CN117402222A - Adeno-associated virus mutant and application thereof - Google Patents

Abstract

The invention belongs to the technical field of biological medicine, and discloses an adeno-associated virus mutant and application thereof. The AAV capsid protein mutant with low hepatic tropism comprises a sequence shown as SEQ ID No. 1; the sequence is located between the mutant amino acids 465 to 478 or 464 to 477. The recombinant adeno-associated virus vector constructed by the AAV capsid protein mutant not only greatly reduces liver tropism, but also has better muscle targeting, better safety and wide application range.

Description

Adeno-associated virus mutant and application thereof

Technical Field

The invention relates to the technical field of biological medicine, in particular to an adeno-associated virus mutant and application thereof.

Background

Adeno-associated virus (AAV) is a type of non-enveloped small virus that encapsulates a linear single-stranded DNA genome, belonging to the genus dependoviridae (Parvoviridae), and requiring helper virus (typically adenovirus) to participate in replication. AAV genomes are single-stranded DNA fragments contained in non-enveloped viral capsids and can be divided into three functional regions: two open reading frames (Rep gene, cap gene) and an Inverted Terminal Repeat (ITR). The recombinant adeno-associated virus vector (rAAV) is derived from a non-pathogenic wild adeno-associated virus, and is widely applied to gene therapy and vaccine research as a gene transfer vector due to the advantages of wide host range, non-pathogenicity, low immunogenicity, long-term stable expression of exogenous genes, good diffusion performance, stable physical properties and the like. In medical research, rAAV is used in research (including in vivo and in vitro experiments) for gene therapy of various diseases, such as gene function research, construction of disease models, preparation of gene knockout mice, and the like.

In recent years, gene therapy has become a novel approach to the treatment of muscle and meat diseases, wherein AAV has been widely used as an effective gene vector. Taking Dunaliella Muscular Dystrophy (DMD) as an example, one occurs in every 3500-5000 men worldwide. DMD is caused by alterations or mutations in the gene encoding the dystrophin protein. Symptoms of DMD often experience developmental delays such as difficulty walking, climbing stairs, or standing from a seated position. SRP-9001 utilizes the MHCK7 promoter in combination with AAVrh74 vector to deliver a mini-dystrophin transgene, a functional protein lacking by DMD patients. 22, 2023, 6, sarepta Therapeutics announced that its AAV gene therapy Delandistrogene moxeparvovec (SRP-9001) was FDA approved for the treatment of Du's Muscular Dystrophy (DMD), under the trade name Elevidinys. The product has good therapeutic effect, and can remarkably improve muscle function of patients. While current AAV therapies exhibit great potential for advantage, the development and use of this technology is limited by the inclusion of pre-existing neutralizing antibodies, the occurrence of hepatotoxicity problems caused by large doses, and the high cost of treatment.

In summary, based on the advantages and disadvantages of current AAV vectors, how to rapidly obtain AAV vectors with good targeting function and low side effects is an important research direction. In the prior art, the application of off-the-shelf AAV serotype types and targeting peptides with known functions for different combinations is a rapid scheme, but early studies found that simple insertion often resulted in weakening or even losing the targeting ability of the functional peptide, and that some characteristics of the original carrier backbone may result in "non-specific" targeting, such as retention of hepatic tropism. Therefore, there is a need to develop new serotypes that can enhance the specificity and reduce toxicity, particularly liver tropism, while maintaining the targeting of functional peptides in an effort to provide better, clinically useful drug delivery vehicles for a wide range of patients.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provide an adeno-associated virus mutant with low liver tropism and better target specificity and application thereof.

In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:

in a first aspect, the invention provides an AAV capsid protein mutant of low hepatic tropism comprising the sequence shown in SEQ ID No. 1; the sequence is located between the mutant amino acids 465 to 478 or 464 to 477.

The AAV capsid protein mutant of the present invention has low hepatic tropism and further improves muscle targeting. mRNA levels were reduced 49-fold and 3.77-fold in the liver, respectively, and there was a different degree of elevation in both mRNA and protein levels in the targeting of different types of muscle (quadriceps, biceps brachii, abdominal).

As a preferred embodiment of the AAV capsid protein mutant according to the present invention, comprising the sequence shown in SEQ ID No. 2; said sequence is located between said mutant amino acids 448 to 478; or (b)

A sequence as shown in SEQ ID No. 3; the sequence is located between the mutant amino acids 448 to 477.

