CN117384853A

CN117384853A - Universal cell for expressing PVR and preparation method thereof

Info

Publication number: CN117384853A
Application number: CN202310846839.6A
Authority: CN
Inventors: 请求不公布姓名
Original assignee: Shize Biomedical Suzhou Co ltd
Current assignee: Shize Biomedical Suzhou Co ltd
Priority date: 2022-07-11
Filing date: 2023-07-11
Publication date: 2024-01-12

Abstract

The invention discloses a universal cell for expressing PVR, a preparation method and application thereof. After the major histocompatibility complex MHC-I and class II genes are inactivated in the cells, PVR protein is overexpressed, and the obtained human pluripotent stem cells or human cell lines or human induced pluripotent stem cells can further escape the killing of NK cells on the basis of escaping T cell attack. While these low-immunogenicity pluripotent stem cells retain their stem and differentiation capabilities.

Description

Universal cell for expressing PVR and preparation method thereof

Cross Reference to Related Applications

The present application claims priority and benefit from the chinese invention patent application No. 202210813508.8 filed 7-11-2022, the entire contents of which are incorporated herein by reference.

Technical Field

The invention belongs to the crossing field of genetic engineering and stem cell technology, and in particular relates to a universal cell for expressing PVR and a preparation method thereof.

Background

By in vitro culture of cells or induced differentiation of stem cells, healthy functional cells can be regenerated in large numbers in vitro, diseases can be treated by allogeneic functional cell transplantation, but immune incompatibility and immune rejection suffered by transplanted cells remain a key obstacle for clinical application. Stem cells are a type of "seed" cells having self-renewal capacity and differentiation capacity into specific functional somatic cells, and are mainly classified into: totipotent stem cells (Totipotent stem cells), pluripotent stem cells (Pluripotent stem cells, PSCs), and Adult stem cells (add stem cells). Human embryonic stem cells (hESCs) and Induced Pluripotent Stem Cells (iPSCs) have the potential of unlimited proliferation, self-renewal and differentiation into various types of cells, and have important application prospects in the treatment of cancers, nerve-related diseases, cardiovascular diseases and the like.

Transplantation autologous cell therapy can avoid the problem of immune rejection, but the cost of manufacturing autologous cells from patients is high and the preparation process cycle is long (Khera et al 2013), and the quality and effectiveness of individual-derived cell products is uncertain. There are data indicating that the presence of cells in the patient's body is different from normal persons and that the therapeutic effect may be affected.

Immunogenicity can be reduced by immunosuppressive drugs, HLA matching, and gene editing, or rejection of allograft cells by the host immune system can be reduced. Immunosuppressant drugs have large side effects, which can lead to bone marrow suppression, hepatotoxicity, alopecia and gastrointestinal adverse reactions. Currently, HLA-matched iPSC libraries are established in the united states, japan, and china, but high costs are required for library construction and maintenance, because the gene of HLA antigen is the most polymorphic gene observed in the human genome. The iPSC library in each place currently cannot provide a match for most people in the respective country, and only a specific group of people (Solomon et al 2015;Turner et al, 2013) is covered. Allogeneic cell therapy for large patient populations may have significant economic and construction and operating costs relative to ligand libraries, but allogeneic cell therapy is subject to strong immune rejection. Thus, it is urgent to construct alloimmune compatible universal PSCs.

The Major Histocompatibility Complex (MHC), human Leukocyte Antigen (HLA), is the leading cause of immune incompatibility. HLA complexes consist of a range of genes, which can be classified into class I, class II and class III. MHC-I genes are expressed in almost all tissue cell types, and transplanted cells expressing "non-hexon" MHC-I molecules will stimulate activation of CD8+ T cells to be eliminated. Cd4+ helper T cells recognize MHC-II genes from "nonhexon" cells, thus undergoing immune rejection, while class III molecules are not involved in immune activity. The use of gene editing methods to alter immunogenic elements to produce low immunogenic cells enables large scale manufacture of "off-the-shell" cell therapy products with immunity.

In recent years, the deletion expression of genes on the surfaces or in the self bodies of MHC-I and MHC-II cells is realized by knocking out genes such as B2M, CIITA, so that the cells have immune tolerance or escape T/B cell specific immune response, and immune compatible universal PSCs are generated, thereby laying an important foundation for wider universal PSCs source cells, tissues and organs. However, HLA molecules are the primary inhibitory ligands for natural killer cells (NK cells), and MHC-class I negative cells are susceptible to Natural Killer (NK) cell lysis. In vivo and in vitro data both show that host NK cells can eliminate implanted B2M ^-/- Donor cells (Flahou et al, 2021). Thus, there is a need to improve upon previous methods to create a solution that can be avoidedUniversal donor cells for immune responses.

The human immune system recognizes and attacks non-self antigens, thus combating infection. Thus, during allogeneic organ transplantation, the immune system may attack the transplanted organ, resulting in immune rejection and failure of the transplantation. While embryos and placenta are semi-allografts, similar to transplanted organs, they can induce maternal tolerance and do not produce a strong immune response. Placenta-high-expressing HLA-G regulates maternal-fetal tolerance by interacting with decidua natural killer cells, while CD47 high expression was also detected in the placenta (Liu et al, 2021; than et al, 2019). On the other hand, tumor cell escape immune surveillance is well known, which reduces antigen presentation by reducing HLA expression, thereby preventing their recognition by immune cells; and increased expression of immunosuppressive components such as HLA-G, PD-L1 and CTLA-4, et al de Charette and Houot, 2018).

Several studies have explored the relationship between maternal-fetal immune tolerance, tumor immune escape and organ transplantation. It has been reported that mimicking maternal tolerance and tumor escape mechanisms, cells express non-classical HLA-class I molecules such as HLAG or immunosuppressive checkpoint proteins such as PD-L1, CTLA4-Ig, CD47, CD24, etc., on the basis of disrupting MHC-I and MHC-II gene expression, and exhibit a certain immune tolerance protection to NK cells (Zhao, W.et al 2020; ye, Q.et al 2020).

However, these protocols exist for direct application based solely on common sense of knowledge in the art, while immune escape and tolerance are mostly dependent on immunosuppressive receptor-ligand binding, and have specific microenvironments at the tumor status or maternal-fetal interface. Direct application of hypo-immune factors across fields to allograft presents uncertainty, whether paired receptors or ligands are present on transplanted cells and immune cells, whether the transplantation environment satisfies escape conditions? What is in the pregnant mother may be different from the state at the time of organ transplantation. Therefore, the prior art has the technical problems of incomplete immune compatibility, ambiguity or lack of durability, narrow effective dosage window and the like. And so far, the potential molecular mechanisms of maternal-fetal immune tolerance and tumor escape are still continually being explored, and the new genes which are continuously discovered can further develop cells with low immunogenicity. This suggests that more new molecules need to be screened to achieve more optimal engineered stem cells to achieve a more optimal immune-sparing regimen.

