CN117384263A

CN117384263A - Protein BRG1 and application of encoding gene thereof in regulation and control of disease resistance of gramineous crops

Info

Publication number: CN117384263A
Application number: CN202210814680.5A
Authority: CN
Inventors: 刁现民; 程溪柳; 智慧; 王�琦; 满欣雨; 汤沙; 刘君
Original assignee: Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Current assignee: Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Priority date: 2022-07-12
Filing date: 2022-07-12
Publication date: 2024-01-12

Abstract

The invention discloses a protein SiBRG1 and application of a coding gene and related biological materials thereof in regulating and controlling crop blast resistance. The amino acid sequence of the protein SiBRG1 is shown in the sequence 2; the coding gene sequence of the protein SiBRG1 is shown in a sequence 1. Experiments prove that: siBRG1 plays an important role in maintaining yield under the stress of crop blast, has important practical significance in the aspects of crop disease resistance and yield utilization, and provides clues for deeply understanding the mechanism of millet and rice blast disease resistance.

Description

Protein BRG1 and application of encoding gene thereof in regulation and control of disease resistance of gramineous crops

Technical Field

The invention belongs to the technical field of biology, and particularly relates to application of a protein BRG1 and a coding gene thereof in regulation and control of disease resistance of gramineous crops.

Background

In the grain production of rice and millet, blast is the first major disease and becomes a major limiting factor for improving and stabilizing yield. The rice and millet blast diseases are caused by pathogenic fungi of the genus Botrytis, and certain fungus communities of the genus Botrytis can take different crops as hosts, have the pathogenicity of crossing hosts, and cross non-host resistance through variation and evolution in the propagation process on a first host to generate super-strong pathogenicity to a second host. The millet is used as a traditional grain and grass crop in China, has the excellent characteristics of barren resistance, high water utilization efficiency, high photosynthesis efficiency and the like, and plays an important role in dry farming. Along with the increasing of Gu Wen diseases and rice blast, broad-spectrum blast disease resistance genes in the mature period are excavated from the study of millet anti-source germplasm resources and are applied to the resistance breeding of other plants such as rice and the like, so that the method has important practical significance for promoting stable and high yield of the crops.

The rice blast is the first disease of the millet, the yield of the millet is reduced by 20% -70% each year, the occurrence of the rice blast in the plant period (the heading, flowering and grouting period) is the most serious, and the yield and quality of the millet are directly reduced seriously, so that the cloning and application of the rice blast disease resistance gene in the plant period are very significant to the disease resistance breeding of the millet. At present, no cereal blast disease resistance gene with function verification is reported.

Disclosure of Invention

The technical problem to be solved by the invention is how to improve the disease resistance of plants, such as the resistance of millet to rice blast or the resistance of rice to Pyricularia (Pyricularia) Gu Wen (Pyricularia setaria) and rice blast (Pyricularia oryzae) diseases.

In order to solve the above technical problem, in a first aspect, the present invention provides a protein, wherein the protein is P1), P2) or P3):

p1), a protein having an amino acid sequence of SEQ ID No. 3;

protein which is obtained by substituting and/or deleting and/or adding more than one amino acid residue in the amino acid sequence shown in P2) and SEQ ID No.3, has more than 80% of identity with the protein shown in P1) and is related to plant stress resistance;

p3), and a tag attached to the N-terminal and/or C-terminal of P1) or P2).

Further, the protein is derived from millet.

Wherein SEQ ID No.3 consists of 1144 amino acid residues.

The protein can be synthesized artificially or obtained by synthesizing the coding gene and then biologically expressing.

The protein tag (protein-tag) refers to a polypeptide or protein which is fused and expressed together with a target protein by using a DNA in-vitro recombination technology so as to facilitate the expression, detection, tracing and/or purification of the target protein. The protein tag may be a Flag protein tag, a His protein tag, an MBP protein tag, an HA protein tag, a myc protein tag, a GST protein tag, and/or a SUMO protein tag, etc.

In order to solve the above technical problems, in a second aspect, the present invention provides a biomaterial related to the above protein, the biomaterial being any one of the following B1) to B7):

b1 A nucleic acid molecule encoding the above protein;

b2 An expression cassette comprising the nucleic acid molecule of B1);

b3 A recombinant vector comprising the nucleic acid molecule of B1), or a recombinant vector comprising the expression cassette of B2);

b4 A recombinant microorganism comprising the nucleic acid molecule of B1), or a recombinant microorganism comprising the expression cassette of B2), or a recombinant microorganism comprising the recombinant vector of B3);

b5 A transgenic plant cell line comprising B1) said nucleic acid molecule, or a transgenic plant cell line comprising B2) said expression cassette, or a transgenic plant cell line comprising B3) said recombinant vector;

b6 A transgenic plant tissue comprising B1) said nucleic acid molecule, or a transgenic plant tissue comprising B2) said expression cassette, or a transgenic plant tissue comprising B3) said recombinant vector;

b7 A transgenic plant organ comprising the nucleic acid molecule of B1), or a transgenic plant organ comprising the expression cassette of B2), or a transgenic plant organ comprising the recombinant vector of B3).

Further, in the above biological material, the nucleic acid molecule B1) is a DNA molecule represented by B1) or B2) as follows:

b1 A DNA molecule with the coding sequence of the coding strand shown in SEQ ID No. 1;

b2 A DNA molecule which has 80% or more identity with the nucleotide sequence defined in b 1) and which encodes the above protein.