As a preferred embodiment of the AAV capsid protein mutant of the present invention, the amino acid sequence is shown in SEQ ID No.5 or the amino acid sequence is shown in SEQ ID No. 7.

In a second aspect, the invention provides an AAV capsid protein mutant having an amino acid sequence as set forth in any one of SEQ ID No.4, SEQ ID No.6, and SEQ ID No. 8.

In a third aspect, the invention provides a recombinant adeno-associated virus comprising an AAV capsid protein mutant as described above.

The recombinant adeno-associated virus vector constructed by the AAV capsid protein mutant not only greatly reduces liver tropism, but also has better muscle targeting, better safety and wide application range.

As a preferred embodiment of the recombinant adeno-associated virus of the invention, a heterologous gene of interest is also included.

Preferably, the heterologous gene of interest encodes any one of the gene products interfering with RNA, aptamer, endonuclease, guide RNA.

In a fourth aspect, the invention provides a nucleic acid encoding an AAV capsid protein mutant having a nucleotide sequence as set forth in any one of SEQ ID No. 9-SEQ ID No. 13.

In a fifth aspect, the present invention provides use of the AAV capsid protein mutant, the recombinant adeno-associated virus, the nucleic acid in any of the following fields:

i. preparing a medicament for delivering the gene product to the muscle and/or heart of a subject;

ii. Preparing an in vivo muscle and/or heart targeting delivery tool;

iii, preparing a delivery medicament for treating muscle and/or heart diseases.

Preferably, the muscle disorders include muscular dystrophy, myasthenia gravis, polymyositis and dermatomyositis, rhabdomyolysis; the heart diseases include myocardial infarction, myocardial ischemia injury, coronary heart disease, cardiac hypertrophy and cardiac fibrosis.

Compared with the prior art, the invention has the beneficial effects that:

the AAV capsid protein mutant has obvious liver tropism reducing function, has great effect in improving different targeting specificities of AAV, for example, can obviously reduce liver tropism while improving muscle targeting after inserting RGD peptide, has better specificity, can avoid potential clinical application risks, particularly the problem of liver toxicity caused by overdose, provides better gene therapy tools for patients or scientific researchers, and has great social and economic benefits.

Drawings

FIG. 1 is a graph of tissue tropism profiles of different serotypes observed in vivo imaging;

FIG. 2 is a liver tropism analysis (3 weeks) of mice for different serotypes;

FIG. 3 is an analysis of the muscle (quadriceps femoris) targeting of mice for different serotypes (3 weeks);

FIG. 4 is an analysis of the muscle (biceps brachii) targeting of mice by different serotypes (3 weeks);

FIG. 5 is an analysis of muscle (abdominal) targeting of mice by different serotypes (3 weeks);

FIG. 6 is a cardiac targeting analysis of mice for different serotypes (3 weeks);

FIG. 7 is a brain and lung targeting analysis (3 weeks) of mice for different serotypes.

Detailed Description

For a better description of the objects, technical solutions and advantages of the present invention, the present invention will be further described with reference to the following specific examples. It will be appreciated by persons skilled in the art that the specific embodiments described herein are for purposes of illustration only and are not intended to be limiting.

The test methods used in the examples are conventional methods unless otherwise specified; the materials, reagents and the like used, unless otherwise specified, are all commercially available.

AAV DJ sequences are described in the scientific literature In vitro and in vivo gene therapy vector evolution via multispecies interbreeding and retargeting of adeno-associated viruses.

MyoAAV 4A sequence is described in the scientific literature Directed evolution of a family of AAV capsid variants enabling potent muscle-directed gene delivery across species.