Reference is made to:

De Charette,M.,and Houot,R.(2018).Hide or defend,the two strategies of lymphoma immune evasion:potential implications for immunotherapy.Haematologica 103,1256-1268.

Liu,Y.,Gao,S.,Zhao,Y.,Wang,H.,Pan,Q.,and Shao,Q.(2021).Decidual Natural Killer Cells:A Good Nanny at the Maternal-Fetal Interface During Early Pregnancy.Front Immunol 12,663660.

Than,N.G.,Hahn,S.,Rossi,S.W.,and Szekeres-Bartho,J.(2019).Editorial:Fetal-Maternal Immune Interactions in Pregnancy.Front Immunol 10,2729.

Zhao,W.,Lei,A.,Tian,L.,Wang,X.,Correia,C.,Weiskittel,T.,Li,H.,Trounson,A.,Fu,Q.,Yao,K.,et al.(2020).Strategies for Genetically Engineering Hypoimmunogenic Universal Pluripotent Stem Cells.iScience 23,101162.

disclosure of Invention

Aiming at the defects existing in the prior art, the invention provides a novel method for obtaining low immunogenicity by modifying cells, adopts a strategy for carrying out mass screening on all mechanism molecules related to maternal-fetal tolerance and tumor escape for the first time, and finally identifies a representative novel gene PVR through multiple rounds of functional detection. The gene can obviously reduce or escape the recognition and attack of immune system, especially the attack of natural killer cells, macrophages and the like, and the invention provides a feasible strategy for realizing the immunity and the immunity of cells by transforming and developing new genes in the unpredictable field.

The invention successfully constructs B2M/CIITA double-allele knockout positive clone DKO cells by knocking out beta-2-microglobulin (B2M) in the endoplasmic reticulum of human pluripotent stem cells and knocking out the positive regulator CIITA transcribed by MHC-II genes; then, the novel gene PVR identified by the invention is over-expressed in DKO cells by using a lentiviral vector, so that the obtained human pluripotent stem cells can further escape the killing of NK cells on the basis of escaping T cell attack. Meanwhile, the low-immunogenicity pluripotent stem cells retain the key biological functions of the pluripotent stem cells such as the stem cells and the differentiation capacity.

In order to achieve the above purpose, the present invention adopts the following technical scheme:

in a first aspect, the invention provides a universal cell comprising, relative to a wild-type cell:

1) Reduced or no expression of MHC-I and/or MHC-II human leukocyte antigens;

2) Expression sequences of PVR;

the cells can escape T cell attack and killing of NK cells.

In certain aspects, the cells include MHC-I and MHC-II human leukocyte antigens with reduced or no expression.

In certain aspects, the cell further comprises a modification to increase expression of one or more polypeptides selected from the group consisting of: DUX4, CD27, CD35, CD200, HLA-C, PD-L1, CD47, CD24, CD26, CCL21, mfge8 and serpin b9.

In certain aspects, reduced or no expression of MHC-I and MHC-II genes is achieved in the cells using gene editing tools (such as TALEN and/or CRISPR systems) to target one or more genes encoding one or more transcription regulators of MHC-I, and one or more genes encoding one or more transcription regulators of MHC-II.

In certain embodiments, to achieve reduced or no expression of MHC-I and MHC-II genes, the MHC-I transcription regulator may preferably be selected from the group consisting of: one or more of B2M, TAP, TAP2, TAP-related glycoprotein (Tapasin) or NLRC 5; the transcriptional regulator of MHC-II may preferably be selected from: CIITA, RFXANK, RFX5, RFXAP;

the transcription regulatory factor is preferably B2M and CIITA.

In certain embodiments, the cell further comprises a genetic modification that targets the CIITA gene by selectively inactivating a rare-cutting endonuclease of the CIITA gene.

In certain embodiments, the cell further comprises a genetic modification that targets the B2M gene by selectively inactivating a rare-cutting endonuclease of the B2M gene.

In certain embodiments, the rare-cutting endonuclease is selected from the group consisting of a CAS protein, a TALE-nuclease, a zinc finger nuclease, a meganuclease, and a homing nuclease.

In certain embodiments, wherein the genetic modification to target the CIITA gene or B2M gene by a rare-cutting endonuclease comprises a CAS protein or polynucleotide encoding a CAS protein, and at least one targeting ribonucleic acid sequence for specifically targeting the CIITA gene or B2M gene.

In a specific embodiment, both ends of the B2M and CIITA exons are directly knocked out using a CRISPR/CAS9 system, wherein the target sequences of the gRNAs for the B2M gene are SEQ ID NO. 2 and SEQ ID NO. 3, and the target sequences of the gRNAs for the CIITA gene are SEQ ID NO. 4 and SEQ ID NO. 5, respectively.

In certain aspects, reduced or no expression of MHC-I and/or MHC-II genes is achieved in the cell by introducing a gene expression modifying molecule for one or more genes encoding one or more transcriptional regulators of MHC-I, or one or more genes encoding one or more transcriptional regulators of MHC-II, wherein the gene expression modifying molecule comprises one selected from siRNA, shRNA, microRNA, an antisense RNA, and another RNA-mediated inhibitory molecule.

In certain aspects, the amino acid sequence of the PVR has more than 70% homology, e.g., more than 80% homology, further e.g., more than 90%, more than 95%, more than 98% homology to the sequence shown as SEQ ID NO. 1;

Further preferably, the amino acid sequence of PVR is shown as SEQ ID NO. 1.

In certain aspects, the cell is an embryonic stem cell.

In certain aspects, the cell is a pluripotent stem cell.

In certain aspects, the cell is an induced pluripotent stem cell.

In certain embodiments, the cell is a low immunogenicity stem cell.

In certain embodiments, the cell is a human stem cell or a human somatic cell.

In certain embodiments, the cell is a human induced pluripotent stem cell or a human pluripotent stem cell.

In a second aspect, the present invention provides a method for preparing a universal cell according to the first aspect, comprising the steps of:

1) Knocking out one or more genes of one or more transcription regulators of MHC-I of the cells; and/or the number of the groups of groups,

2) Knocking out one or more genes of one or more transcription regulators of MHC-II of the cells;

3) Nucleic acid sequences encoding PVR proteins are introduced into cells.