In the present invention, identity refers to identity of amino acid sequences or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the internet, such as BLAST web pages of the NCBI homepage website. For example, in advanced BLAST2.1, the identity of a pair of amino acid sequences can be searched for by using blastp as a program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as Matrix, setting Gap existence cost, per residue gap cost and Lambda ratio to 11,1 and 0.85 (default values), respectively, and calculating, and then obtaining the value (%) of the identity.

In the present invention, the 80% identity or more may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

In order to solve the above technical problem, in a third aspect, the present invention provides the use of a protein or a substance regulating the expression of a gene encoding the protein or a substance regulating the activity or content of the protein, wherein the use is any of the following:

a1 The use of a protein or a substance regulating the expression of a gene encoding said protein or a substance regulating the activity or content of said protein in regulating stress resistance of a plant;

a2 Protein or a substance regulating the expression of a gene encoding said protein or the use of a substance regulating the activity or content of said protein in the preparation of a product regulating stress resistance of a plant;

a3 Use of a protein or a substance regulating the expression of a gene encoding said protein or a substance regulating the activity or content of said protein for the cultivation of stress-tolerant plants;

a4 The use of a protein or a substance regulating the expression of a gene encoding said protein or a substance regulating the activity or content of said protein for the preparation of a product for the cultivation of stress-tolerant plants;

a5 Use of a protein or a substance regulating the expression of a gene encoding said protein or a substance regulating the activity or content of said protein in plant breeding;

the protein is the protein;

the substance for regulating the expression of the protein coding gene or the substance for regulating the activity or the content of the protein is the biological material.

Further, the purpose of plant breeding as described in A5) may be to cultivate disease resistant plants, such as millet against Gu Wen (Pyricularia setaria) and/or rice against rice blast (Pyricularia oryzae).

Further, in the above application, the substance that regulates the expression of the protein-encoding gene or the substance that regulates the activity or content of the protein is a substance that increases or up-regulates the expression of the protein-encoding gene or a substance that increases or up-regulates the activity or content of the protein, and the regulation of stress resistance of the plant is an increase in stress resistance of the plant.

Further, in the above application, the plant is any one of the following:

c1 A monocot plant);

c2 Plants of the order gramineae);

c3 A gramineous plant);

c4 A plant of the genus oryza;

c5 Rice);

c6 A green bristlegrass genus;

c7 And millet).

In the present invention, the substance that regulates gene expression may be a substance that performs at least one of the following 6 regulation: 1) Regulation at the level of transcription of said gene; 2) Regulation after transcription of the gene (i.e., regulation of splicing or processing of the primary transcript of the gene); 3) Regulation of RNA transport of the gene (i.e., regulation of nuclear to cytoplasmic transport of mRNA of the gene); 4) Regulation of translation of the gene; 5) Regulation of mRNA degradation of the gene; 6) Post-translational regulation of the gene (i.e., regulation of the activity of the protein translated by the gene).

In the present invention, the recombinant microorganism of B4) may be in particular a yeast, a bacterium, an alga or a fungus. The bacteria may be gram positive or gram negative bacteria. The gram negative bacterium may be agrobacterium tumefaciens (Agrobacterium tumefaciens). The agrobacterium tumefaciens (Agrobacterium tumefaciens) can be in particular agrobacterium tumefaciens EHA105.

In the present invention, the plant tissue of B6) may be derived from roots, stems, leaves, flowers, fruits, seeds, pollen, embryos and anthers.

In the present invention, the transgenic plant organ of B7) may be the root, stem, leaf, flower, fruit and seed of the transgenic plant.

In the present invention, the transgenic plant cell lines, transgenic plant tissues and transgenic plant organs may or may not include propagation material.

In the above application, the stress resistance may be disease resistance, for example: the rice blast resistance and the rice blast resistance.

Further, the pathogenic bacteria of the cereal blast and rice blast may be Gu Wen (Pyricularia setaria) of the genus Pyricularia (Pyricularia) and/or rice blast (Pyricularia oryzae).

In order to solve the above technical problems, in a fourth aspect, the present invention provides a method for controlling stress resistance of a plant, the method comprising controlling stress resistance of a plant by controlling expression of a gene encoding the above protein or controlling activity or content of the above protein.

Further, the method comprises introducing the coding gene of B1) in the application into a recipient plant, and promoting or improving the expression of the protein coding gene or the activity or content of the protein to obtain a target plant with higher stress resistance than the recipient plant.

In the above method, the stress resistance may be disease resistance, for example: the rice blast resistance and the rice blast resistance.

Further, the pathogenic bacteria of the cereal blast and rice blast may be cereal blast (Pyricularia setaria) and/or rice blast (Pyricularia oryzae) of the genus Pyricularia.

In order to solve the above technical problems, in a fifth aspect, the present invention provides a method for growing a stress-resistant plant, the method comprising up-regulating or promoting or increasing the expression level of a gene encoding the above protein in a plant of interest, to obtain a plant with increased stress resistance, which is higher than the plant of interest.

Further, in the above method, the plant with increased stress resistance may specifically be millet with increased resistance to Gu Wen (Pyricularia setaria), and/or rice with increased resistance to rice blast (Pyricularia oryzae).

Further, in the above method, the plant is any one of the following:

c1 A monocot plant);

c2 Plants of the order gramineae);

c3 A gramineous plant);

c4 A plant of the genus oryza;

c5 Rice);

c6 A green bristlegrass genus;

c7 And millet).