Example 1: AAV mutant design, construction and virus production

(1) Design of AAV mutants

Based on structural analysis, the potential sites are replaced by a fragment replacement method, so that hepatic tropism is reduced, and the targeting of muscles is improved. Mutants 2,3,4,5 were designed by combining different region fragments and tested in comparison with mutants 1, AAV9, AAV DJ and MyoAAV 4A, which had been directly inserted with RGD peptide (Arg arginine-Gly glycine-Asp aspartic acid). The segment designs of the other mutants compared to mutant 1 (direct insertion of RGD peptide) are shown in table 1:

TABLE 1 segment design of mutants

Remarks: the amino acid positions of the table are positioned in VP1 according to the construction of the complete capsid protein VP 1; mutant 2 segment 1 and segment 2 are both derived from AAV2; mutant 3 segment 1 is derived from AAV2, segment 2 retains AAV DJ source sequences; mutant 4 segment 1 is derived from AAV9 and segment 2 is derived from AAV2; mutant 4 segment 1 was derived from AAV9, segment 2 retained the AAV DJ source sequence; the segment 1 sequences of the mutants 2,3,4 and 5 correspond to the replacement of the segment 1 sequences in AAV DJ or mutant 1, and the segment 2 sequences of the mutants 2,3,4 and 5 correspond to the replacement of the segment 2 sequences in AAV DJ or mutant 1. The amino acid sequences of the mutants 1-5 VP1 are sequentially shown as SEQ ID No. 4-8. The nucleotide sequences of the mutants 1-5 VP1 are sequentially shown as SEQ ID No. 9-13.

(2) Construction of mutant serotype vector and plasmid extraction

The Rep-CAP plasmid is digested with SmiI and BshTI, gel electrophoresis is carried out, and a fragment band of about 5000bp is cut off for gel recovery, so that the digested skeleton fragment is obtained.

According to the Cap sequence of the mutant 1, the following primers are designed, and the specific steps are as follows: amplifying and gel-recovering the AAV DJ Rep-CAP plasmid as a template by using a CAP-f+YJ125-R primer to obtain a target product mutant 1 product-1, and amplifying and gel-recovering the AAV DJ Rep-CAP plasmid as a template by using a YJ125-F+cap-R primer to obtain a target product mutant 1 product-2. The Rep-CAP plasmid of the mutant 1 can be constructed by mixing the framework fragments and the mutant 1 products-1 and-2 in the following steps and proportions;

according to the Cap sequence of the mutant 2, the following primers are designed, and the specific steps are as follows: the method comprises the steps of using a Rep-CAP plasmid of AAV DJ as a template to amplify and glue with a Cap-f+YJ121-R primer to obtain a target product mutant 2 product-1, using a Rep-CAP plasmid of AAV DJ as a template to amplify and glue with a YJ121-F+J125-R primer to obtain a target product mutant 2 product-2, and using a Rep-CAP plasmid of AAV DJ as a template to amplify and glue with a YJ125-F+cap-R primer to obtain a target product mutant 2 product-3. The Rep-CAP plasmid of the mutant 2 can be constructed by mixing the framework fragments and the products-1, -2 and-3 of the mutant 2 in the following steps and proportions;

according to the Cap sequence of the mutant 3, the following primers are designed, and the specific steps are as follows: the Rep-CAP plasmid of AAV DJ is used as a template to amplify and glue the primer of Cap-f+YJ122-R to obtain a target product mutant 3 product-1, the Rep-CAP plasmid of AAV DJ is used as the template to amplify and glue the primer of YJ122-F+YJ125-R to obtain a target product mutant 3 product-2, and the Rep-CAP plasmid of AAV DJ is used as the template to amplify and glue the primer of YJ125-F+cap-R to obtain the target product mutant 3 product-3. The Rep-CAP plasmid of the mutant 3 can be constructed by mixing the framework fragments and the mutant 3 products-1, -2 and-3 in the following steps and proportions;

according to the Cap sequence of the mutant 4, the following primers are designed, and the specific steps are as follows: the Rep-CAP plasmid of AAV DJ is used as a template to amplify and glue the primer of Cap-f+YJ123-R to obtain a target product mutant 4 product-1, the Rep-CAP plasmid of AAV DJ is used as the template to amplify and glue the primer of YJ123-F+YJ125-R to obtain a target product mutant 4 product-2, and the Rep-CAP plasmid of AAV DJ is used as the template to amplify and glue the primer of YJ125-F+cap-R to obtain a target product mutant 4 product-3. The Rep-CAP plasmid of the mutant 4 can be constructed by mixing the framework fragments and the mutant 4 products-1, -2 and-3 in the following steps and proportions;

