CN117363660A - Method for constructing SMA mouse model - Google Patents

Abstract

The invention belongs to the fields of animal genetic engineering and genetic modification, and discloses a method for constructing an SMA mouse model, in particular to a method for constructing a Smn1 gene modified humanized animal model based on a homologous recombination technology and application of the model in biological medicine. Disclosed herein are non-human animals comprising a nucleic acid sequence encoding an SMN protein comprising a human gene sequence. Also disclosed herein are transgenic non-human animals comprising the SMN2 gene, wholly or partially human. Also disclosed are non-human animals expressing human or humanized SMN proteins. In addition, methods for making and using non-human animals comprising human or humanized SMN2 nucleic acid sequences are disclosed. The mouse obtained by the invention does not express the endogenous gene of the mouse Smn1 any more, and drives the transcriptional regulation of the full-length sequence of the human SMN2 under the regulatory element of the human SMN2, so that various sequences in treatment evaluation can completely target the SMN2 sequence of the human, and the related scientific research industry of spinal muscular atrophy can be promoted.

Description

Method for constructing SMA mouse model

Technical Field

The invention belongs to the fields of animal genetic engineering and genetic modification, and discloses a method for constructing an SMA mouse model.

Background

Spinal muscular atrophy (Spinal Muscular Atrophy; SMA) is an autosomal recessive genetic disease, mainly affecting the anterior horn of the spinal cord, and clinically manifested as progressive atrophy and weakness of limbs, extremely high mortality and disability rate. At present, the infant mortality rate is one of the most common hereditary neurological diseases, and the morbidity rate in newborns reaches 1/6000.

Infants with severe forms of SMA often die from respiratory disease due to the weakness of the muscles supporting breathing. Children with lighter forms of SMA survive longer, but they may require extensive medical support, especially for those patients at the more severe end of the spectrum of conditions. Clinical profiles of SMA disorders have been divided into the following five groups.

(a) Type 0 SMA (intrauterine SMA) is the most severe form of disease and begins before birth. Typically, the first symptom of type 0 SMA is a decrease in fetal movement that can be observed first between 30 and 36 weeks of gestation. After birth, these newborns rarely move and dysphagia and dyspnea.

(b) SMA type 1 (infant SMA or wei-Huo Ershi disease) develops symptoms in 0 to 6 months, which is also very severe. The patient is never able to sit up and, due to no respiratory support, death usually occurs in the first 2 years.

(c) The age of onset of type 2 SMA (transitional SMA) is 7-18 months. The patient can sit without support, but cannot stand or walk independently. The prognosis of this group depends largely on the degree of respiratory correlation.

(d) Type 3 SMA (juvenile SMA or Kugelberg-Welander disease) is usually diagnosed after 18 months. Type 3 SMA individuals are able to walk independently at certain times during the course of the disease, but typically rely on wheelchairs during young or adult life.

(e) Type 4 SMA (adult onset SMA). Weakness usually begins in the tongue, hands or feet in the late adolescence and then progresses to other areas of the body. Adult SMA processes are slower and have little or no effect on life expectancy.

The causative gene of SMA is the motor neuron survival gene (Survival motor neuron, SMN), and SMN gene maps have been obtained by linkage analysis of complex regions in chromosome 5 q. In humans, this region contains approximately 50 kilobase pair (kb) inverted copies, resulting in two nearly identical copies of the SMN gene. SMA is caused by inactivating mutations or deletions in telomere copies of the gene (SMN 1) in both chromosomes, resulting in loss of SMN1 gene function. However, all patients retained a centromere copy of the gene (SMN 2), and the copy number of the SMN2 gene in SMA patients was generally inversely related to disease severity; i.e. patients with less severe SMA have more copies of SMN 2. However, SMN2 cannot fully compensate for the loss of SMN1 function due to alternative splicing of exon 7 caused by a translationally silent C-to-T mutation in exon 7. Thus, most transcripts produced by SMN2 lack exon 7 (Δ7smn2) and encode truncated SMN proteins that have impaired function and are rapidly degraded.

SMN proteins are thought to play a role in RNA processing and metabolism, with well-identified functions that mediate the assembly of a specific class of RNA-protein complexes known as snrnps. In motor neurons, SMN may have other functions, however, its role in preventing selective degeneration of motor neurons has not been well established.

The use of animal models helps to drive the potential therapeutic approach associated with SMA further into clinical trials, and many studies have increased the SMN full length protein to improve SMA symptoms, such as ASO antisense oligonucleotides, for correction of SMN2 gene splicing. However, only the Smn1 gene is present in mice, and no Smn2 gene similar to the human Smn2 gene is present, so these sequences are not targeted to mice.

Accordingly, there is a need for a non-human animal, e.g., a rodent, e.g., a murine, e.g., a mouse or a rat, wherein the Smn1 gene of the non-human animal is replaced in whole or in part with a human Smn2 gene, or with a human Smn2 gene comprising a sequence encoding a human or humanized Smn protein, respectively (e.g., at an endogenous non-human locus).

There is also a need for a non-human animal comprising an SMN2 gene (e.g. humanized or human) in which the SMN2 gene is under the control of a human regulatory element (e.g. a human regulatory element).

There is also a need for a humanized non-human animal that expresses a human or humanized SMN protein, the SMN1 gene of which is replaced in whole or in part with a human SMN2 gene, the SMN2 gene being under the control of a human regulatory element (e.g., a human regulatory element). Since most transcripts produced by SMN2 lack exon 7 (Δ7smn2) and encode truncated SMN proteins that have impaired function and are rapidly degraded, only a small number of transcripts express full-length functional SMN proteins, and thus non-human animals exhibit SMA phenotypes.