In the present invention, the regulation of gene expression may be promotion or increase of the gene expression, which may be achieved by gene overexpression.

The disease resistance improvement may be expressed specifically as: after inoculation of pathogenic bacteria, the area of the lesions on the leaves of the plants over-expressing the protein of interest is significantly lower than that of the wild type; and is superior to wild type in all or part of the aspects of spike length, spike weight, hundred grain weight and the like.

The beneficial technical effects obtained by the invention are as follows:

the stress resistance gene provided by the invention has a certain broad spectrum, and the over-expression of BRG1 gene in the receptor plant can simultaneously improve the resistance of millet to Gu Wen (Pyricularia setaria) and/or the resistance of rice to rice blast (Pyricularia oryzae).

Drawings

FIG. 1 shows plasmid patterns, A in FIG. 1 shows pCAMBIA1305::35S:: BRG1-flag and pCAMBIA 1305::: pUbi:: BRG1-flag overexpression vector patterns, and B in FIG. 1 shows knockout vector Cas9MH-BRG1 patterns.

FIG. 2 shows the molecular identification of rice and millet transgenic for BRG 1. FIG. 2A shows the results of PCR and western detection of the BRG1 gene transformed by Ci846 of millet; FIG. 2B shows the results of PCR and western analysis of the BRG1 gene of Nippon Temminck; in FIG. 2, C is the identification of genomic DNA molecules of the transgenic homozygous strain of rice Long Jing (LG 46); in FIG. 2, D is the identification of genomic DNA molecules of the Kitaake transgenic homozygous lines of rice.

FIG. 3 is an identification of the natural onset of the millet Ci 846-BRG 1-transformed material in Hainan field. In FIG. 3A is the adult Ci846 wild type, ci846 control transformed with empty vector, BRG1 overexpressing #7, #16 bottom 1-7 panels She Dao blast disease resistance; FIG. 3B is a display of the size and shape of the ears of control and overexpressed millet; in fig. 3C is the spike length, spike weight and hundred grain weight of the control and overexpressing plants.

FIG. 4 shows the identification of the disease resistance of rice NIP-to-BRG 1 material artificially inoculated with rice blast in a greenhouse. FIG. 4A shows the upper She Dao blast disease resistance of seedlings in which NIP BRG1 is overexpressed #11, #13, # 14; B-D in FIG. 4 are the ear weight, hundred grain weight and heading stage of control and over-expressed plants.

FIG. 5 shows the identification of the disease resistance of a material transformed from rice Long Jing (LG 46) to BRG1 by artificial inoculation of rice blast in a greenhouse. A, B in FIG. 5 is a plot of disease resistance and lesion area statistics for the upper She Dao blast disease resistance of seedling stage LG46 BRG1 overexpressing transgenic lines #1, #2, # 3; FIG. 5C and FIG. 5D-F are photographs of maturity, spike weight, hundred grain weight and heading stage of control and overexpressing plants.

FIG. 6 shows the identification of the disease resistance of a material transformed from Kitaake to BRG1 in a greenhouse by artificial inoculation of rice blast. A, B in FIG. 6 is the seedling stage Kitaake pBRG1:: BRG transgenic lines #1, #2 upper She Dao blast disease resistance and lesion area statistics; panel C, D-F in FIG. 6 are photographs of maturity, spike weight, hundred grain weight and heading stage of control and overexpressing plants.

FIG. 7 shows the results of resistance detection of homozygous materials of BRG1 knocked out by gene editing of a resistant parent golden seedling, HJ in FIG. 7 shows golden seedling wild type, A in FIG. 7 shows the susceptibility analysis of adult-stage golden seedling control flag leaves and BRG1-KO, B in FIG. 7 shows the susceptibility analysis of adult-stage golden seedling control top leaves and BRG1-KO, and C in FIG. 7 shows the growth appearance of golden seedling wild type and BRG 1-KO.

FIG. 8 shows the BRG1 expression level calculated by the average TPM of the transcriptome sequencing of millet Hemsl 1.

Detailed Description

The following detailed description of the invention is provided in connection with the accompanying drawings that are presented to illustrate the invention and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the invention in any way.

The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to techniques or conditions described in the literature in the field or according to the product specifications. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

The quantitative tests in the following examples were all performed in triplicate, and the results were averaged.

The millet variety Yugu1 (Yugu 1) in the examples below was stored in the laboratory and described in the literature "Ji. Phenotypic analysis of several mutants of millet ear development" [ J ]. North America agricultural journal, 2020,29 (11) ", which is available to the public from the applicant, and this biomaterial was used only for repeated experiments related to the invention and was not used for other purposes.

The millet variety golden seedling (HJ) in the examples below is stored in this laboratory and is described in the document "Li Chuanzong. Physiological basis of yellow in golden seedling millet seedling stage and initial localization of yellow seedling gene [ J ]. Programming of plant genetic resources, report 2020, (21): 05", the public is available from the applicant, and the biological material is used only for repeated experiments related to the invention and cannot be used for other purposes.

The rice variety Nippon in the examples described below is stored in this laboratory and is described in the document "Cheng Xiliu. INDETERMINATE spike 1 Recruits Histone Deacetylase and a Transc riptional Repression Complex to Regulate Rice Salt Tolerance [ J ]. Plant Physiol,2018, (178)," and is available to the public from the applicant, and this biomaterial is used only for repeated experiments in connection with the present invention and is not used for other purposes.

