATGAAATCTCCATCAAACTTCCAACTGAATTCTTCAACGAATTAGAAATGGCAATTTGCAAATTCATCTGGAATAACAAAAAAACCTAGGATAGCAAAACCTGTTCTCACTGATAAAATAATCTCTGGTGGAATCACCATGCCTGACCTTAAACTGTAAGACAGAGCAATTGTGATAAAAACTGCATGGTACTGGTATAGTAACAGACAGGTAGAACAATGGAATAGAATTGAAGACCCAGAAATTAACCCACACACATATGGTCACTTGATCTTTGACAAGGGAGCTAAAACCATCCAGTGGAAAAAAGGATAGCATTTTCACCAAATGGTGCTGGCACAACTGGCGGTTTTCATGTAGAAGAATGCAAATTGTTCCTTCTTATCTCCTTGTACTAAGGGAAAGTCTGAGTGTATCAAGGAATTCCACATAAAACCAGAGACACTGAAACTTATAGAGGATAAAGTGGGGAAATGCCTCGAAGATATGGGCAAAAGGGGGAAATTCCTGAATAGAACAGCAATGGCTTGTGCTGCAAGATCGAGAATCGACAAATGGGACCTCATGAAATTGCAAAGCTTATGTAAGGCAAAAGACACTGTCAACAAGACAAAAAGACCATCAACAGACTGTGAAAGGAACTTTACCAATCCTAAATCAAATAGGGGACTAATATCCAATATATATAAAGAACCCAAGAAGATGGACTCTAGAAAATCAAATAACCCCATTTAAAAAATGGGGCATAGAGCTAAACCAAGAATTCTCAACTGAAGAATATTGAATGGCTGAGAAGCACCTGAAAAAATGTTCAACATC。

in a specific comparative embodiment, other detection systems use forward primers as shown in SEQ ID NOS.9-11.

The forward primer sequence shown in SEQ ID NO. 9 specifically comprises: TCACCATGCCTGACCTTAAACTGTA, which binds to positions 2566-2590 of the sequence shown in SEQ ID NO. 8 on PG13 cell genomic DNA.

The forward primer sequence shown in SEQ ID NO. 10 specifically comprises: GGAGCTAAAACCATCCAGTGGAA which binds to the PG13 cell genomic DNA at positions 2715-2737 of the sequence shown in SEQ ID NO. 8.

The forward primer sequence shown in SEQ ID NO. 11 specifically comprises: GCAAATTGTTCCTTCTTATCTCCTTGT which binds to positions 2799-2825 of the sequence shown in SEQ ID NO. 8 on the genomic DNA of PG13 cells.

In a specific comparative embodiment, other detection systems use reverse primers as shown in SEQ ID NOS 12-18.

The reverse primer sequence shown in SEQ ID NO. 12 specifically comprises: TGTGGGTTAATTTCTGGGTCTTCA, which binds to positions 2663-2686 of the sequence shown in SEQ ID NO. 8 on PG13 cell genomic DNA.

The reverse primer sequence shown in SEQ ID NO. 13 specifically comprises: TTGTGCCAGCACCATTTGG which binds to positions 2756-2774 of the sequence shown in SEQ ID NO. 8 on PG13 cell genomic DNA.

The reverse primer sequence shown in SEQ ID NO. 14 specifically comprises: TTCACAGTCTGTTGATGGTCTTTTTG, which binds to positions 3043-3068 of the sequence shown in SEQ ID NO. 8 on the genomic DNA of PG13 cells.

The reverse primer sequence shown in SEQ ID NO. 15 specifically comprises: ACAAGGAGATAAGAAGGAACAATTTGC which binds to positions 2799-2825 of the sequence shown in SEQ ID NO. 8 on the genomic DNA of PG13 cells.

The reverse primer sequence shown in SEQ ID NO. 16 specifically comprises: TGCCCATATCTTCGAGGCATT which binds to positions 2905-2925 of the sequence shown in SEQ ID NO. 8 on the genomic DNA of PG13 cells.

The reverse primer sequence shown in SEQ ID NO. 17 specifically comprises: TTCGAGGCATTTCCCCACTT which binds to positions 2896-2915 of the sequence shown in SEQ ID NO. 8 on the genomic DNA of PG13 cells.