In certain aspects, the transcriptional regulator of MHC-I may preferably be selected from: one or more of B2M, TAP, TAP2, TAP-related glycoprotein (Tapasin) or NLRC 5; the transcriptional regulator of MHC-II may preferably be selected from: CIITA, RFXANK, RFX5, RFXAP.

In certain embodiments, the transcriptional regulator is selected from the group consisting of B2M and CIITA.

In certain aspects, the knockout of steps 1) and 2) is a genetic modification that targets the CIITA gene or B2M gene by selectively inactivating rare-cutting endonucleases of the CIITA gene or B2M gene.

Preferably, the rare-cutting endonuclease is selected from the group consisting of a CAS protein, a TALE-nuclease, a zinc finger nuclease, a meganuclease, and a homing nuclease.

Further preferred, wherein the genetic modification for targeting the CIITA gene or the B2M gene by a rare-cutting endonuclease comprises a CAS protein or a polynucleotide encoding a CAS protein, and at least one targeting ribonucleic acid sequence for specifically targeting the CIITA gene or the B2M gene.

In certain embodiments, steps 1) and 2) use a CRISPR system to directly knock out both ends of the B2M and CIITA exon segments, respectively, wherein the target sequence for the gRNA of the B2M gene is SEQ ID No. 2, 3 and the target sequence for the gRNA of the CIITA gene is SEQ ID No. 4, 5.

In certain aspects, the knockout of step 1) or 2) is achieved by introducing a gene expression modifying molecule for one or more genes encoding one or more transcriptional regulators of MHC-I, or one or more genes encoding one or more transcriptional regulators of MHC-II, wherein the gene expression modifying molecule comprises one selected from siRNA, shRNA, microRNA, an antisense RNA and another RNA-mediated inhibitory molecule, to achieve reduced or no expression of MHC-I and/or MHC-II genes.

In certain aspects, step 3) introduces a nucleic acid sequence encoding a PVR protein into the cell using an expression vector.

Preferably, the expression vector used in the step 3) is a viral vector.

In certain embodiments, the viral vector employed in step 3) is a lentivirus.

In certain aspects, step 3) introducing a nucleic acid sequence encoding a PVR protein into a selected site of the cell; preferably, the selected site of the cell is a safe harbor gene site.

further preferably, the amino acid sequence of PVR is shown as SEQ ID NO. 1.

In certain aspects, the universal cell further comprises a second expression vector comprising a polynucleotide sequence encoding one selected from the group consisting of DUX4, CD27, CD35, CD200, HLA-C, PD-L1, CD47, CD24, CD26, CCL21, mfge8, and serpin b 9.

In certain embodiments, the second expression vector is an inducible expression vector; preferably, the second expression vector is a viral vector.

In a third aspect, the present invention provides a method of preparing differentiated cells of the generic type, comprising culturing cells of the generic type prepared according to the method of the second aspect under differentiation conditions, thereby preparing differentiated cells of low immunogenicity.

In certain aspects, wherein the differentiation conditions are suitable for differentiating the cells into cell types selected from the group consisting of cardiomyocytes, neural cells, glial cells, endothelial cells, T cells, NK cells, NKT cells, macrophages, hematopoietic progenitor cells, mesenchymal cells, islet cells, chondrocytes, retinal pigment epithelial cells, kidney cells, liver cells, thyroid cells, skin cells, blood cells, and epithelial cells.

In a fourth aspect, the invention provides a method of treating a patient in need of cell therapy comprising administering a population of differentiated, low-immunogenic cells prepared according to the method of the third aspect.

In a fifth aspect, the invention provides a composition comprising a universal cell according to the first aspect.

In certain aspects, the composition comprises a universal cell of the first aspect and one or more therapeutic agents comprising a peptide, cytokine, small molecule compound, macromolecule, ADC, antibody, nanoparticle, biological analog, mRNA, traditional Chinese medicine, protein, vaccine, checkpoint inhibitor, mitogen, growth factor, small RNA, double-stranded RNA (double stranded RNA; dsRNA), mononuclear blood cells, feeder cell components or replacement factors thereof, vectors comprising one or more polynucleic acids of interest, antibodies, and the like.

In a sixth aspect, the invention provides a cell expressing PVR protein and having reduced or no expression of MHC class I and/or MHC class II human leukocyte antigens.

In a seventh aspect, the invention provides a cell that does not express CIITA, expresses PVR protein, and has reduced or no expression of MHC class I and/or MHC class II human leukocyte antigens.

In an eighth aspect, the invention provides a cell that does not express B2M, expresses PVR protein, and has reduced or non-expressed MHC class I and/or MHC class II human leukocyte antigen.

In a ninth aspect, the invention provides a cell that does not express CIITA and B2M, expresses PVR protein, and has reduced or non-expressed MHC class I and/or MHC class II human leukocyte antigen expression.

In a tenth aspect, the invention provides a method of expressing a PVR protein and at least one polypeptide selected from the group consisting of: polypeptides of DUX4, CD27, CD35, CD200, HLA-C, PD-L1, CD47, CD24, CD26, CCL21, mfge8 and serpin b9, and cells with reduced or non-expressed MHC class I and/or MHC class II human leukocyte antigens.

In an eleventh aspect, the invention provides a method of expressing no CIITA, expressing a PVR protein and at least one member selected from the group consisting of: DUX4, CD27, CD35, CD200, HLA-C, PD-L1, CD47, CD24, CD26, CCL21, mfge8 and serpin b9, and cells with reduced or no expression of MHC class I and/or MHC class II human leukocyte antigens.

In a twelfth aspect, the invention provides a method for expressing a PVR protein and at least one polypeptide selected from the group consisting of: polypeptides of DUX4, CD27, CD35, CD200, HLA-C, PD-L1, CD47, CD24, CD26, CCL21, mfge8 and serpin b9, and cells with reduced or non-expressed MHC class I and/or MHC class II human leukocyte antigens.

In a thirteenth aspect, the invention provides a method of expressing a PVR protein and at least one member selected from the group consisting of: polypeptides of DUX4, CD27, CD35, CD200, HLA-C, PD-L1, CD47, CD24, CD26, CCL21, mfge8 and serpin b9, and cells with reduced or non-expressed MHC class I and/or MHC class II human leukocyte antigens.