The rice variety Kitaake in The examples described below is stored in this laboratory and is described in The literature "Li. The sequence of 1504Mutants in The Model Rice Variety Kitaake Facilitate Rapid Func tional Genomic Studies[J" The Plant Cell,2017, (29): 1218. The public is available from The applicant, and this biological material is used only for repeated experiments related to The present invention and is not used for other purposes.

The rice variety Longjing 46 in the following examples is given away by a Lei Cailin researcher and is described in the document Huang Xiaoqun. Seed selection of a novel rice variety Longjing 46 [ J ]. North rice, 2022, (01), 52', the public is available from the applicant, and the biological material is only used for repeated experiments related to the invention and cannot be used for other purposes.

The cereal blast fungus HN-1 in the following examples is stored for this experiment and is described in the document "LI Zhi-jiang. Identification of blast-resistance loci through genome-wide association analysis in foxtail millet [ J ]. Journal of Integrative Agriculture,2021,20 (8): 2056", which is available to the public from the applicant, and this biological material is used only for repeated experiments related to the present invention and is not used for other purposes.

The rice blast fungus in the following examples is given away by Lei Cailin researchers and is described in the literature Lei Cailin. Research on physiological race and toxicity of rice blast and change dynamics thereof in northern japonica rice region [ J ]. Proc. Crop theory, 2000, (06) ", which is publicly available from the applicant, and the biological material is used only for repeated experiments related to the present invention and is not used for other purposes.

The Cas9MH backbone vector in the examples described below is a professor Liu Yaoguang, and is described in the literature "Liu YG.A Robust CRISPR/Cas9 System for Convenient, high-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants [ J ]. Mol Plant,2015,8 (8): 1274-84", available to the public from the applicant, and this biomaterial is used only for repeated experiments related to the invention and is not used for other purposes.

The pCAMBIA1305 backbone vector in the examples described below is a product of the general statin Biotechnology (Beijing) Inc. under the product catalog number Biovectorcammbia 1305.

The Agrobacterium tumefaciens EHA105 in the examples described below is a product of the biological technology Co., ltd. In Beijing, under the product catalog number 140384-10.

The following examples use SPSS11.5 statistical software to process the data, the experimental results are expressed as mean ± standard deviation, the One-way ANOVA test is used, the error bars represent mean ± SE (n > =3); * Represents a significant difference at a level of P.ltoreq.0.05, and represents a significant difference at a level of P.ltoreq.0.01.

Example 1 acquisition of BRG1 millet and Rice and disease resistance analysis

1.1 obtaining of millet and Rice by BRG1

1) Construction of pCAMBIA 1305:35S:BRG1 overexpression vector

In order to clone the broad-spectrum resistance gene in the plant period of the rice blast, 1440 parts of rice resources and variety materials are utilized in the early stage, points are distributed in main production areas of the whole country of the rice, and the resistance of the rice blast with the plant period of Tian Gu is investigated by different materials. Multi-point investigation data over many years show that farmhouse species golden seedlings are high in resistance to cereal blast in the adult stage. Therefore, golden seedlings are used as disease-resistant parents, disease-resistant isolates are constructed by hybridization with a disease-resistant material SK325, and the gene locus information is obtained through BSA mixed pool sequencing and fine positioning and forward positioning. The disease-resistant gene is named as BRG1, and after the BRG1 in the golden seedling is amplified, the disease-sensitive material is introduced to carry out transgenic function verification.

Replacing a fragment between NcoI and PmlI cleavage sites of a pCAMBIA1305 skeleton vector by using a CDS sequence of a BRG1 gene and a sequence of a tag protein Flag shown in a sequence 1, and keeping other nucleotide sequences of the pCAMBIA1305 from becoming pCAMBIA 1305:35 S:BRG 1-Flag over-expression vectors; the physical map is shown in figure 1 a.

The promoter sequence of the BRG1 gene shown in the sequence 2 is used for replacing the fragment (small fragment between XbaI and NcoI cleavage sites) between XbaI and NcoI cleavage sites of the pCAMBIA 1305:35 S:BRG 1-flag of the recombinant vector, and the other nucleotide sequences of the pCAMBIA 1305:pBRG1:BRG 1-flag are kept unchanged, so that the expression vector driven by the self promoter of the pCAMBIA 1305:pBRG1:BRG 1-flag is obtained. The amino acid sequence of the BRG1 protein is shown in sequence 3.

The general Ubi promoter sequence shown in the sequence 4 is used for replacing the XbaI and NcoI restriction sites of the pCAMBIA1305 skeleton vector to obtain the pCAMBIA 1305::: pUbi::: BRG1-GFP overexpression vector. The amino acid sequence of the BRG1 protein is shown in sequence 3.

Meanwhile, a CRISPR knockout target point is designed by using the BRG1 genome sequence shown in the sequence 5 (the design website is http:// CRISPR. Hzau. Edu. Cn/CRISPR2 /), and the knockout site sequence is AGATGCAGAAGATTGGCGA (371-390 positions of SEQ ID No. 5). And (3) connecting the knockout target point to BsaI enzyme cleavage site of the Cas9MH vector to obtain a CRISPR knockout vector Cas9MH-BRG1, wherein the map of the knockout vector Cas9MH-BRG1 is shown in the diagram B in figure 1.