Several mouse models of SMA have been developed. Specifically, the smnΔexon 7 (Δ7smn) model (Le et al, hum. Mol. Genet.,2005, 14:845) carries several copies of the SMN2 gene and Δ7smn2cDNA and reproduces various phenotypic characteristics of SMA type 1. The Δ7SMN model can be used for SMN2 expression studies and for the assessment of motor function and survival. However, the model needs to construct two strains, one is a Smn1 gene knockout and the other is a SMN2 transgenic model, and the model with the SMA phenotype can be obtained through hybridization of the two strains. The C/C-allele mouse model (Jackson Laboratory strain #008714,The Jackson Laboratory,BarHarbor,ME) provided a model of SMA disease using mice with reduced levels of both full length SMN2 (FL SMN 2) mRNA and SMN protein. However, the C/C-allele mouse phenotype has the SMN2 gene and the alternatively spliced mixed mSMN1-SMN2 gene, and the SMN protein has the human-mouse chimeric phenomenon.

Disclosure of Invention

In response to the deficiencies of the prior art, a method of constructing an SMA non-human animal is disclosed herein. Disclosed herein are non-human animals comprising a nucleic acid sequence encoding an SMN protein comprising a human gene sequence. Also disclosed herein are transgenic non-human animals comprising the SMN2 gene, wholly or partially human. Also disclosed are non-human animals expressing human or humanized SMN proteins. In addition, methods for making and using non-human animals comprising human or humanized SMN2 nucleic acid sequences are disclosed.

The invention comprises the following technical scheme:

a method of constructing a SMA mouse model comprising the steps of:

preparing a genetically engineered mouse using mouse ES embryonic stem cells to replace the mouse full-length SMN1 locus with a 47.9kb human SMN2 genomic sequence;

(1) Constructing a targeting vector I, wherein the targeting vector comprises a 5arm homology arm sequence, a Puro resistance screening element and a 3arm homology arm, wherein two sides of Puro are respectively provided with a loxP and a lox511 element, and the homology arm sequence is obtained by amplifying a genome of a C57BL/6 mouse;

(2) Constructing a targeting Bac vector II, inserting a loxP recombinase site in the same direction as the targeting vector I at a 15kb position on the upstream of the human SMN2 gene, and inserting a lox511 recombinase site in the same direction as the targeting vector I at a 5kb position on the downstream of the human SMN2 gene; and a Neo resistance screening element is included between the human SMN2 gene and lox511, wherein BAC is RP11-1012N14;

(3) Electrotransferring the constructed targeting vector I into ES cells of a C57BL/6 strain, screening the cells by a Puromycin drug, selecting drug-resistant ES clones, culturing and amplifying related ES clones, and then carrying out PCR typing identification and Southern identification to obtain positive ES cells I which are correctly targeted;

(4) The constructed Bac vector II is electrically transferred into ES cells I, the cells are screened by G418 drugs, ES clones with drug resistance are selected, and the relevant ES clones are cultured and amplified and then subjected to PCR typing identification and Southern identification to obtain positive ES cells II with correct targeting;

(5) Injecting positive ES cells II into blastula, transplanting blastula into a surrogate mouse, and birth of the mouse through pregnancy;

(6) Cutting the paw of a young mouse, extracting DNA, and carrying out PCR typing identification to confirm the genotype of the mouse;

(7) Mating a male foundation mouse with a wild-type heterologous mouse to obtain an F1 generation heterozygote mouse, and carrying out PCR identification after birth on the mouse, wherein if a positive mouse is born, the transgene is integrated into germ cells;

(8) Male F1 mice and female F1 mice were bred with each other, and F2 mice were identified by post-natal PCR to confirm the birth of homozygous mice, thereby obtaining SMA mouse models.

Further, the method for constructing the SMA mouse model further comprises any one of the following preferable step parameters:

in the step (5), the pregnancy period is about 20 days;

in the step (6), the young mouse paws of 5-7d are cut off in the step (6), DNA is extracted, and PCR typing identification is carried out to confirm the genotype of the mouse;

in the step (7), the male foundation mice are mated with wild-type foreign mice to obtain F1 generation heterozygote mice after 7 days of birth, and PCR identification is carried out on the mice;

in the step (8), the male F1 mice are bred with each other after being 8 weeks old and the female F1 mice are 6 weeks old, and the F2 mice are identified by PCR 7 days after being born.

Furthermore, the method for constructing the SMA mouse model further comprises the step (9) of performing phenotypic analysis on the SMN2 homozygous mice and analyzing the survival, the body length and other characteristics of the mice.

Further, the method for constructing the SMA mouse model, wherein the step (1) comprises the following specific steps:

PCR amplification is carried out by taking wild C57BL/6 mouse genome DNA as a template to obtain a5 '-end homologous arm fragment and a 3' -end homologous arm fragment; simultaneously synthesizing loxP-Puro-lox511 resistance screening sequence;

5' homology arm: the positioning of the nucleotide is chr13:100,110,478-100,115,238 in a mouse mm10 database; designing an upstream primer as shown in SEQ ID NO. 2; the downstream primer is shown as SEQ ID NO. 3;

3' homology arm: the positioning of the nucleotide is chr13:100,138,191-100,141,017 in a mouse mm10 database; designing an upstream primer shown as SEQ ID NO. 4, and designing a downstream primer shown as SEQ ID NO. 5;

the 5 '-end homology arm fragment, the 3' -end homology arm fragment and the loxP-Puro-lox511 resistance screening sequence are connected to the PUC57 plasmid through INFUION connection, and finally the targeting vector I is obtained.