In a fourteenth aspect, the present invention provides a cell according to the sixth to thirteenth aspects above, wherein the cell is selected from the group consisting of a stem cell, a differentiated cell, a pluripotent stem cell, an induced pluripotent stem cell, an adult stem cell, a progenitor cell, a somatic cell, a primary T cell and a chimeric antigen receptor T cell.

In a fifteenth aspect, the present invention provides the use of a generic cell according to the first aspect, a composition according to the fifth aspect, for the preparation of a product for cell therapy.

In a sixteenth aspect, the present invention provides the use of a composition according to the first aspect, of a composition according to the fifth aspect, for the preparation of a product for organ transplantation.

In a seventeenth aspect, the present invention provides the use of a composition according to the first aspect or the fifth aspect for constructing a pool of universal PSCs.

In an eighteenth aspect, the present invention provides the use of a composition according to the fifth aspect of the generic cell according to the first aspect as a gene drug carrier.

The invention has the beneficial effects that:

after the main histocompatibility complex MHC-I and class II genes are inactivated in the stem cells, PVR is overexpressed, and the obtained human pluripotent stem cells can further escape NK cell killing on the basis of escaping T cell attack, and the effect is similar to positive control WT and DKO+CD47. The obtained effect of the human induced pluripotent stem cells on escaping NK cells is obviously better than that of positive control iPSC WT, and the killing of PBMC can be obviously escaped. While these low-immunogenicity pluripotent stem cells retain their stem and differentiation capabilities.

Drawings

FIG. 1 shows B2M gene knockout strategy and result diagram in human embryonic stem cell line H1;

FIG. 2 shows CIITA gene knockout strategy and results in human embryonic stem cell line H1;

FIG. 3 shows the expression profile of B2M and CIITA at RNA level in DKO cells using RT-qPCR in example 1;

FIG. 4 is a graph showing the results of detecting B2M protein levels using Western-blot in example 1;

FIG. 5A shows graphs of HLA-I/II expression in various cells by flow cytometry using INF-gamma stimulation of wild-type H1 (WT) and DKO in example 1;

wherein, the T cells are positive controls for detecting HLA-I/II molecules;

FIG. 6 is a karyotype diagram of the B2M/CIITA double allele knock-out positive clone (DKO) obtained in example 1;

FIG. 7 shows the expression profile of RNA and protein level dryness gene POU5F1/NANOG/SOX2 in WT and DKO cells using immunofluorescence and RT-qPCR in example 2;

wherein MSC is a negative control;

FIG. 8 shows the expression pattern of SSEA-4 and Tra1-81, which are cell surface stem genes of WT and DKO, detected by immunofluorescence in example 2.

Fig. 9 shows that DKO cells can form teratomas with three germ layers, inner, middle, and outer, using immunohistochemistry;

FIG. 10 is a graph of the results of the test performed on DKO cells using RTCA assay in example 2;

FIG. 11 shows a schematic diagram of pGC-EF1a plasmid structure;

FIG. 12 shows the expression profile of DKO+CD47 cell line CD47 constructed in example 3 with a flow cytometer;

FIG. 13 shows graphs of the killing results of NK cells against CD 47-overexpressing DKO+CD47 cell lines, WT, DKO cells by RTCA assay in example 3;

FIG. 14 shows graphs of the killing results of NK cells against cell lines overexpressing candidate proteins, H1WT (positive control) and H1 DKO cells (negative control) by RTCA assay in example 4.

Fig. 15. MRNA levels compared to DKO overexpression were measured using qPCR for the constructed dko+pvr cell lines in example 5.

FIG. 16 detection of dry gene expression using immunofluorescence (A) and flow (B) for the constructed DKO+PVR cell lines in example 5.

FIG. 17 shows graphs of the killing results of NK cells against DKO+PVR cell lines, WT, DKO cells overexpressing PVR protein by RTCA assay in example 5.

Description: the label WT, DKO, DKO +PVR in FIGS. 18 and 19 below corresponds to hiPSC-WT, hiPSC-DKO, hiPSC-DKO+PVR;

FIG. 18 shows graphs of the killing results of NK cells against hiPSC-DKO+PVR cell lines, WT, DKO cells overexpressing PVR protein by RTCA assay in example 6;

FIG. 19 is a graph showing the results of RTCA assay on killing of PBMC and MAC cells against hiPSC-DKO+PVR cell lines, WT and DKO cells over-expressing PVR protein in example 6;

Detailed Description

The technical scheme of the invention will be further described in detail below with reference to specific embodiments. It is to be understood that the following examples are illustrative only and are not to be construed as limiting the scope of the invention. All techniques implemented based on the above description of the invention are intended to be included within the scope of the invention.

Unless otherwise indicated, the starting materials and reagents used in the following examples were either commercially available or may be prepared by known methods. The experimental procedure, which does not address the specific conditions in the examples below, is generally followed by routine conditions such as Sambrook et al, molecular cloning: conditions described in the laboratory Manual (New York: cold Spring Harbor Laboratory Press, 1989) or as recommended by the manufacturer.

Unless defined otherwise or clearly indicated by context, all technical and scientific terms in this disclosure have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

Example 1 construction of B2M and CIITA double knockout cell line (DKO)

1. Cell culture reagent:

TABLE 1

2. The method and the result are as follows:

the invention selects a human pluripotent stem cell line H1 (Wicell, WA 01) or H9 (Wicell, WA 09), uses CRISPR/CAS9 to knock out beta-2-microglobulin (B2M) in the endoplasmic reticulum, so that MHC-I on the cell surface can not form functional molecules, thereby escaping allogeneic CD8 ⁺ Killing of T cells; killing of escaping CD4+ T cells is accomplished by knocking out the upregulating factor CIITA for MHC-II gene transcription, thereby reducing MHC-II molecule expression.

The CRISPR/CAS9 gene knockout strategy of the B2M is shown in figure 1, the B2M-gRNA1 and the B2M-gRNA2 are used for directly knocking out two ends of the B2M exon segment, and then the B2M-F1/R1 and the B2M-F2/R2 pair of PCR primers are used for carrying out genome sequence knocking-out verification.

gRNA sequence:

B2M-gRNA1：CGTGAGTAAACCTGAATCTT

B2M-gRNA2：AGTCACATGGTTCACACGGC

identification primers

B2M-F1:TGGGGCCAAATCATGTAGACTC

B2M-R1:TCAGTGGGGGTGAATTCAGTGT

B2M-F2+B2M-R2＝608bp

After knockout: non-strip belt

B2M-F2:CAGAAGTCCTTGAGAGCCTCC

B2M-R2:TGTGCATCAGTATCTCAGCAGG

B2M-F2+B2M-R2＝812bp

After knockout: 569bp.