2) Preparation of recombinant bacteria

The pCAMBIA1305::35S:: BRG1-flag, pCAMBIA1305:: pBRG1:: BRG1-flag, pCAMBIA1305:: pUbi::: BRG1-GFP overexpression vector, cas9MH-BRG1 knockout vector are transferred into the Agrobacterium tumefaciens EHA105 to obtain recombinant bacteria pCAMBIA 1305::: 35S:: BRG1-flag/EHA105, pCAMBIA 1305::: pBRG1::: BRG1-flag/EHA105, pCAMBIA1305:: pUbi::: BRG1-GFP/EHA105, cas9MH-BRG1/EHA105.

3) Obtaining and identifying BRG1 millet and rice

The recombinant bacterium pCAMBIA 1305::: ubi:: BRG1-GFP/EHA105 is used for infecting the high-inductance variety Ci846 of the millet by using an agrobacterium-mediated embryo callus infection method to obtain an over-expression material (No. ZJY-1) of the millet Ci846, and the transformation vector pCAMBIA1305 is used as a control to obtain the control material named Ci846-EV. pCAMBIA 1305:35S:BRG1-flag/EHA 105 infects Nipponbare, a rice susceptible variety, to obtain an overexpressed material of Nipponbare (No. ZJY-2). pCAMBIA 1305:::: ubi::: BRG1-GFP infects the rice susceptible variety Longjing 46 to obtain the over-expression material of the rice Longjing 46 (number ZJY-3). pCAMBIA 1300:pBRG1:BRG 1-flag/EHA105 infects rice disease-causing variety Kitaake to obtain self-promoter-driven expression material of rice Longjing 46 (number ZJY-4). Cas9MH-BRG1/EHA105 infects the resistant parent golden seedling to obtain the CRISPR knockout material of BRG 1. Genetic transformation, namely, callus is placed in a screening culture medium containing 60mg/L hygromycin, the budding condition of the callus is observed about 1 month, the budding callus is transferred to a rooting culture medium for continuous culture, and a PCR method and western blot are utilized to detect positive transgenic plants. And harvesting T1 generation transgenic seeds according to the strain, and then further dividing the strain for propagation culture until homozygous transgenic plant seeds are obtained.

The method for detecting the transgenic plants comprises the following steps: extracting genome DNA of the transgenic plant as a template, and carrying out PCR amplification by using a primer pC-F/pC-R to obtain 220bp plant which is positive and is used for transferring BRG1 millet and rice.

The results of PCR detection of the partially positive BRG 1-transformed millet and rice lines are shown in FIG. 2A. In FIG. 2, A is Ci846 over-expressed ZJY-1, B is Japanese sunny over-expressed ZJY-2, C is Longjing 46 over-expressed ZJY-3, and D is Kitaake self-promoter-driven expression ZJY-4. As can be seen from the figures: the target band can be amplified by positive BRG1 millet and rice lines.

Wherein, the nucleotide sequence of the primer is as follows:

pC-F：5'-ACGCACAATCCCACTAT-3'；

p-CR：5'-TTGCATGCCACATCAAGATCC-3'；

obtaining homozygous lines Ci846 over-expressed lines ZJY-1#7, #16 by selfing 2 generations; the Nipponbare overexpressing strain ZJY-2#12, #13; the Longjing tea 46 over-expression strain ZJY-3#1, #2; kitaake self promoter-driven over-expression lines ZJY-4#1, #2; gold seedling knocking-out material ZJY-5#1. The primers are used for identifying positive homozygous lines in transgenic T3 generation plants of millet and rice.

Western blot detection, namely taking 100mg transgenic plant leaves, boiling 0.3ml protein extract to extract denatured proteins, performing vertical electrophoresis in SDS-PAGE gel, transferring the protein level in the gel onto a nitrocellulose membrane by using a membrane transfer system, incubating the protein membrane by using a protein tag flag and a commercialized antibody (flag AE092; GFP AE012, abclon) corresponding to GFP, and then developing and observing the intensity and the size of the bands to judge the intensity of protein expression. Western blot results identified that ZJY-1#3 and ZJY-2#11, 12, 13 had higher protein accumulation levels (FIG. 3).

Positive BRG 1-transformed millet and rice homozygous lines were selected for the disease resistance analysis experiments described below.

The method for detecting the millet material of the gene editing knockout BRG1 comprises the following steps: genomic DNA of the transgenic plants was extracted, PCR amplification was performed using primers casF/casR, and the amplified products were sequenced using Sanger sequencing. The editing site of the BRG1 sequence is found to be mutated, so that translation is terminated in advance, and the BRG1 in the recipient plant is knocked out.

CasF：ATGGAGAAGCGGTTTGC；

CasR：CTTGCTACGGTTGCAGATGATG。

2.2 disease resistance analysis of millet and Rice transformed with BRG1

1) Analysis of disease resistance in field

In the natural environment of a field in a susceptible-to-pestilence producing area, taking control in a plant period and 2-3 leaves at the top of a transgenic material or leaves at the top of the transgenic material, or taking leaves with all leaf ages, and counting the ratio of the lesion area and the total leaf area on each leaf.

The field phenotype data show that the Ci846 infectious disease area reaches more than 80%, and the Ci846 over-expresses ZJY-1 infectious disease area is 2% at most (figure 3).