Furthermore, in the method for constructing the SMA mouse model, the nucleotide sequence of the loxP-Puro-lox511 resistance screening sequence in the step (1) is shown as SEQ ID NO. 1.

Further, in the above method for constructing a mouse model of SMA, in the step (3),

and (3) respectively using 3 pairs of primers to carry out PCR analysis and identification on the genome DNA of the ES cells obtained in the step (3):

1F1 (SEQ ID NO: 6) is located outside the 5' homology arm;

1R1 (SEQ ID NO: 7) is located on the Puro element;

2F2 (SEQ ID NO: 8) on the Puro element;

2R2 (SEQ ID NO: 9) is located on the 3' homology arm;

1F3 (SEQ ID NO: 10) is located on the 5' homology arm;

the 1F1-1R1 primer product had a length of 4914bp, the 2F2-2R2 primer product had a length of 342bp, and the 1F3-1R1 primer product had a length of 209bp.

Further, in the above method for constructing a mouse model of SMA, in the step (4),

performing PCR analysis and identification on the ES cell genome DNA obtained in the step (4) by using 5 pairs of primer pairs respectively:

f1 (SEQ ID NO: 15) and R1 (SEQ ID NO: 16) are located on the human or murine genome flanking the loxP; f2 (SEQ ID NO: 17) on the Neo-resistance element;

r2 (SEQ ID NO: 18) is located on the murine genome outside lox 511;

f3 (SEQ ID NO: 19), R3 (SEQ ID NO: 20), F4 (SEQ ID NO: 21), R4 (SEQ ID NO: 22), F5 (SEQ ID NO: 23), R5 (SEQ ID NO: 24) are located on the inserted human genome;

the F1R1 primer product had a length of 353bp, the F2R2 primer product had a length of 553bp, the F3R3 primer product had a length of 270bp, the F4R4 primer product had a length of 589bp, and the F5R5 primer product had a length of 231bp.

Further, in the above method for constructing SMA mouse model, in the step (7), PCR analysis is performed on mouse rat tail genomic DNA using 5 pairs of primers, respectively;

f1 (SEQ ID NO: 15) and R1 (SEQ ID NO: 16) are located on the human or murine genome flanking the loxP;

f6 (SEQ ID NO: 25) located on a human genome;

r2 (SEQ ID NO: 18) is located on the murine genome outside lox 511;

f3 (SEQ ID NO: 19), R3 (SEQ ID NO: 20), F4 (SEQ ID NO: 21), R4 (SEQ ID NO: 22), F5 (SEQ ID NO: 23), R5 (SEQ ID NO: 24) are located on the inserted human genome; f7 (SEQ ID NO: 26) on the murine genome;

the F1R1 primer product length was 353bp, the F6R2 primer product length was 274bp, the F3R3 primer product length was 270bp, the F4R4 primer product length was 589bp, the F5R5 primer product length was 231bp, and the F7R2 primer product length was 363bp, wherein the F7R2 amplification product was used to identify the wild type band.

Further, in the above method for constructing an SMA mouse model, in the step (8), PCR analysis is performed using 2 pairs of primer pairs to the rat tail genomic DNA of the F2-generation mouse, respectively,

primer F1 (SEQ ID NO: 15) and R1 (SEQ ID NO: 16) are located on the human or murine genome flanking the loxP,

f7 (SEQ ID NO: 26) on the murine genome;

r2 (SEQ ID NO: 18) is located on the murine genome outside lox 511;

the F1R1 primer product was 353bp in length and could not be detected in wild-type mice; F7R2 had a product length of 363bp in wild-type mice, but was undetectable in homozygous mice.

Furthermore, the invention also discloses application of the method for constructing the SMA mouse model in developing medicaments for treating/preventing spinal muscular atrophy.

The invention has the following beneficial effects:

1. the technology adopts homologous recombination technology and recombinase-mediated cassette exchange RMCE technology to replace the full length of the mouse Smn1 gene to the full length of the human SMN2 gene, the full length is realized in ES cells through two-step targeting, and then heterozygote male and female mice are matched with each other to obtain homozygous mice with SMA phenotype, the SMA phenotype is stable, and the method does not need to carry out Foundation screening of transgenic technology and construction of hybridization of various strains, and the construction period and breeding period are shorter than those of the existing strains, so that the method has low cost and can be rapidly put into research;

2. the mouse obtained by the technology does not express the endogenous gene of the mouse Smn1 any more, the transcription regulation of the full-length sequence of the human SMN2 is driven under the regulatory element of the human SMN2, and the chimeric SMN protein of the human mouse does not exist, so that various sequences in treatment evaluation can be completely targeted to the sequence of the human SMN 2.