according to the Cap sequence of the mutant 5, the following primers are designed, and the specific steps are as follows: the Rep-CAP plasmid of AAV DJ is used as a template to amplify and glue the primer of Cap-f+YJ124-R to obtain a target product mutant 5 product-1, the Rep-CAP plasmid of AAV DJ is used as the template to amplify and glue the primer of YJ124-F+YJ125-R to obtain a target product mutant 5 product-2, and the Rep-CAP plasmid of AAV DJ is used as the template to amplify and glue the primer of YJ125-F+cap-R to obtain a target product mutant 5 product-3. The Rep-CAP plasmid of the mutant 5 can be constructed by mixing the framework fragments and the mutant 5 products-1, -2 and-3 in the following steps and proportions;

the primers involved in the construction of the Rep-CAP vectors for AAV capsid protein mutants 1-5 are shown in Table 2:

TABLE 2 primer sequences

The framework and the fragments have homologous arm sequences, and the fragments can be assembled into a complete vector through Gisbon in a multi-fragment manner. Taking 1 clean 200uL PCR tube as a mark and placing the mark on an ice box, and cutting the enzyme-cleaved skeleton and each target fragment according to the skeleton: preparing a reaction solution with the fragment molar ratio of 1:3, and carrying out recombination connection in a PCR instrument at 50 ℃ for 30 min. Thawing 50 mu L of competent cells on ice, mixing 10 mu L of the ligation product with DH5 alpha competent cells, and standing on ice for 20-30 min; heat shock at 42 ℃ for 45 seconds; rapidly placing on ice for 2 minutes, adding 400 mu L of recovery SOC culture medium (without antibiotics), and culturing at 37 ℃ for 1h at 200 rpm; the mixture was spread on Amp-resistant plates (50. Mu.g/ml) and incubated at 37℃for 14 hours. Monoclonal bacteria were selected and grown in 4ml of liquid LB medium (Amp+ resistant) for 14 hours at 37 ℃.

Centrifuging the bacterial liquid for 1 minute at 12000rpm, and pouring out the supernatant culture medium; adding 250 mu L of buffer P1/RNaseA mixed solution, and high-speed vortex to re-suspend bacteria; adding 250 μL buffer P2, and reversing upside down for 8-10 times; adding 350 mu L buffer P3, immediately reversing and uniformly mixing for 8-10 times to thoroughly neutralize the solution; centrifuging at 13000rpm for 10min, and collecting supernatant; centrifuging 12000 for 1 minute, pouring out the waste liquid, adding 500 mu L PW1, centrifuging 12000 for 1 minute, and pouring out the waste liquid; 600 μl of PW2 was added, 12000 centrifuged for 1min, and the supernatant was decanted; 600 μl of PW2 was added, 12000 centrifuged for 1min, and the supernatant was decanted; idle at 12000rpm for 2 minutes; 30-50 mu L of the preheated eluent at 55 ℃ is added, and the mixture is kept stand for 2 minutes and centrifuged at 12000rpm for 1 minute. Concentration detection was performed using a micro nucleic acid quantitative instrument.

The obtained plasmid is subjected to concentration detection, 10 mu L of positive plasmid identified by enzyme digestion is taken and sequenced, and the positive plasmid is stored at-20 ℃. Sequencing results showed that the obtained plasmid was able to encode the variant capsid protein VP1. Finally, relevant Helper plasmids were extracted according to the amount of virus required for the post-test, and each group of Rep-Cap plasmids (AAV 9, AAV DJ, myoAAV 4A and mutants of the invention) plasmids and GOI plasmids (ssAAV. CAG. Fluc-2a-eGFP. WPRE. SV40 pA).

(3) Packaging and purification of mutant serotype viruses

Rep-Cap plasmids of each group (AAV 9, AAV DJ, myoAAV 4A and AAV mutants of the invention), plasmids expressing firefly luciferase (Fluc) and green fluorescent protein (EGFP), pHelper plasmids were co-transferred in HEK-293T cells in appropriate amounts, AAV virus was purified by ultra-high speed centrifugation using iodixanol gradient, and virus titers were measured to be appropriate titers at 1E+11GC/mL-1E+13GC/mL and placed at-80℃for use.