2) Disease resistance analysis of greenhouse artificial inoculation

The positive BRG1 millet, rice plants and control plants are sowed in nutrient soil at the same time under the conditions of 26 ℃ and 16h illumination/24 ℃/8h darkness and with the humidity maintained at 60 percent. When the plant grows to 3-4 leaf stage (1 month after sowing), it is transferred toThe humidity is above 85% and the temperature is 28 deg.C. Spores of the virulent Valley fever miniband HN-1 and the rice miniband LCL01 are respectively resuspended to 10 ³ And/ml, spraying on living plants. The experiments were divided into 4 groups, named millet Ci846, rice Nippon (NIP), rice Long Jing (LG 46) and rice Kitaake, respectively, by recipient plants. The incubation was continued for 7 days to count the phenotype. Or inoculating spore suspension by needle insertion, spreading leaf on 2% agar medium, and counting disease phenotype after 1 week. The disease phenotype is a statistical ratio of the area of the lesions on each leaf to the total leaf area.

NIP overexpressing material was essentially non-pathogenic, whereas control was severe (fig. 4). After the dragon round-grained nonglutinous 46 is subjected to over-expression needle insertion inoculation of pathogenic bacteria, the disease spots are not spread, and the wild type control is obviously spread (figure 5). The spread area of the lesions is small after the Titaake transgenic plants are inoculated by needle insertion, and the wild type spread is obvious (figure 6). It is shown that BRG1 can obviously promote the disease resistance of blast under the genetic background conditions of different species and different varieties.

3) Yield analysis of individuals

After harvesting the millet and rice material planted in the field, all the ears of each plant are collected, the weight of the whole ears is weighed, and the average value and variance of 15 whole plants are calculated.

4) Analysis of hundred grain weight

After harvesting the millet and rice material planted in the field, all the ears of each plant were collected, the weight of 100 seeds was weighed, and the average and variance of 15 plants were calculated.

5) Analysis of heading date

The day on which half of the plants in each row of the millet and rice material planted in the field were heading was recorded as the heading date, and the heading period was the number of days from the date of sowing to the heading date. The heading date of a single row of each plant line was recorded and the mean and variance calculated using the heading dates of the different plant lines. The results are shown in FIGS. 3-6:

FIG. 3 shows the detection results of the millet Ci846 over-expressed plants and wild type plants, and FIG. 3 shows that A shows the disease spots of Ci846 wild type, ci-846-EV (Ci 846 of the transformed skeleton vector) and the disease spots of Ci846 over-expressed materials in a greenhouse artificial inoculation disease resistance experiment, and as can be seen from FIG. 3A, the disease spots of wild type Ci846 and Ci-846-EV plants are more, and the disease spots of the over-expressed plants BRG1-OE #7 and the over-expressed plants BRG1-OE #16 are less than those of the wild type Ci846 and Ci-846-EV; b in fig. 3 is the spike profile of millet Ci846 wild type and overexpressing plants (specific numbering); in FIG. 3C is a statistical analysis of millet Ci846 wild type and overexpressing plants (OE#12, OE#11, OE#7), ear length, ear weight and hundred grain weight; the results show that: the shape and ear length of the BRG1 overexpressing plants and wild-type ears were not significantly different, but the ear weight and hundred grain weight of BRG1 overexpressing plants were significantly higher than that of wild-type plants.

FIG. 4 shows the detection results of the rice Nippon-sunny over-expressed plants and wild plants, A in FIG. 4 shows the disease spots of the greenhouse artificial inoculation disease resistance experiment of the Nippon-sunny wild type and over-expressed plants OE-11, OE-13 and OE-14, and as can be seen from FIG. 4, the surfaces of the over-expressed plants OE-11, OE-13 and OE-14 have no obvious disease spots, the wild type surface has a large number of disease spots, the disease resistance of the over-expressed plants is superior to that of the wild type, and the over-expressed BRG1 gene can improve the disease resistance of Nippon-sunny; B-D in FIG. 5 are the results of comparisons of ear weight, hundred grain weight and heading date for over-expressed plants and wild-type plants, respectively, showing that: the spike weight and hundred grain weight of the over-expression strain are obviously higher than those of the wild type strain, and the spike period of the over-expression strain and the wild type strain are not obviously different.

FIG. 5 shows the detection results of over-expressed plants and wild plants of Longjing 46 (LG 46), in FIG. 5A and B show the disease spots of the greenhouse artificial inoculation disease resistance experiment of the wild plants #1, #2 and #3 of Longjing 46, in FIG. 5A shows the affected photo, in FIG. 5B shows the statistical analysis of the disease spot area, in FIG. 5A and B, the disease spots on the leaf surfaces of the over-expressed plants #1, #2 and #3 are smaller than those on the leaf surfaces of the wild plants, the disease resistance of the over-expressed plants is superior to that of the wild plants, and the over-expressed BRG1 gene can improve the disease resistance of the Longjing 46; FIG. 5C shows plant shapes of wild-type and overexpressing Longjing 46 plants #1, #2; D-F in FIG. 5 are the results of the comparison of ear weight, hundred grain weight and heading date for the over-expressed and wild-type plants, respectively, showing that: the spike weight of the over-expression strain is obviously higher than that of the wild type strain, and the hundred grain weights and the spike period of the over-expression strain and the wild type strain are not obviously different.