In addition, the CRISPR/CAS9 gene knockout strategy of CIITA is shown in FIG. 2, the CIITA exon segments are directly knocked out at two ends by using CIITA-gRNA1 and CIITA-gRNA2, and then genome sequence knockout verification is carried out by using two pairs of PCR primers of CIITA-F1/R1 and CIITA-F2/R2 respectively.

gRNA sequence:

CIITA-gRNA1:GATATTGGCATAAGCCTCCC

CIITA-gRNA2:CATCGCTGTTAAGAAGCTCC

identifying a primer:

CIITA-F1:CTGTGCCTCTACCACTTCTATG

CIITA-R1:CCTTCCATGTCACACAACAGCC

CIITA-F1+CIITA-R1＝368bp

after knockout: non-strip belt

CIITA-F2:TGGAATCCACACTTTCCAGTTC

CIITA-R2:TGGAGTCTCCGTTCCTCCAG

CIITA-F2+CIITA-R2＝889bp

After knockout: 459bp

The specific operation is as follows:

1) Human pluripotent stem cells were cultured to 80% density using mTeSR1 normally on Matrigel coated 6 well plates. After digestion with TRYPLE, DMEM/F12 was added for neutralization and counting. Sucking 2X 10 ⁶ Cells were in EP tubes and the supernatant was discarded after centrifugation.

2) According to the Neon transfection system 100. Mu.L electric rotator system, 15. Mu.g TrueCut was added ^TM Cas9 protein+3 μg gRNA (B2MgRNA 1+B2MgRNA 2+CIITA gRNA1+CIITA gRNA 2) forms an RNP system, and the RNP system is uniformly mixed and placed at room temperature for 20min.

3) 100. Mu.L of RNP electrotransfection system resuspended cells, and the Neon transfection system performed electrotransfection with parameters 1200V,30ms,1pause. Cells were rapidly added to pre-warmed medium after electrotransformation and plated uniformly in 1 well Matrigel coated 6 well plates.

4) Fresh mTeSR1 medium was changed daily. After single cells grow up, single clones are picked up in a 48-well plate, after cloning and amplification, genome samples are collected for PCR detection and gene editing conditions, and the PCR results are shown in figures 1 and 2. The PCR positive clones were sent to Sanger sequencing for further validation.

5) Positive B2M/CIITA double-allele knockout clone DKO amplification culture and freezing-storage are identified.

The expression of B2M and CIITA at the RNA level of B2M/CIITA bi-allelic knockout clone DKO was examined using qPCR and knockouts were determined as shown in fig. 3.

B2M-F:AAGATGAGTATGCCTGCCGT

B2M-R:ATGCGGCATCTTCAAACCTC

CIITA-F:CCTGGAGCTTCTTAACAGCGA

CIITA-R:TGTGTCGGGTTCTGAGTAGAG

The expression of B2M protein levels of B2M/CIITA double allele knock-out clone DKO was examined using Western-Blot, and knockouts were determined as shown in FIG. 4.

WT and DKO were stimulated with INF-gamma: cells were plated, and the next day of liquid change medium containing INF-gamma was added to the cells, and after 48 hours of action, cells were digested and tested for HLA-I/II expression using flow-through. Results As shown in FIG. 5, B2M/CIITA double allele knock-out stem cell positive clones (DKO) were unable to express HLA-I/II class molecules in response to INF-gamma stimulation. T cells are the positive control for detection of HLA-I/II class molecules.

Karyotyping was performed on the B2M/CIITA double allele knock-out positive clone (DKO) obtained: chromosomal specimens mounted on slides were treated with trypsin and stained with Giemsa's staining solution. And (3) analyzing the chromosome number and morphological structure of the metaphase chromosome to determine whether the karyotype of the metaphase chromosome is consistent with the normal karyotype. The results are shown in FIG. 6, where DKO karyotype is normal.

Example 2 verification of the drying and immune Functions of DKO cell lines in example 1

1. Expression of Stem genes in WT and DKO cells

Immunofluorescence assays showed that WT and DKO cells expressed the dry genes POU5F1 and NANOG at the protein level: cells were plated in 12-well plates, medium was aspirated after cells had grown to 60-80% density, and 4% paraformaldehyde was added for fixation. After cell rupture, the primary antibodies were incubated overnight at 4℃with POU5F1 and NANOG, after which the secondary antibodies with fluorescent markers were incubated at room temperature, after which they were washed off, and then photographed using a fluorescence microscope. The results are shown in FIG. 7A. RT-qPCR detection showed that WT and DKO cells expressed the dry genes POU5F1, NANOG and SOX2 at RNA level: the results are shown in FIG. 7B. (MSC is a negative control for dry gene expression)

Flow result detection shows that the dry genes SSEA-4 and Tra1-81 with high expression on the cell surfaces of the WT and DKO respectively account for 100%,99.98%, 96.75% and 99.13%. The results are shown in FIG. 8.

2. Differentiation ability of the obtained B2M/CIITA double allele knockout positive clone (DKO)

100 μl of suspension containing 5E+5DKO cells was subcutaneously injected into immunodeficient mice (SCID Beige) until the teratoma volume was greater than 1.5cm ³ And then taking out and performing slice dyeing.

The obtained B2M/CIITA double allele knockout positive clone (DKO) can form teratomas in vivo and differentiate cells of inner, middle and outer three germ layers. As shown in fig. 9.

3.DKO cell immune function verification

Killing experiments of T cells and NK cells were performed using xCELLigence RTCA Instrument. The same number of WT and DKO cell lines were resuspended using IL-2-containing Essential 8 medium and inoculated into 96-well E-plates coated with matrigel and killing assays were performed with the addition of activated T cells or NK cells. RTCA test data were analyzed using xcelligent software to calculate kill rate and escape function.

TABLE 2

Name of the name	Goods number (Cat No.)	Specification of specification	Manufacturer' s
				PE anti-human CD4	980804	500 ul/tube	Biolegend
APC anti-human CD8	980904	500 ul/tube	Biolegend
				FITC anti-human CD3	300440	500tests	Biolegend
APC anti-human CD16	301012	100tests	Biolegend
				PE anti-human CD56(NCAM)	318306	100tests	Biolegend
human IL-2	202-1L-050/CF	50ug	R&D
				Y-27632 2HCl	S1049	5mg	Selleck
Matrigel	354277	5ml	Gibco
				Essential 8 ^TM Culture medium	A1517001	500ml	Gibco
E-Plate VIEW 96PET	300601030	6 blocks/box	Agilent

As shown in the RTCA data of FIG. 10, WT cells escape NK cell killing due to HLA-I expression, but are killed by T cells. DKO cells can escape T cell killing while being more sensitive to NK cell killing.