Example 2 comparative testing of various indicators of mutant serotypes

(1) Injection and dissection of animals

Mouse experiment: balb/C male mice with the age of 6-8 weeks are used for experiments, related viruses are prepared according to designed experimental groups and control groups, each group is injected with 2E11GC virus, living body imaging is respectively carried out at 2 weeks and 3 weeks, animal dissection and organ material taking are carried out after 3 weeks of injection, liquid nitrogen quick freezing is carried out immediately after sample material taking, and the liquid nitrogen quick freezing is respectively used for subsequent experiments such as RNA extraction, WB detection and the like.

(2) Living body imaging

Mice were weighed prior to imaging, and an animal living imaging system (AniView 100, of the biological technology limited of eglut, guangzhou) was started and a small animal anesthesia system was commissioned. Setting an image storage path, shooting parameters and other information. Each mouse was injected intraperitoneally with luciferin (15 mg/ml, promega, E1605) at a dose of 150mg/kg, i.e., 10uL/g, and imaging was started 10min after each group injection. Shooting of each batch of mice is completed sequentially according to the sequence of lying on the back, lying on the left side, lying on the prone position and lying on the right side. After shooting is completed, the mice are put back into the mouse cage to wait for anesthesia, and whether the states of the mice are abnormal or not is observed.

(3) Detection of mRNA expression level of target Gene

1) Tissue total RNA extraction and reverse transcription

Grinding of the sample: pre-cooling the grinder 10min in advance and setting grinding parameters. The animal tissue samples stored in-80℃refrigerator were removed, about 50-100mg of tissue was cut into Huang Douli pieces in sterile petri dishes, and transferred to 1.5ml RNase-free EP tubes. Per 50-100mg tissue: proper amount of TransZol Up is added in the proportion of 1ml of TransZol Up, then two clean and sterile 3mm grinding steel balls are added, and a sealing film is wound. The sample was placed in a 24-well grind adapter and trimmed, the screw was tightened, and the cap closing button was pressed. And starting a grinding program, taking out the sample after the operation of the instrument is finished, and observing the grinding granularity of the sample, wherein the subsequent extraction operation can be performed if no massive tissue residue exists. The milled sample was centrifuged at 12,000Xg for 2min at 4℃and the supernatant was pipetted into a new 1.5ml RNase-free EP tube with corresponding labeling.

Extraction of total RNA of a sample: specific reference is made to the TransZol Up Plus RNA Kit (Beijing full gold, cat# ER 501) specification. 1ml of tranZol up is added with 0.2. 0.2ml RNA Extraction Agent and vigorously vibrated for 5min;12,000Xg, centrifuged at 4℃for 10min. At this time, the sample was divided into three layers, the colorless aqueous phase was transferred to a new 1.5ml RNase-free EP tube, and an equal volume of absolute ethanol (precipitation may occur at this time) was added, and mixed by gently inverting; adding the obtained solution and the precipitate into a centrifugal column, centrifuging at room temperature for 30s at 12,000Xg, and discarding the filtrate; adding 500 mu L of CB9, centrifuging at 12,000Xg for 30s at room temperature, and discarding the filtrate; repeating the previous steps for one time; 500. Mu.L WB9 was added, centrifuged at 12,000Xg for 30s at room temperature, and the filtrate was discarded; repeating the previous steps for one time; centrifuging for 2min at room temperature of 12,000Xg to thoroughly remove residual ethanol; placing the centrifugal column into a 1.5ml RNase-free EP tube, adding 30-50 μl (depending on tissue size) of RNase-free Water at the center of the centrifugal column, and standing at room temperature for 1min; centrifuging at room temperature for 1min at 12,000Xg, eluting RNA;

sample nucleic acid concentration determination by detecting RNA concentration using a micro-nucleic acid quantitative instrument detector, recording the concentration, OD260/280, OD260/230, and storing RNA at-80 ℃.

Reverse transcription: use of RNA samples from each groupAll-in-One First-Strand cDNA Synthesis SuperMix for qPCR (One-Step gDNA Removal) (Beijing full gold, cat# AE 341-03), specific steps of which are referred to the specification.