Drawings

Fig. 1: vector map of targeting vector I in example 1;

fig. 2: vector profile of targeting vector II in example 2;

FIG. 3; the PCR reaction system (25. Mu.L) in example 6;

fig. 4: genotyping PCR identification of ES cell I in example 6;

fig. 5: southern identification of ES cell I in example 6, WT, 2B5,2B7,2B10, 2D3, in order from left to right;

fig. 6: the results of the genotype PCR identification of ES cells II in example 6;

fig. 7: southern identification of ES cell II in example 6 was followed by WT, 2D3-1A12,2D3-2B9,2D3-2D4 and 2B5-2C6 in that order from left to right;

fig. 8: genotyping results for the F1 generation in example 6;

fig. 9: the result of genotyping of the Fn generation in example 6;

fig. 10: characterization of genetically engineered mice in example 7.

Detailed Description

The following description of the technical solutions in the embodiments of the present invention will be clear and complete, and it is obvious that the described embodiments are only some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention. The appropriate amount of the invention is determined by one of ordinary skill in the art according to national technical specifications and practical production conditions. The raw materials described in the present invention are commercially available unless otherwise specified.

Examples

Construction of vector I

The upstream primer of the 2-segment homologous recombination fragment and the downstream primer matched with the upstream primer and the related sequence are designed. The method comprises the following steps: PCR amplification is carried out by taking wild C57BL/6 mouse genome DNA as a template to obtain a5 '-end homologous arm fragment and a 3' -end homologous arm fragment; a loxP-Puro-lox511 resistance screening sequence (SEQ ID NO: 1) was also synthesized.

1= tggcttctggaagctgagctcataacttcgtatagcatacattatacgaagttatgaattcctcgagccccagctggttctttccgcctcagaagccatagagcccaccgcatccccagcatgcctgctattgtcttcccaatcctcccccttgctgtcctgccccaccccaccccccagaatagaatgacacctactcagacaatgcgatgcaatttcctcattttattaggaaaggacagtgggagtggcaccttccagggtcaaggaaggcacgggggaggggcaaacaacagatggctggcaactagaaggcacagtcgaggctgatcagcgagctctagagctcaggcaccgggcttgcgggtcatgcaccaggtgcgcggtccttcgggcacctcgacgtcggcggtgacggtgaagccgagccgctcgtagaaggggaggttgcggggcgcggaggtctccaggaaggcgggcaccccggcgcgctcggccgcctccactccggggagcacgacggcgctgcccagacccttgccctggtggtcgggcgagacgccgacggtggccaggaaccacgcgggctccttgggccggtgcggcgccaggaggccttccatctgttgctgcgcggccagccgggaaccgctcaactcggccatgcgcgggccgatctcggcgaacaccgcccccgcttcgacgctctccggcgtggtccagaccgccaccgcggcgccgtcgtccgcgacccacaccttgccgatgtcgagcccgacgcgcgtgaggaagagttcttgcagctcggtgacccgctcgatgtggcggtccgggtcgacggtgtggcgcgtggcggggtagtcggcgaacgcggcggcgagggtgcgtacggcccgggggacgtcgtcgcgggtggcgaggcgcaccgtgggcttgtactcggtccccatggtggcgttggctgcaggtcgaaaggcccggagatgaggaagaggagaacagcgcggcagacgtgcgcttttgaagcgtgcagaatgccgggcctccggaggaccttcgggcgcccgccccgcccctgagcccgcccctgagcccgcccccggacccaccccttcccagcctctgagcccagaaagcgaaggagcaaagctgctattggccgctgccccaaaggcctacccgcttccattgctcagcggtgctgtccatctgcacgagactagtgagacgtgctacttccatttgtcacgtcctgcacgacgcgagctgcggggcgggggggaacttcctgactaggggaggagtagaaggtggcgcgaaggggccaccaaagaacggagccggttggcgcctaccggtggatgtggaatgtgtgcgaggccagaggccacttgtgtagcgccaagtgcccagcggggctgctaaagcgcatgctccagactgccttgggaaaagcgcctcccctacccggtagaattaattcgatatcaagctgaatcgatgatttaaatgtcgacgatgggccctggtaccataacttcgtatagtatacattatacgaagttatcacagcagcaaatgcaactactacca5' homology arms (4761 bp) of SEQ ID NO: the mouse mm10 database was mapped to chr13:100,110,478-100,115,238 nucleotides, the upstream primer (SEQ ID NO: 2); the downstream primer (SEQ ID NO: 3). 3' homology arm (2827 bp): the positioning of the nucleotide is chr13:100,138,191-100,141,017 in a mouse mm10 database; an upstream primer (SEQ ID NO: 4), and a downstream primer (SEQ ID NO: 5).

The 5 '-end homology arm fragment, the 3' -end homology arm fragment and the loxP-Puro-lox511 resistance screening box are connected to the PUC57 plasmid through INFUION connection, and finally the targeting vector I is obtained, and the vector map is shown in figure 1.

SEQ ID NO:2：5’-atctagctgtcgcgaagagtggcgcgccacacgcctgggctcttgtcttta-3’

SEQ ID NO:3：5’-GCGGAAAGAACCAGCTGGGGCTCGAGGAATTCATAACTTCGTATAATGTATGCTATACGAAGTTATGAGCTCAGCTTCCAGAAGCCA-3’

SEQ ID NO:4:5’-aaatgtcgacgatgggccctggtaccataacttcgtatagtatacattatacgaagttatcacagcagcaaatgcaactactacca-3’

SEQ ID NO:5:5’-CTATAGGGCGAATTGGGTACGCGGCCGCTTGGTTTAGTCAATGACTGCGCTGC-3’

Example 2

Construction of vector II

BAC: RP11-1012N14 was obtained from the BACPAC resource center (BPRC) comprising a human genomic sequence (located in the human hg19 database as chr5:69,248,687-69,428,698); performing BAC modification on RP11-1012N14, inserting loxP recombinase sites in the same direction as the targeting vector I at 15kb at the upstream of the human SMN2 gene, and inserting lox511 recombinase sites in the same direction as the targeting vector I at 5kb at the downstream of the human SMN2 gene; a Neo resistance screening element is introduced between the human SMN2 gene sequence and lox511, and the Neo is provided with recombinase sites different from loxP and lox511 at two ends, and the vector map is shown in figure 2.