EXAMPLE 3 construction of DKO+CD47 cell line and verification of immune function

CD47 (NM-198793) was overexpressed in the DKO cells obtained in example 1 using a lentiviral vector, the amino acid sequence of which is shown in SEQ ID NO.18, and cDNA (SEQ ID NO. 19) of the overexpressed sequence was constructed in a lentiviral plasmid (pGC-EF 1 a) that was started by EF1a and was labeled with a puromycin selection, the structure of which is shown in FIG. 11. The plasmid was digested with BamHI/NheI, ligated, and the inserted sequence was verified for correctness by Sanger sequencing and virus packaging was performed. DKO human pluripotent stem cells constructed in example 2 were transfected, and the cells were changed to medium with puromycin after 24 hours and 48 hours for selection. The result of the constructed stable transgenic cell DKO+CD47 is shown in FIG. 12, and cell expansion and subsequent functional detection are carried out after confirming the expression.

Referring to example 2, whether an overexpressed dko+cd47 cell line can successfully escape NK cell killing while escaping T cell killing was examined using RTCA, as shown in fig. 13, NK cells can effectively kill DKO cells, and WT and dko+cd47 overexpressing cells can escape NK killing.

Example 4 selection of Universal cells expressing proteins comprising maternal tolerance and tumor immune escape molecules

The invention discloses a construction strategy and screening of each molecular protein:

the 22 candidate targets were screened in this time, and the amino acid and cDNA sequences are shown in Table 3. Candidate targets are involved in maternal-fetal tolerance or tumor immune escape, wherein:

molecules involved in maternal tolerance: HLA-E, HLA-G, CTLA4-Ig.

Inhibitory immune receptors involved in tumor expression (immune checkpoints): MICA, MICB, ULBP1, ULBP2, ULBP3, CTLA4-Ig, C1-Inhibitor, PVR, CD, CD55, CD59, CD20, HER2.

Relates to regulatory factors in tumor microenvironment: TDO, IDO1, IDO2, IL-10, IL37, IL-12A, IL-35B.

TABLE 3 Table 3

/>

The use of natural immunosuppressive mechanisms to engineer pluripotent stem cells to confer low immunogenicity, but these types of methods rely on immunosuppressive receptor-ligand pairs or specific microenvironments, and whether they exist on transplanted cells and immune cells, so merely introducing these genes may not necessarily bring about complete low immunogenicity, requiring functional confirmation by actual detection (Zhao et al 2020).

The 22 candidate targets selected in this time were over-expressed in the DKO cells obtained in example 1 using lentiviral vectors, the amino acid sequences of the 22 candidate targets are shown in table 3, cdnas of the over-expressed sequences (sequences shown in table 3) were constructed in lentiviral plasmids (pGC-EF 1 a) activated by EF1a, and the structures of pGC-EF1a plasmids are shown in fig. 11. The plasmid was digested with BamHI/NheI, ligated, and the inserted sequence was verified for correctness by Sanger sequencing and virus packaging was performed. DKO human pluripotent stem cells constructed in example 2 were transfected, and the cells were changed to medium with puromycin after 24 hours and 48 hours for selection. And (3) carrying out multiple NK in vitro killing experiments (n is more than or equal to 5) on stable transgenic plants of 22 candidate targets, and screening out candidate new targets with optimal escape degrees on NK cells. The relative killing ratio was normalized to the negative control H1 DKO cells and summarized in two NK ratios (E: T) of high (high: E: t=2:1) and low (low: E: t=1:1 or 0.5:1). The killing ratio is less than 1, which indicates that the DKO has escape ability, and the lower the ratio is, the stronger the escape ability is. The positive control was H1 WT and h1dko+cd47 constructed in example 3. The results are shown in fig. 14, and the multiple killing rates are smaller than DKO at multiple ratios of dko+pvr alone, similar to the average killing rate of positive control H1 WT and dko+cd47 of the prior art, which is the optimal cell for escaping NK killing. The effect is even better than that of common sense star molecule HLA-G, CTLA4-Ig, and the like, and the unexpected effect is achieved.

EXAMPLE 5 construction of DKO+PVR cell lines and verification of immune Functions

1. DKO+PVR cell construction and over-expression detection

The nucleic acid sequence encoding PVR (amino acid sequence of PVR shown as NP-006496.4) (NM-006505.5) was synthesized directly and constructed in a lentiviral plasmid (pGC-EF 1 a) that was started by EF1a and harbored a puromycin selection marker, the structure of pGC-EF1a plasmid is shown in FIG. 11. The plasmid was digested with BamHI/NheI, ligated, and the inserted sequence was verified for correctness by Sanger sequencing and virus packaging was performed. The DKO human pluripotent stem cells obtained in example 2 were transfected and then transformed into a culture medium with puromycin for selection. The constructed dko+pvr cells were tested for mRNA overexpression using qPCR, DKO cells were negative controls, and the results are shown in fig. 15.

PVR F1：GTTTGGACTCCGAATAGCTGG

PVR R1：GTTGCGCGTAGAGGATGAAG

2. Expression of a Stem Gene in DKO+PVR cells

Referring to example 2, immunofluorescence assay showed that DKO+PVR cells expressed dry genes OCT4, NANOG, SOX2, TRA-1-60, TRA-1-81 at protein level, and the results are shown in FIG. 16A. Flow result detection shows that the DKO+PVR cell surface high expression dry genes SSEA-4, OCT4, TRA-1-60 and Tra1-81 account for 99.20%, 97.92%, 99.69% and 97.93%, respectively. The results are shown in FIG. 16B.

DKO+PVR cell immune function assay

And (3) carrying out cell expansion and subsequent functional detection after the DKO+PVR cells are established and expressed in a dry state. Referring to example 2, in the NK cell killing experiment for RTCA assay, DKO cells constructed in example 2 were completely killed by NK cells, and H1WT and dko+pvr were successfully escaped. As shown in fig. 17.