2) Quantitative PCR (qPCR) experiment

The qPCR system was prepared using each of the above DNA or cDNA groups as a template according to the instructions of 2x SYBR Green qPCR Master Mix (Bimake, cat# B21203):

TABLE 3 qPCR System

Reagent(s)	Usage amount
		2x SYBR Green qPCR Master Mix	10ul
Template (DNA or cDNA)	1.5ul
		Upstream primer (10. Mu.M)	1ul
Downstream primer (10. Mu.M)	1ul
		ROX Reference Dye	0.4ul
Deionized water	Up to 20ul

TABLE 4 primer sequences

Primer name	Primer sequences (5')>3’)
		Fluc2-qPCR-F1	AACCAGCGCCATTCTGATCA
Fluc2-qPCR-R1	TCGGGGTTGTTAACGTAGCC
		GAPDH-F2	CAGGAGAGTGTTTCCTCGTCC
GAPDH-R2	TTCCCATTCTCGGCCTTGAC

Table 5 qPCR program settings

3) Data analysis

And calculating the relative expression according to the Ct value of each group and the formula 2-delta Ct.

4) Detection of expression level of target protein by WB

Sample pretreatment, namely shearing tissues into tiny fragments, weighing and recording the fragments, placing the fragments into a 1.5ml or 2ml centrifuge tube, marking the tube, cooling the tube at the temperature of-80 ℃ for standby, and precooling a freezing and grinding instrument; lysates of RIPA (bi yun, P0013B) were dissolved (PMSF was added to a final PMSF concentration of 1mM during the minutes prior to use);

the complete lysate is added according to the proportion of 150-250 mu L of lysate added into each 20mg of tissue, then two sterilized zirconia grinding beads are added, and the samples (brain, spinal cord and other tissue samples: temperature-20 ℃, frequency 70Hz, time for shaking 50s for 10s, circulation 3-4 times, muscle, liver and other samples: temperature-20 ℃, frequency 70Hz, time for shaking 50s for 10s,5-7 times) are directly ground in the lysate. After the sample is ground, centrifuging the sample in a refrigerated centrifuge at 4 ℃ and 12,000Xg for 5-10min, and transferring the supernatant to a new sterilized EP tube for preservation at-20 ℃ or-80 ℃;

protein concentration determination: after protein concentration was measured by the method in the modified BCA protein concentration measurement kit (Producer, cat. No. C503051), an appropriate amount of protein homogenate was taken according to the required amount, and mixed with a corresponding amount of 5X SDS-PAGE protein loading buffer, and the mixture was boiled in water for 10min, cooled, centrifuged at a low speed for a moment, and then loaded.

WB (Western Blot) detection:

SDS-PAGE electrophoresis: the proper loading amount is determined according to the protein concentration and the expression level, the loading amount of the tissue homogenate protein is less than 20 mu L/hole, the loading amount of the tissue homogenate protein is about 20-50 mu g, and the specific operation flow of electrophoresis is as follows: pulling out the comb on the prefabricated gel, mounting the gel on the electrophoresis tank, adding electrophoresis buffer solution into the inner tank and the outer tank, adding newly prepared buffer solution into the inner tank, detecting leakage, and adding electrophoresis buffer solution into the outer tank if no leakage exists; and (3) taking a proper amount of treated protein samples for loading, and carrying out 100V constant-pressure electrophoresis on a space energy electrophoresis device by taking pre-dyed standard proteins as references, wherein the electrophoresis time is 100min until bromophenol blue reaches the bottom of the gel. Closing the power supply, carefully removing the prefabricated rubber plate, taking down the gel, and placing the gel in a film transfer buffer solution to wait for subsequent operation;

transferring: 6 filter papers and 1 PVDF membrane were cut according to the glue area. Soaking PVDF membrane in methanol for 5-10sec, transferring to membrane transfer buffer solution for 5min, and pre-wetting filter paper in the membrane transfer buffer solution; and (3) installing and transferring the device: negative electrode (blackboard) -sponge-3 layer wetted filter paper-gel-PVDF film-3 layer wetted filter paper-sponge-positive electrode (transparent plate). Each layer of bubbles are driven away to avoid affecting the transfer effect, the support is clamped, and the support is placed into the electrotransport groove; transferring the film for 100min by using a constant-pressure ice bath with the voltage of 100V; judging whether the membrane transfer is successful or not according to whether the pre-dyed protein molecular weight standard strip is completely transferred to the PVDF membrane or not; soaking the transferred PVDF film in PBST solution, washing for 5min at room temperature, and cutting the PVDF film according to the requirement, wherein the PVDF film is not dried in the film cutting process;