Example 3

ES cell electrotransformation

40ug of the targeting vector plasmid obtained in example 1 was extracted and electroporated into the ES cell line of the C57BL/6 strain, and after 24 hours of cell electrotransfection, the ES medium containing the Puromycin resistance drug was replaced. The ES cells were observed daily for 7 consecutive days, and fresh ES medium containing the drug for resistance was changed daily. On day 8, a well-conditioned, moderately large monoclonal pool was selected, and the clones were subjected to cell culture and subsequent genotyping and Southern identification.

Example 4

ES cell electrotransformation

40ug of the targeting vector BAC plasmid obtained in example 2 was extracted and electrotransferred into the positive ES cells obtained in example three, and after 24 hours of cell electrotransfer, the ES medium containing the G418 resistant drug was replaced. The ES cells were observed daily for 7 consecutive days, and fresh ES medium containing the drug for resistance was changed daily. On day 8, a well-conditioned, moderately large monoclonal pool was selected, and the clones were subjected to cell culture and subsequent genotyping and Southern identification.

Example 5

Microinjection and embryo transfer

Taking blastocysts of albino C57BL/6 mice, injecting positive cells obtained in the example 4 into the blastocysts, and then transplanting the blastocysts into oviducts of recipient mice to produce genetically modified humanized mice to obtain first-established mice (namely foundation mice, F0 generation) with the C57BL/6 background. The obtained mice are crossed and selfed to expand population quantity, and stable mouse strains are established.

Example 6

Identification of genetically modified humanized cells and mice

1. ES cell I genotyping and Southern identification

PCR analysis and identification were performed on the ES cell genomic DNA obtained in example 3 using 3 pairs of primers, respectively: primer position 1F1 (SEQ ID NO: 6) is located outside the 5' homology arm and 1R1 (SEQ ID NO: 7) is located on the Puro element; 2F2 (SEQ ID NO: 8) on the Puro element and 2R2 (SEQ ID NO: 9) on the 3' homology arm; 1F3 (SEQ ID NO: 10) is located on the 5' homology arm.

1F1(SEQ ID NO:6)：5’-ATAGAATAAGAAACCTGGGAGGCTG-3’

1R1(SEQ ID NO:7)：5’-TGGGGCTCGAGGAATTCATAAC-3’

2F2(SEQ ID NO:8):5’-CTTCCTGACTAGGGGAGGAGTAG-3’

2R2(SEQ ID NO:9):5’-ATGGCTTCTAACGGACAGAACAC-3’

1F3(SEQ ID NO:10):5’-GAGTTAGTTCTTACCCTCTGCCTC-3’

The PCR reaction system (25. Mu.L) is shown in FIG. 3

The 1F1-1R1 primer product length should be 4914bp, the 2F2-2R2 primer product length should be 342bp, and the 1F3-1R1 primer product length should be 209bp.

Among the 96 clones obtained, 5 clones were identified as positive clones, and the PCR identification results are shown in FIG. 4.

Further, 4 clones (2B5,2B7,2B10 and 2D 3) positive for PCR were confirmed by the Southern blot method.

The EcoNI enzyme is selected to digest genome, transfer membrane and hybridization. Probes were located on the outside segments of the 5' homology arms, respectively. The probe synthesis primers are respectively as follows: P1-F (SEQ ID NO: 11), P1-R (SEQ ID NO: 12).

P1-F(SEQ ID NO:11)：5'-GAAGAATGCCACGCCCTGAAACTAT-3'

P1-R(SEQ ID NO:12)：5'-GTGCTGGCCTGAGTAGCATAACATCT-3'

The successfully prepared genetically engineered cells are respectively generated by probe hybridization:

5' probe 10.50kb-MT (with EcoNI digestion). Whereas the wild type C56BL/6 mouse genome has only a 12.91kb band, no hybridization band is generated

AflII enzyme is selected to digest genome, transfer membrane and hybridization. Probes were located on the outside segments of the 3' homology arms, respectively. The probe synthesis primers are respectively as follows: P2-F (SEQ ID NO: 13), P2-R (SEQ ID NO: 14).

P2-F(SEQ ID NO:13)：5'-ATGGGCAGTGCTAGTCATCAAACCC-3'

P2-R(SEQ ID NO:14)：5'-AGAGGAGTTCAGAACAGGAAGCCTG-3'

The successfully prepared genetically engineered cells are respectively generated by probe hybridization:

3' Probe:10.38kb-MT (with AflII digestion). Whereas the wild-type C56BL/6 mouse genome has only a 7.99kb band, no hybridization band is generated

The experimental results showed that the hybridization band sizes were all consistent with the expectations, confirming that 4 clones were positive and that no random inserts were present, numbered 2B5,2B7,2B10 and 2D3, respectively. The Southern blot detection results are shown in FIG. 5.