FIG. 6 shows the detection results of Kitaake over-expressed plants and wild plants, FIG. 6A and B show the disease spot results of Kitaake wild type and over-expressed plants #1, #2 and #3 in a greenhouse artificial inoculation disease resistance experiment, FIG. 6A shows a disease-affected photo, FIG. 6B shows statistical analysis of disease spot area, and FIG. 6A and B show that the disease spots on the leaf surfaces of over-expressed plants #1, #2 and #3 are smaller than those on the leaf surfaces of wild type plants, the disease resistance of the over-expressed plants is superior to that of the wild type, and the over-expressed BRG1 gene can improve the disease resistance of Longjing 46; FIG. 6C shows plant shapes of wild-type and overexpressing Longjing 46 plants #1, #2; D-F in FIG. 6 are the results of the comparison of ear weight, hundred grain weight and heading date for the over-expressed and wild-type plants, respectively, showing that: the spike weight of the over-expression strain is obviously higher than that of the wild type strain, and the hundred grain weights and the spike period of the over-expression strain and the wild type strain are not obviously different.

FIG. 7 shows the results of resistance detection of homozygous materials of BRG1 knocked out by gene editing of a resistant parent golden seedling, HJ in FIG. 7 shows golden seedling wild type, A in FIG. 7 shows the susceptibility analysis of adult-stage golden seedling control flag leaves and BRG1-KO, B in FIG. 7 shows the susceptibility analysis of adult-stage golden seedling control top leaves and BRG1-KO, and C in FIG. 7 shows the growth appearance of golden seedling wild type and BRG 1-KO. The results indicate that the resistance of the resistant parent Huang Jinmiao is significantly reduced after BRG1 knockout, changing from Gu Wengao resistant material to high-feel material.

Example 2 tissue-specific expression of BRG1 Gene in millet

In order to verify the tissue-specific expression characteristics of the BRG1 gene in millet, the tissue-specific expression of the yucu 1 gene throughout the entire developmental cycle under normal growth conditions was analyzed using a transcriptome depth sequencing method. The method comprises the following specific steps:

2.1 extraction of RNA from crop tissue

Tissue (root, stem, leaf and ear) RNA was extracted by Trizol (Cat No.15596-026, invitrogen, scotland, UK) and purified by Purelink RNA Kit (Cat No.12183018, invitrogen, scotland, UK) to remove impurities and DNA fragments. The method comprises the following specific steps:

(1) Placing special tools for extracting RNA such as mortar, pestle, scissors and tweezers into a tray, spraying with 95% alcohol fire, calcining for about 5min, removing RNase, cooling, and pre-cooling in liquid nitrogen. The special operating platform for RNA extraction is firstly wiped clean by 75% alcohol and then sprayed with RNase Zap to remove RNase. In the whole RNA extraction operation process, clean experiment clothes, gloves and masks are worn, so that RNase in saliva and sweat is prevented from entering a sample to degrade RNA.

(2) And (3) rapidly weighing 0.1-0.15g of blades or other tissues, putting into a mortar containing liquid nitrogen, rapidly freezing, rapidly grinding for 1-2 times after the blades or other tissues become brittle, crushing the materials into powder, and fully grinding. In the process, liquid nitrogen is continuously supplemented to keep the low temperature, so that the degradation of RNA is reduced.

(3) The well-ground material was transferred to a 2mLRNase-free centrifuge tube to which 1mL of Trizol reagent had been added, and after shaking well, the mixture was placed on ice, and after all samples had been added to Trizol, the mixture was vortexed for 15s and allowed to stand at room temperature for 5min.

(4) 200. Mu.L of chloroform was added to each 1mL of Trizol, the mixture was vortexed and allowed to stand at room temperature for 2 to 3 minutes, and the mixture was centrifuged at 12000rpm for 15 minutes.

(5) The supernatant was transferred to a new 1.5mLRNase-free centrifuge tube, and an equal volume of 70% alcohol was added, thoroughly mixed and the resulting precipitate was dissolved.

(6) mu.L of the well-mixed sample was pipetted into the column of the Pure Link RNA Mini Kit kit and centrifuged at 12000rpm for 15s at room temperature and repeated 3-4 times until all samples passed through the column.

(7) To the filter column, 700. Mu.L of WBI was added and centrifuged at 12000rpm at room temperature for 15s, and the column was washed and the filtrate was discarded.

(8) The column was centrifuged at 12000rpm at room temperature for 15 seconds by adding 500. Mu.LWBII to the filter column, washing the column, discarding the filtrate, repeating the operation once, and centrifuging at 12000rpm for 2 minutes at room temperature to dry the column.

(9) The filter column was transferred to a new 1.5mL RNase-free centrifuge tube, 30-100. Mu. LRNase-free water was added, and the mixture was left at room temperature for 1min to dissolve RNA.

(10) RNA was collected by centrifugation at 12000rpm for 2min at room temperature. The extracted RNA can be immediately inverted into cDNA, and can be preserved at-20deg.C, or can be directly preserved at-80deg.C.

(11) Samples were assayed for OD260, OD280, OD320, OD260/OD280 and their concentrations using a NANODROP 1000. Only the OD260/OD280 ratio of the RNA sample is 1.9-2.1, and the OD260/OD230 ratio is more than or equal to 2.0, can the RNA sample be used for subsequent experiments.

(12) RNA quality was detected by 1% agarose gel electrophoresis, rapid electrophoresis. High quality RNA should have two bright and clear bands of 28S and 18S, and 28S is more than twice as bright as 18S.