blocking and antibody incubation: incubating the PVDF membrane with a blocking solution (5% nonfat milk powder) at room temperature for 2h or overnight at 4deg.C; transferring the blocked PVDF membrane into primary hybridization resisting solution (Luciferase Rabbit Polyclonal antibody (Proteintech, 27986-1-AP) according to 1:2000;GADPH Rabbit Polyclonal antibody (Proteintech, 10494-1-AP) according to 1:2000;Rabbit GFP tag Polyclonal antibody (Proteintech, 50430-2-AP) according to 1:2000, and adding into 4ml QuickBlock respectively ^TM The Western primary antibody dilution (Biyun Tian, P0256) is prepared into primary antibody hybridization solution, and incubated for 1h or overnight at 4 ℃ at room temperature, and then PBST is used for washing membranes for 3X 5min; transferring the washed PVDF membrane into a secondary antibody hybridization solution (HRP-conjugated Affinipure Goat Anti-Rabbit Ig)G (H+L) (Proteintech, SA 00001-2) was added to 4ml QuickBlock at 1:5000 ^TM The Western secondary antibody diluent (Biyundian, P0258) is prepared into secondary antibody hybridization solution, and incubated for 1h at room temperature, and PBST is used for washing membranes for 3X 5min;

color development: mixing the A solution and the B solution of the ECL chemiluminescence kit in equal volume, and after shaking and mixing uniformly, dripping the luminescent liquid on the PVDF film to ensure that the PVDF film is covered with the luminescent liquid, adjusting different exposure time to ensure that protein strips are clear, and photographing by an instrument.

In order to circumvent the risk of pre-existing antibodies and to develop serotypes of vectors of various characteristics for use by patients, the use of a method of targeting peptide "grafting" is a relatively simple and rapid strategy. However, the method of inserting known functional targeting peptides may result in reduced or even lost targeting or altered overall specificity due to factors such as altered peptide structure, serotype differences, etc. The above examples are intended to achieve better muscle targeting by inserting known RGD targeting peptides into AAV DJ. However, it was found in experiments that simple insertion of RGD targeting peptide into AAV DJ not only reduced muscle targeting, but it still had higher liver tropism. Therefore, the invention finds out a potential section for inducing hepatophilia through structural analysis, and develops a mutant serotype with good specificity by utilizing a technical scheme of amino acid section substitution of different serotypes and combining with a method of in-vivo experiments of mice.

In mouse experiments, the designed serotypes mutant 2 and mutant 4 have the characteristics of significantly reducing hepatic tropism and improving muscle targeting. The tissue tropism distribution of each serotype can be intuitively seen from the in vivo imaging results of fig. 1, whether the mutant 1 directly inserted with RGD peptide or the designed mutants 3 and 5 have certain muscle targeting ability, but all have stronger hepatic tropism, while the designed mutants 2 and 4 greatly reduce hepatic tropism and improve muscle targeting to a certain extent. From the detection results of the molecular experiments (as shown in fig. 2), compared with the mutant 1 directly inserted with RGD peptide, the mRNA levels of the mutant 2 and the mutant 4 which are designed and optimized are respectively reduced by 49 times and 3.77 times in the liver, and the protein levels are also reduced at a significant level. The mRNA and protein levels of mutant 3 were slightly higher than those of mutant 1 and AAV DJ, and the mRNA and protein levels of mutant 5 were different from each other, and the mechanism was not clear. The segment substitution results of the various mutants are combined, which shows that the substitution of the S465-QGGPNTMANQAK-N478 sequence in the segment 2 is the core for reducing the hepatic tropism of the AAV DJ skeleton, and the segment 1 sequence also affects the final effect to different degrees.