Example 6 in vitro detection of loss of escaping immune System by hips DKO+PVR

In this example, human induced pluripotent stem cells (hiPSC cells, i.e., WT cells in FIGS. 18-19) were selected to prepare hiPSC-DKO and hiPSC-DKO+PVR (hiPSC cells by CTS) according to the methods described in examples 1 and 5 ^TM CytoTune ^TM -iPS 2.1 Sendai Virus reprogramming kit (Thermo Fisher Scientific Inc cat# A34546). hiPSC-DKO (i.e., DKO cells in FIGS. 18-19) and hiPSC-DKO+PVR (i.e., DKO+PVR cells in FIGS. 18-19) were obtained.

1. Verification of escaping NK cell killing function

NK cell killing assays were performed on the XCElligent platform (ACEA Biosciences). Each hiPSC cell was resuspended in 100. Mu.l of cell-specific medium and plated onto Matrigel (Sigma-Aldrich) coated 96-well E-plates (ACEABiosciences). After the cell index value reached 1, NK cells were added at an E:T ratio of 1:1. Data were normalized and analyzed using RTCA software (ACEA). As shown in fig. 18, hiPSC-dko+pvr cells can significantly escape NK killing, escaping effect is better than WT cells.

2. Verification of escaping PBMC and Macrophage (MAC) killing function

NK activating factors are added into PBMC in advance, the NK proportion and the killing performance of T cells in the PBMC are improved, RTCA experiments are carried out by taking activated mixed lymphocytes (PBMC) as effector cells, and the immune escape capacity of hiPSC-DKO+PVR cells is comprehensively judged (method reference PMID: 33309274). Specific procedures PBMC and MAC cell killing assays were performed on the xcelligent platform (acebio sciences). Each hiPSC cell was resuspended in 100. Mu.l of cell-specific medium and plated onto Matrigel (Sigma-Aldrich) coated 96-well E-plates (ACEABiosciences). After the cell index value reached 1, PBMC and MAC cells were added at E:T ratios of 2:1 and 3:1. Data were normalized and analyzed using RTCA software (ACEA). The results are shown in figure 19, hiPSC-dko+pvr cells can significantly escape killing of PBMCs.

The embodiments of the present invention have been described above. However, the present invention is not limited to the above embodiment. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A universal cell comprising, relative to a wild-type cell:

1) Reduced or no expression of MHC-I and/or MHC-II human leukocyte antigens;

2) Expression sequences of PVR;

the cells can escape T cell attack and killing of NK cells.

2. The universal cell of claim 1, wherein the cell comprises reduced or no expression of MHC-I and MHC-II human leukocyte antigens.

3. The universal cell of claim 1 or 2, wherein the cell further comprises a modification to increase expression of one or more of the following polypeptides: DUX4, CD27, CD35, CD200, HLA-C, PD-L1, CD47, CD24, CD26, CCL21, mfge8 and serpin b9.

4. The universal cell of claim 1 or 2, wherein reduced or no expression of MHC-I and/or MHC-II genes is achieved in the cell using gene editing tools to target one or more genes encoding one or more transcriptional regulators of MHC-I, or one or more genes encoding one or more transcriptional regulators of MHC-II;

preferably, the MHC-I transcriptional regulator is selected from the group consisting of: one or more of B2M, TAP, TAP2, TAP-related glycoprotein (Tapasin) or NLRC 5; the MHC-II transcriptional regulator is selected from the group consisting of: CIITA, RFXANK, RFX5, RFXAP;

Further preferably, the transcriptional regulator is B2M and CIITA.

5. The universal cell of claim 4, further comprising a genetic modification to target the CIITA gene by selectively inactivating a rare-cutting endonuclease of the CIITA gene.

6. The universal cell of any of claims 1-5, further comprising a genetic modification to target the B2M gene by a rare-cutting endonuclease that selectively inactivates the B2M gene.

7. The universal cell of claim 5 or 6, wherein the rare-cutting endonuclease is selected from the group consisting of CAS protein, TALE-nuclease, zinc finger nuclease, meganuclease and homing nuclease.

8. The universal cell of claim 7, wherein the genetic modification to target the CIITA gene or B2M gene by a rare-cutting endonuclease comprises a CAS protein or polynucleotide encoding a CAS protein, and at least one targeting ribonucleic acid sequence for specifically targeting the CIITA gene or B2M gene.

9. The universal cell of claim 8, wherein the B2M and CIITA exons are knocked out directly at both ends using a CRISPR/CAS9 system, wherein the targeting sequences for the targeting ribonucleic acid sequence gRNA of the B2M gene are SEQ ID NOs 2 and 3 and the targeting sequences for the targeting ribonucleic acid sequence gRNA of the CIITA gene are SEQ ID NOs 4 and 5, respectively.

10. The universal cell of claim 1 or 2, wherein reduced or no expression of MHC-I and/or MHC-II genes is achieved in the cell by introducing a gene expression modifying molecule for one or more genes encoding one or more transcriptional regulators of MHC-I, or one or more genes encoding one or more transcriptional regulators of MHC-II, wherein the gene expression modifying molecule comprises one selected from siRNA, shRNA, microRNA, an antisense RNA and another RNA-mediated suppressor molecule.

11. The universal cell according to any of claims 1-10, wherein the amino acid sequence of PVR has more than 70% homology, such as more than 80% homology, further such as more than 90%, more than 95% homology, more than 98% homology with the sequence as shown in SEQ ID No. 1;

preferably, the amino acid sequence of PVR is shown as SEQ ID NO. 1.

12. The universal cell of any one of claims 1-11, wherein the cell is an embryonic stem cell or a pluripotent stem cell or an induced pluripotent stem cell; preferably low immunogenic stem cells; further preferred are human stem cells or human somatic cells; still more preferably, the cell is a human induced pluripotent stem cell or a human pluripotent stem cell.

13. A method for preparing a universal cell according to any one of claims 1 to 12, comprising the steps of:

1) Knocking out one or more genes of one or more transcription regulators of MHC-I of stem cells; and/or the number of the groups of groups,

2) Knocking out one or more genes of one or more transcription regulators of MHC-II of stem cells;

3) Nucleic acid sequences encoding PVR proteins are introduced into cells.

14. The method of claim 13, wherein the MHC-I transcriptional regulator is selected from the group consisting of: one or more of B2M, TAP, TAP2, TAP-related glycoprotein (Tapasin) or NLRC 5; the MHC-II transcriptional regulator is selected from the group consisting of: CIITA, RFXANK, RFX5, RFXAP; preferably, the transcriptional regulator is selected from the group consisting of B2M and CIITA.