Genotyping and Southern identification of ES cells II

PCR analysis and identification were performed on the ES cell genomic DNA obtained in example 4 using 10 pairs of primers, respectively: primer position F1 (SEQ ID NO: 15) and R1 (SEQ ID NO: 146) are located on the human or murine genome flanking loxP; f2 (SEQ ID NO: 17) on the Neo-resistance element, R2 (SEQ ID NO: 18) on the murine genome outside lox 511; f3 (SEQ ID NO: 19), R3 (SEQ ID NO: 20), F4 (SEQ ID NO: 21), R4 (SEQ ID NO: 22), F5 (SEQ ID NO: 23), R5 (SEQ ID NO: 24) are located on the inserted human genome.

F1(SEQ ID NO:15)：5’-GAGTTAGTTCTTACCCTCTGCCTC-3’

R1(SEQ ID NO:16)：5’-CCGATAATTTTTCCGCCTGCTT-3’

F2(SEQ ID NO:17):5’-TTCGCCATTCCGCTGATTCT-3’

R2(SEQ ID NO:18):5’-ATGGCTTCTAACGGACAGAACAC-3’

F3(SEQ ID NO:19):5’-TGCAGCTTATGCAGTTTTTGTCT-3’

R3(SEQ ID NO:20):5’-GGCATTATCTAAGAGGGTGCTG-3’

F4(SEQ ID NO:21):5’-TACTTGTTTCCTGGTCTGGCAAT-3’

R4(SEQ ID NO:22):5’-GGTTACATTCGCACTTGGAAGGG-3’

F5(SEQ ID NO:23):5’-ACTTAACTGGTTGGTTGTGTGGA-3’

R5(SEQ ID NO:24):5’-TAGAACCAGAGGCTTGACGAAT-3’

The F1R1 primer product should be 353bp in length, the F2R2 primer product should be 553bp in length, the F3R3 primer product should be 270bp, the F4R4 primer product should be 589bp, and the F5R5 primer product should be 231bp.

Out of the 180 clones obtained, 6 clones were identified as positive clones, and the PCR identification results are shown in FIG. 6.

Further, 5 clones (2D 3-1A12,2D3-2B9,2D3-2C2,2D3-2D4 and 2B5-2C 6) positive for PCR were confirmed by using the Southern blot method.

The genome is digested by EcoRV enzyme, transferred to membrane and hybridized. Probes were located on the outside segments of the 5' homology arms, respectively. The probe synthesis primers are respectively as follows: P1-F (SEQ ID NO: 25), P1-R (SEQ ID NO: 26).

P1-F(SEQ ID NO:25)：5'-GAAGAATGCCACGCCCTGAAACTAT-3'

P1-R(SEQ ID NO:26)：5'-GTGCTGGCCTGAGTAGCATAACATCT-3'

The successfully prepared genetically engineered cells are respectively generated by probe hybridization:

5' probe 14.42kb-MT (with EcoNI digestion). Whereas the wild type C56BL/6 mouse genome has only 16.42kb band, no hybridization band is generated

The genome is digested by MfeI and KpnI enzymes, transferred to a membrane and hybridized. Probes were located on the outside segments of the 3' homology arms, respectively. The probe synthesis primers are respectively as follows: P2-F (SEQ ID NO: 27), P2-R (SEQ ID NO: 28).

P2-F(SEQ ID NO:27)：5'-ATGGGCAGTGCTAGTCATCAAACCC-3'

P2-R(SEQ ID NO:28)：5'-AGAGGAGTTCAGAACAGGAAGCCTG-3'

The successfully prepared genetically engineered cells are respectively generated by probe hybridization:

3' Probe:8.81kb-MT (with AflII digestion). Whereas the wild type C56BL/6 mouse genome has only a 5.28kb band, no hybridization band is generated

The experimental results showed that the hybridization band sizes were all consistent with the expectations, confirming that 4 clones were positive clones and that no random inserts were present, numbered 2D3-1A12,2D3-2B9,2D3-2D4 and 2B5-2C6, respectively. The Southern blot detection results are shown in FIG. 7.

3. Chimeric rate analysis of F0 mice

The F0 mice obtained in example 5 were observed for chimerism from the hair color, and all the birth mice were male mice, and the chimerism was as shown in Table 1 below.

TABLE 1 chimeric Rate of F0 mice

As can be seen from Table 1, the chimerism rate was approximately 100%, indicating that positive ES cells developed into positive mice.

4. Genotyping of F1 generation

F0 mice were bred with wild type mice to obtain F1 mice. PCR analysis was performed on F1 rat tail genomic DNA. PCR analysis was performed on mouse rat tail genomic DNA using 5 pairs of primers, respectively, with primer positions F1 (SEQ ID NO: 15) and R1 (SEQ ID NO: 16) on the human or murine genome flanking the loxP; f6 (SEQ ID NO: 25) located on the human genome and R2 (SEQ ID NO: 18) located on the murine genome outside lox 511; f3 (SEQ ID NO: 19), R3 (SEQ ID NO: 20), F4 (SEQ ID NO: 21), R4 (SEQ ID NO: 22), F5 (SEQ ID NO: 23), R5 (SEQ ID NO: 24) are located on the inserted human genome and F7 (SEQ ID NO: 26) is located on the murine genome. Wherein the same primer as that used for the identification of F0 generation mice was used for PCR analysis of the rat tail genomic DNA of Fn generation mice.