In a further embodiment, the insertion of a polypeptide comprising an RGD motif is used to confer muscle targeting ability to the mutant serotypes, and the extent to which different mutants target the muscles at each site (quadriceps, biceps brachii, abdominal) as well as the heart is observed. As shown in FIG. 3, mutant 2 and mutant 4 were stronger in mRNA and protein levels than mutant 1, and protein expression levels were closer to MyoAAV 4A (AAV 9 backbone with the same RGD peptide inserted). Mutants 3 and 5 showed higher mRNA than mutant 1, but the protein level was similar to that of mutant 1. For biceps brachii (fig. 4), mutant 2 and mutant 4 were significantly stronger than mutant 1, mutant 3 and mutant 5, and the mRNA of mutant 2 and mutant 4 was 3.22-fold and 6.97-fold, respectively, of mutant 1, with protein levels even better than MyoAAV 4A. For the abdominal muscles (fig. 5), the highest protein level is still mutant 2 and mutant 4, and the result of the 3 muscles is combined, which shows that the mutant 2 and the mutant 4 designed and optimized by the invention can reduce hepatic tropism and strengthen the targeting effect, thereby improving the specificity of serotypes as a whole. For the heart (fig. 6), although mutant 2 was about 1.78 times higher in mRNA level than mutant 1, the protein level was slightly lower than mutant 1 instead.

In addition, mRNA levels were tested on brain and lung to initially observe additional characteristics of serotypes. From the results (FIG. 7), mutant 2mRNA was lowest in the brain, while mutant 4 was slightly higher than the other mutants. In the lung, the optimized mutants 2,3,4 and 5 are lower than the mutant 1, wherein the mutants 2 and 4 are still the lowest, which indicates that the design of the mutants not only reduces hepatic tropism, but also has different weakening effects on lung organ functions, and further enhances the specificity in vivo.

In conclusion, the invention discovers potential hepatic philic sites of the original serotypes by a structural analysis method, and then uses fragment replacement technologies of different serotypes to verify by using experimental animal technical means, so that new serotype mutants capable of reducing hepatic philic are obtained, and have excellent specificity in vivo. Through a simple targeted peptide insertion method, the mutant skeleton can be grafted quickly, so that different serotypes of variants can be obtained quickly under the condition that large-scale screening is not needed, and the pre-existing antibodies in a human body are avoided or different applications are further developed according to skeleton characteristics. The invention utilizes the polypeptide containing RGD motif to demonstrate the muscle targeting specificity of the mutant, and the design method can effectively reduce hepatic tropism of original frameworks, strengthen the targeting effect of muscles, avoid the problem of liver toxicity in clinical application, reduce the dosage required by muscle targeting, provide a stronger carrier for effective application of gene therapy in clinic, and provide new ideas for serotype transformation and application.

Finally, it should be noted that the above embodiments are only for illustrating the technical solution of the present invention and not for limiting the scope of the present invention, and although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that the technical solution of the present invention may be modified or substituted equally without departing from the spirit and scope of the technical solution of the present invention.

Claims (10)

1. An AAV capsid protein mutant with low hepatic tropism, which is characterized by comprising a sequence shown as SEQ ID No. 1; the sequence is located between the mutant amino acids 465 to 478 or 464 to 477.

2. The AAV capsid protein mutant according to claim 1, comprising a sequence as shown in SEQ ID No. 2; said sequence is located between said mutant amino acids 448 to 478; or (b)

A sequence as shown in SEQ ID No. 3; the sequence is located between the mutant amino acids 448 to 477.

3. The AAV capsid protein mutant according to claim 2, wherein the amino acid sequence is shown in SEQ ID No. 5.

4. The AAV capsid protein mutant according to claim 2, wherein the amino acid sequence is shown in SEQ ID No. 7.

5. An AAV capsid protein mutant, characterized in that the amino acid sequence is shown in any one of SEQ ID No.4, SEQ ID No.6 and SEQ ID No. 8.

6. A recombinant adeno-associated virus comprising an AAV capsid protein mutant according to any one of claims 1 to 4.

7. The recombinant adeno-associated virus of claim 6, further comprising a heterologous gene of interest.

8. The recombinant adeno-associated virus of claim 7, wherein the heterologous gene of interest encodes any one of a gene product of interfering RNA, an aptamer, an endonuclease, and a guide RNA.

9. A nucleic acid for coding AAV capsid protein mutant is characterized in that the nucleotide sequence is shown in any one of SEQ ID No. 9-SEQ ID No. 13.

10. Use of the AAV capsid protein mutant of any one of claims 1-5, the recombinant adeno-associated virus of any one of claims 6-8, the nucleic acid of claim 9 in any one of the following fields:

i. preparing a medicament for delivering the gene product to the muscle and/or heart of a subject;

ii. Preparing an in vivo muscle and/or heart targeting delivery tool;

iii, preparing a delivery medicament for treating muscle and/or heart diseases.