15. The method of preparation according to claim 13 or 14, wherein the knockout of step 1) or 2) is a genetic modification of the CIITA gene or B2M gene targeted by rare-cutting endonucleases that selectively inactivate the CIITA gene or B2M gene;

preferably, the rare-cutting endonuclease is selected from the group consisting of a CAS protein, a TALE-nuclease, a zinc finger nuclease, a meganuclease, and a homing nuclease;

Further preferred, wherein the genetic modification for targeting the CIITA gene or the B2M gene by a rare-cutting endonuclease comprises a CAS protein or a polynucleotide encoding a CAS protein, and at least one targeting ribonucleic acid sequence for specifically targeting the CIITA gene or the B2M gene;

still more preferably, steps 1) and 2) use a CRISPR system to directly knock out both ends of the B2M and CIITA exon segments, respectively, wherein the target sequences for the gRNA of the B2M gene are SEQ ID NOs 2 and 3 and the target sequences for the gRNA of the CIITA gene are SEQ ID NOs 4 and 5.

16. The method of preparation according to claim 13 or 14, wherein the knockout of step 1) or 2) is achieved by introducing a gene expression modifying molecule for one or more genes encoding one or more transcription regulators of MHC-I, or one or more genes encoding one or more transcription regulators of MHC-II, wherein the gene expression modifying molecule comprises one selected from siRNA, shRNA, microRNA, an antisense RNA and another RNA-mediated inhibitory molecule.

17. The method of any one of claims 13-16, wherein step 3) comprises introducing a nucleic acid sequence encoding PVR protein into a cell using an expression vector;

Preferably, the expression vector adopted in the step 3) is a viral vector;

further preferably, the viral vector is a lentivirus.

18. The method of any one of claims 13-17, wherein step 3) introduces a nucleic acid sequence encoding PVR protein into a selected site of the stem cell; preferably, the selected site of the stem cell is a safe harbor gene site.

19. The method of any one of claims 13-18, wherein the amino acid sequence of PVR has more than 70% homology, such as more than 80% homology, further such as more than 90%, more than 95% homology, more than 98% homology with the sequence as shown in SEQ ID No. 1;

further preferably, the amino acid sequence of PVR is shown as SEQ ID NO. 1.

20. The method of any one of claims 13-19, wherein the universal stem cell further comprises a second expression vector comprising a polynucleotide sequence encoding one selected from the group consisting of DUX4, CD27, CD35, CD200, HLA-C, PD-L1, CD47, CD24, CD26, CCL21, mfge8, and serpin b 9.

21. The method of claim 20, wherein the second expression vector is an inducible expression vector; preferably, the second expression vector is a viral vector.

22. A method of preparing a differentiated universal cell comprising culturing a universal cell prepared according to the method of any one of claims 13-21 under differentiation conditions, thereby preparing a differentiated low-immunogenicity cell.

23. The method of claim 22, wherein the differentiation conditions are suitable for differentiating cells into cell types selected from the group consisting of cardiomyocytes, neural cells, glial cells, endothelial cells, T cells, NK cells, NKT cells, macrophages, hematopoietic progenitor cells, mesenchymal cells, islet cells, chondrocytes, retinal pigment epithelial cells, kidney cells, liver cells, thyroid cells, skin cells, blood cells, and epithelial cells.

24. A method of treating a patient in need of cell therapy comprising administering a differentiated, low-immunogenicity cell population prepared according to the method of claim 22 or 23.

25. A composition comprising the universal cell of any one of claims 1-12; preferably, the composition further comprises one or more therapeutic agents; preferably, the therapeutic agent comprises a peptide, cytokine, checkpoint inhibitor, mitogen, growth factor, small RNA, double stranded RNA (double stranded RNA; dsRNA), mononuclear blood cells, feeder cell components or replacement factors thereof, a vector comprising one or more polynucleic acids of interest, antibodies, or the like.

26. A cell expressing PVR protein and having reduced or no expression of MHC class I and/or MHC class II human leukocyte antigens.

27. A cell that does not express CIITA, expresses PVR protein, and has reduced or no expression of MHC class I and/or MHC class II human leukocyte antigens.

28. A cell that does not express B2M, expresses PVR protein, and has reduced or no expression of MHC class I and/or MHC class II human leukocyte antigens.

29. A cell that does not express CIITA and B2M, expresses PVR protein, and has reduced or no expression of MHC class I and/or MHC class II human leukocyte antigens.

30. Expressing PVR protein and at least one selected from the group consisting of: polypeptides of DUX4, CD27, CD35, CD200, HLA-C, PD-L1, CD47, CD24, CD26, CCL21, mfge8 and serpin b9, and cells with reduced or non-expressed MHC class I and/or MHC class II human leukocyte antigens.

31. Non-expression of CIITA, expression of PVR protein and at least one member selected from the group consisting of: polypeptides of DUX4, CD27, CD35, CD200, HLA-C, PD-L1, CD47, CD24, CD26, CCL21, mfge8 and serpin b9, and cells with reduced or non-expressed MHC class I and/or MHC class II human leukocyte antigens.

32. non-B2M-expressing, PVR protein and at least one member selected from the group consisting of: polypeptides of DUX4, CD27, CD35, CD200, HLA-C, PD-L1, CD47, CD24, CD26, CCL21, mfge8 and serpin b9, and cells with reduced or non-expressed MHC class I and/or MHC class II human leukocyte antigens.

33. Non-expression of CIITA and B2M, expression of PVR protein and at least one member selected from the group consisting of: polypeptides of DUX4, CD27, CD35, CD200, HLA-C, PD-L1, CD47, CD24, CD26, CCL21, mfge8 and serpin b9, and cells with reduced or non-expressed MHC class I and/or MHC class II human leukocyte antigens.

34. The cell of any one of claims 26-33, wherein the cell is selected from the group consisting of a stem cell, a differentiated cell, a pluripotent stem cell, an induced pluripotent stem cell, an adult stem cell, a progenitor cell, a somatic cell, a primary T cell, and a chimeric antigen receptor T cell.

35. Use of a universal cell according to any one of claims 1 to 12, a composition according to claim 25 or a cell according to claims 26 to 35 for the preparation of a product for cell therapy.

36. Use of a cell of the general type according to any one of claims 1 to 12, a composition according to claim 25 or a cell according to claims 26 to 35 for the preparation of a product for organ transplantation.

37. Use of a universal stem cell according to any one of claims 1 to 12, a composition according to claim 25 or a cell according to claims 26 to 35 for the construction of a universal PSCs cell bank.

38. Use of a universal stem cell according to any one of claims 1 to 20, a composition according to claim 25 or a cell according to claims 26 to 35 as a gene drug carrier.