2.2 inversion of RNA into cDNA

RNA was inverted into cDNA using a TaKaRa Primer Script II 1st Stand cDNA synthesis Kit (Cat No.6210A, takara, otsu Shiga, japan) reverse transcription kit. The method comprises the following specific steps:

(1) The following reagents were added to 200. Mu.L of RNase-free centrifuge tube: oligo dT (500. Mu.g/mL) 1. Mu.L, dNTP mix 1. Mu.L, total RNA 5. Mu.g, RNase Free dH2O to a total volume of 10. Mu.L.

(2) The tube was placed on PCR, reacted at 65℃for 5min, and then rapidly cooled on ice.

(3) The following reaction solutions were added to the centrifuge tube: 5X Prime Script TM Buffer. Mu.L, RNase Inhibitor (40U/. Mu.L) 0.5. Mu.L (20U), prime Script TM Rtase (200U/. Mu.L) 1. Mu.L (200U), RNase Free dH2O 4.5. Mu.L.

(4) Placing the centrifuge tube on a PCR instrument, reversing the centrifuge tube into cDNA according to the procedures of 42 ℃ reaction for 40min,70 ℃ reaction for 15min and 4 ℃ stop reaction, diluting the cDNA successfully reversing by 10 times, and then placing the cDNA at-20 ℃ for preservation.

2.3 detection of the differences in BRG1 Gene expression by sequencing the full-Length transcriptome pool

(1) The cDNA was disrupted with the FS enzyme of the abclon FS DNA Lib Prep Kit for Illumina V (RK 20236) pooling kit, comprising the following steps: adding 10 mu L of FS enzyme,9 mu L of buffer,40ng of cDNA into 60 mu L of total system, and breaking at 37 ℃ for 8-10 min; add 5. Mu.L of 3. Mu.M linker, 10. Mu.L of ligase, 60. Mu.L of reaction Mix, 30. Mu.L buffer to a total volume of 110. Mu.L, 22℃for 15min linker ligation; library PCR amplification after purification with AgencourtAmpure XP Beads.

TABLE 1 PCR reaction System

TABLE 2 PCR reaction procedure

Program name	Temperature (temperature)	Time
			Pre-denaturation	95℃	2min
Denaturation (denaturation)	95℃	1min
			Annealing	60℃	1min
Extension	72℃	Cycling 7cycles for 1min
			Total extension of	72℃	7min

As a result, as shown in the transcriptome sequencing data of the growth phase of Gu Ziquan in FIG. 8, BRG1 was expressed in a part of the tissue in the seedling phase of millet and stably expressed in all tissues in the adult plant phase. This expression pattern coincides with the expression of stable high resistance in the adult stage of golden seedlings, and the tissue expression specificity may be necessary for adult stage resistance.

The present invention is described in detail above. It will be apparent to those skilled in the art that the present invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with respect to specific embodiments, it will be appreciated that the invention may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The application of some of the basic features may be done in accordance with the scope of the claims that follow.

Claims

1. A protein, characterized in that: the protein is P1), P2) or P3) as follows:

p1), a protein having an amino acid sequence of SEQ ID No. 3;

p3), and a tag attached to the N-terminal and/or C-terminal of P1) or P2).

2. A biological material associated with the protein of claim 1, which is any one of the following B1) to B7):

b1 A nucleic acid molecule encoding the protein of claim 1;

b2 An expression cassette comprising the nucleic acid molecule of B1);

3. The biomaterial according to claim 2, characterized in that: b1 The nucleic acid molecule is a DNA molecule as shown in b 1) or b 2) below:

b2 A DNA molecule having 80% or more identity to the nucleotide sequence defined in b 1) and encoding the protein of claim 1.

4. Use of a protein or a substance regulating the expression of a gene encoding said protein or a substance regulating the activity or content of said protein, characterized in that: the application is any one of the following:

the protein of claim 1;

the substance regulating the expression of the protein-encoding gene or the substance regulating the activity or content of the protein is the biological material according to claim 2.

5. The use according to claim 4, characterized in that: the substance for regulating the expression of the protein coding gene or the substance for regulating the activity or content of the protein is a substance for increasing or up-regulating the expression of the protein coding gene or a substance for increasing or up-regulating the activity or content of the protein, and the substance for regulating the stress resistance of the plant is a substance for increasing the stress resistance of the plant.

6. Use according to claim 4 or 5, characterized in that: the plant is any one of the following:

c1 A monocot plant);

c2 Plants of the order gramineae);

c3 A gramineous plant);

c4 A plant of the genus oryza;

c5 Rice);

c6 A green bristlegrass genus;

c7 And millet).

7. A method for regulating stress resistance of a plant, comprising: the method comprises regulating plant stress resistance by regulating expression of a gene encoding the protein of claim 1 or regulating activity or content of the protein of claim 1.

8. The method according to claim 7, wherein: the method comprises introducing the coding gene of B1) in the application of claim 2 or 3 into a recipient plant, promoting or increasing the expression of the protein coding gene of claim 1 or the activity or content of the protein of claim 1, and obtaining the target plant with stress resistance higher than that of the recipient plant.

9. A method of growing a stress-resistant plant, comprising upregulating or promoting or increasing the expression level of a gene encoding the protein of claim 1 or 2 in a plant of interest, resulting in a plant with increased stress resistance, said plant with increased stress resistance being more stress-resistant than said plant of interest.

10. The method according to any one of claims 7-9, characterized in that: the plant is any one of the following:

c1 A monocot plant);

c2 Plants of the order gramineae);

c3 A gramineous plant);

c4 A plant of the genus oryza;

c5 Rice);

c6 A green bristlegrass genus;

c7 And millet).