The reverse primer sequence shown in SEQ ID NO. 18 specifically comprises: TCATGAGGTCCCATTTGTCGAT, which binds to positions 2979-3000 of the sequence shown in SEQ ID NO. 8 on the genomic DNA of PG13 cells.

In a specific comparative embodiment, other detection systems use probes as shown in SEQ ID NOS.19-21.

The probe sequence shown in SEQ ID NO. 19 specifically comprises: FAM-CTGGTATAGTAACAGACAGGTAG-MGB, which binds to positions 2624-2646 of the sequence shown in SEQ ID NO. 8 on PG13 cell genomic DNA.

The probe sequence shown in SEQ ID NO. 20 specifically comprises: FAM-CCAAATGGTGCTGGCAC-MGB, which binds to positions 2756-2772 of the sequence shown in SEQ ID NO. 8 on PG13 cell genomic DNA.

The probe sequence shown in SEQ ID NO. 21 specifically comprises:

FAM-AGAGACACTGAAACTTATAGAGGA-MGB, which binds to positions 2870-2893 of the sequence shown in SEQ ID NO. 8 on PG13 cell genomic DNA.

The combination of primer pairs and probes resulted in several different comparison systems as shown in Table 11 below.

TABLE 11 comparison of the modes of combining the primer probes of the detection systems and the product sizes

[ Experimental procedures ]

1. Preparing standard curve samples and template-free control (NTC) samples

NTC sample: DNA dilution.

2. Preparing a PCR reaction system

Detection system 30 μl: 20. Mu.L qPCR reaction (17. Mu. L qPCR Reaction Buffer +0.06. Mu.L 100. Mu.M comparative forward primer, 0.06. Mu.L 100. Mu.M comparative reverse primer, 0.06. Mu.L 100. Mu.M comparative probe+2.82. Mu.L DNA dilution) +10. Mu.L template (standard curve sample or NTC sample).

PCR reaction procedure

PCR amplification was performed on SHENTKE-96S.

4. Data analysis and result determination data analysis: after amplification, the threshold line was 0.02, and R of the standard curve was read ² Amplification efficiency, and the detected Ct value for each sample.

[ experimental results ]

The results of the amplification performance of the comparative detection system are shown in Table 12. The amplification curves of the comparative systems 4 to 12 are shown in FIGS. 18 to 26.

Table 12 compares the amplification performance of the detection system

The results show that only system 8 in 9 groups of comparison systems designed by the target meets the requirements, and other systems have poor amplification curve forms, a back Ct value or low amplification efficiency and poor overall performance. The performance of the system provided by the invention, including linear range, specificity, quantitative limit, durability and simulated sample test, accords with the analysis method verification guiding principle in Chinese pharmacopoeia.

Claims

1.A primer pair for quantitatively detecting the size distribution of PG13 cell DNA fragments is characterized in that,

at least 3primer pairs; wherein:

2. The primer pair for quantitative detection of the size distribution of a DNA fragment of a PG13 cell according to claim 1, wherein the primer pair is selected from the following primer pairs:

3. The primer pair for quantitative detection of the size distribution of a DNA fragment of a PG13 cell according to claim 2, wherein the primer pair is selected from the following primer pairs:

4. The primer pair for quantitative detection of the size distribution of a PG13 cell DNA fragment according to claim 2 or 3,

5. A detection reagent for quantitatively detecting residual DNA of PG13 cells, which is characterized in that,

the detection reagent comprising the primer pair according to any one of claims 1 to 4;

probes are also included.

6. The detection reagent for quantitative detection of residual DNA of PG13 cells according to claim 5, wherein,

the probe is shown as SEQ ID NO. 7.

7. A detection kit for quantitatively detecting PG13 cell residual DNA is characterized in that,

comprising a primer pair according to any one of claims 1 to 4 or a detection reagent according to claims 5 to 6.

8. A quantitative detection method of PG13 cell residual DNA is characterized in that,

the method comprises the following steps: qPCR is performed on a sample to be tested using the primer set according to any one of claims 1 to 4 or the detection reagent according to claims 5 to 6 or the detection kit according to claim 7, and qPCR amplification products are detected.

9. Use of the primer set according to any one of claims 1 to 4 or the detection reagent according to claims 5 to 6 or the detection kit according to claim 7 for detecting the presence or absence of PG13 cell residual DNA and fragment size distribution thereof in a test subject.

10. The use according to claim 9 for quantitative detection of PG13 cell-residual DNA fragments in a test subject.