F1(SEQ ID NO:15)：5’-GAGTTAGTTCTTACCCTCTGCCTC-3’

R1(SEQ ID NO:16)：5’-CCGATAATTTTTCCGCCTGCTT-3’

F6(SEQ ID NO:25):5’-GTGGACTCTTTTTGGTTGGTAAGC-3’

R2(SEQ ID NO:18):5’-ATGGCTTCTAACGGACAGAACAC-3’

F3(SEQ ID NO:19):5’-TGCAGCTTATGCAGTTTTTGTCT-3’

R3(SEQ ID NO:20):5’-GGCATTATCTAAGAGGGTGCTG-3’

F4(SEQ ID NO:21):5’-TACTTGTTTCCTGGTCTGGCAAT-3’

R4(SEQ ID NO:22):5’-GGTTACATTCGCACTTGGAAGGG-3’

F5(SEQ ID NO:23):5’-ACTTAACTGGTTGGTTGTGTGGA-3’

R5(SEQ ID NO:24):5’-TAGAACCAGAGGCTTGACGAAT-3’

F7(SEQ ID NO:26):5’-CCAAGGCGTGTTGTGGTTTTG-3’

The F1R1 primer product should be 353bp in length, the F6R2 primer product should be 274bp in length, the F3R3 primer product should be 270bp in length, the F4R4 primer product should be 589bp in length, the F5R5 primer product should be 231bp in length, and the F7R2 primer product should be 363bp in length. Wherein the F7R2 amplification product is used to identify wild-type bands.

A total of 3 mice out of 16 mice born were identified as heterozygous mice, and the PCR identification results are shown in FIG. 8.

4. Fn generation genotyping

Mice identified as positive for F1 were mated to each other to give Fn-generation mice. PCR analysis was performed on the Fn-generation rat tail genomic DNA. PCR analysis was performed using 2 pairs of primers, primer F1 (SEQ ID NO: 15) and R1 (SEQ ID NO: 16) are located on the human or murine genome flanking loxP, F7 (SEQ ID NO: 26) is located on the murine genome, and R2 (SEQ ID NO: 18) is located on the murine genome outside lox 511.

F1(SEQ ID NO:15)：5’-GAGTTAGTTCTTACCCTCTGCCTC-3’

R1(SEQ ID NO:16)：5’-CCGATAATTTTTCCGCCTGCTT-3’

R2(SEQ ID NO:18):5’-ATGGCTTCTAACGGACAGAACAC-3’

F7(SEQ ID NO:26):5’-CCAAGGCGTGTTGTGGTTTTG-3

The F1R1 primer should be 353bp in length, undetectable in wild-type mice, and F7R2 in wild-type mice 363bp in length, undetectable in homozygous mice

Of the 4 Fn-generation mice obtained, 37# mice were identified as homozygous mice, 38# and 39# as heterozygous mice, and 40# as negative mice; the PCR identification results are shown in FIG. 9.

Example 7

The Fn-generation homozygous mice and heterozygous mice obtained in example 5 were subjected to phenotypic analysis.

After the mice were anesthetized, phenotypic observations were performed and the experimental results were shown (see fig. 10). 50% of mice die at 4 weeks of age, and homozygous mice have reduced body types, tail breakage occurs, and more than 4 weeks of survival of mice have toe necrosis.

The above embodiments are only preferred embodiments of the present invention, and the scope of the present invention is not limited thereto, i.e. the present invention is not limited to the above embodiments, but is capable of being modified and varied in all ways according to the following claims and the detailed description.

Claims (10)

1. A method of constructing a mouse model of SMA comprising the steps of:

preparing a genetically engineered mouse using mouse ES embryonic stem cells to replace the mouse full-length SMN1 locus with a 47.9kb human SMN2 genomic sequence;

(1) Constructing a targeting vector I, wherein the targeting vector comprises a 5arm homology arm sequence, a Puro resistance screening element and a 3arm homology arm, wherein two sides of Puro are respectively provided with a loxP and a lox511 element, and the homology arm sequence is obtained by amplifying a genome of a C57BL/6 mouse;

(2) Constructing a targeting Bac vector II, inserting a loxP recombinase site in the same direction as the targeting vector I at a 15kb position on the upstream of the human SMN2 gene, and inserting a lox511 recombinase site in the same direction as the targeting vector I at a 5kb position on the downstream of the human SMN2 gene; and a Neo resistance screening element is included between the human SMN2 gene and lox511, wherein BAC is RP11-1012N14;

(3) Electrotransferring the constructed targeting vector I into ES cells of a C57BL/6 strain, screening the cells by a Puromycin drug, selecting drug-resistant ES clones, culturing and amplifying related ES clones, and then carrying out PCR typing identification and Southern identification to obtain positive ES cells I which are correctly targeted;

(4) The constructed Bac vector II is electrically transferred into ES cells I, the cells are screened by G418 drugs, ES clones with drug resistance are selected, and the relevant ES clones are cultured and amplified and then subjected to PCR typing identification and Southern identification to obtain positive ES cells II with correct targeting;

(5) Injecting positive ES cells II into blastula, transplanting blastula into a surrogate mouse, and birth of the mouse through pregnancy;

(6) Cutting the paw of a young mouse, extracting DNA, and carrying out PCR typing identification to confirm the genotype of the mouse;

(7) Mating a male foundation mouse with a wild-type heterologous mouse to obtain an F1 generation heterozygote mouse, and carrying out PCR identification after birth on the mouse, wherein if a positive mouse is born, the transgene is integrated into germ cells;

(8) Male F1 mice and female F1 mice were bred with each other, and F2 mice were identified by post-natal PCR to confirm the birth of homozygous mice, thereby obtaining SMA mouse models.

2. A method of constructing a mouse model of SMA according to claim 1, further comprising any of the following preferred step parameters:

in the step (5), the pregnancy period is about 20 days;

in the step (6), the young mouse paws of 5-7d are cut off in the step (6), DNA is extracted, and PCR typing identification is carried out to confirm the genotype of the mouse;

in the step (7), the male foundation mice are mated with wild-type foreign mice to obtain F1 generation heterozygote mice after 7 days of birth, and PCR identification is carried out on the mice;

in the step (8), the male F1 mice are bred with each other after being 8 weeks old and the female F1 mice are 6 weeks old, and the F2 mice are identified by PCR 7 days after being born.

3. A method according to claim 1, further comprising the step of (9) phenotyping the SMN2 homozygous mice for the characterization of survival, body length, etc.

4. A method of constructing a mouse model of SMA according to claim 1, wherein step (1) comprises the specific steps of:

PCR amplification is carried out by taking wild C57BL/6 mouse genome DNA as a template to obtain a5 '-end homologous arm fragment and a 3' -end homologous arm fragment; simultaneously synthesizing loxP-Puro-lox511 resistance screening sequence;

5' homology arm: the positioning of the nucleotide is chr13:100,110,478-100,115,238 in a mouse mm10 database; designing an upstream primer as shown in SEQ ID NO. 2; the downstream primer is shown as SEQ ID NO. 3;

3' homology arm: the positioning of the nucleotide is chr13:100,138,191-100,141,017 in a mouse mm10 database; designing an upstream primer shown as SEQ ID NO. 4, and designing a downstream primer shown as SEQ ID NO. 5;

the 5 '-end homology arm fragment, the 3' -end homology arm fragment and the loxP-Puro-lox511 resistance screening sequence are connected to the PUC57 plasmid through INFUION connection, and finally the targeting vector I is obtained.

5. The method of claim 4, wherein the loxP-Puro-lox511 resistance screening sequence in the step (1) has a nucleotide sequence shown in SEQ ID NO. 1.

6. A method for constructing a mouse model of SMA according to claim 1, wherein in the step (3),

and (3) respectively using 3 pairs of primers to carry out PCR analysis and identification on the genome DNA of the ES cells obtained in the step (3):

1F1 (SEQ ID NO: 6) is located outside the 5' homology arm;

1R1 (SEQ ID NO: 7) is located on the Puro element;

2F2 (SEQ ID NO: 8) on the Puro element;

2R2 (SEQ ID NO: 9) is located on the 3' homology arm;

1F3 (SEQ ID NO: 10) is located on the 5' homology arm;

the 1F1-1R1 primer product had a length of 4914bp, the 2F2-2R2 primer product had a length of 342bp, and the 1F3-1R1 primer product had a length of 209bp.

7. A method for constructing a mouse model of SMA according to claim 1, wherein in the step (4),

performing PCR analysis and identification on the ES cell genome DNA obtained in the step (4) by using 5 pairs of primer pairs respectively:

f1 (SEQ ID NO: 15) and R1 (SEQ ID NO: 16) are located on the human or murine genome flanking the loxP; f2 (SEQ ID NO: 17) on the Neo-resistance element;

r2 (SEQ ID NO: 18) is located on the murine genome outside lox 511;

f3 (SEQ ID NO: 19), R3 (SEQ ID NO: 20), F4 (SEQ ID NO: 21), R4 (SEQ ID NO: 22), F5 (SEQ ID NO: 23), R5 (SEQ ID NO: 24) are located on the inserted human genome;

the F1R1 primer product had a length of 353bp, the F2R2 primer product had a length of 553bp, the F3R3 primer product had a length of 270bp, the F4R4 primer product had a length of 589bp, and the F5R5 primer product had a length of 231bp.

8. The method according to claim 1, wherein in the step (7), 5 pairs of primers are used to perform PCR analysis on mouse rat tail genomic DNA;

f1 (SEQ ID NO: 15) and R1 (SEQ ID NO: 16) are located on the human or murine genome flanking the loxP;

f6 (SEQ ID NO: 25) located on a human genome;

r2 (SEQ ID NO: 18) is located on the murine genome outside lox 511;

f3 (SEQ ID NO: 19), R3 (SEQ ID NO: 20), F4 (SEQ ID NO: 21), R4 (SEQ ID NO: 22), F5 (SEQ ID NO: 23), R5 (SEQ ID NO: 24) are located on the inserted human genome; f7 (SEQ ID NO: 26) on the murine genome;

the F1R1 primer product length was 353bp, the F6R2 primer product length was 274bp, the F3R3 primer product length was 270bp, the F4R4 primer product length was 589bp, the F5R5 primer product length was 231bp, and the F7R2 primer product length was 363bp, wherein the F7R2 amplification product was used to identify wild type bands.

9. The method according to claim 1, wherein in the step (8), PCR analysis is performed using two pairs of primer pairs for rat tail genomic DNA of F2 mice,

primer F1 (SEQ ID NO: 15) and R1 (SEQ ID NO: 16) are located on the human or murine genome flanking the loxP,

f7 (SEQ ID NO: 26) on the murine genome;

r2 (SEQ ID NO: 18) is located on the murine genome outside lox 511;

the F1R1 primer product was 353bp in length and could not be detected in wild-type mice; F7R2 had a product length of 363bp in wild-type mice, but was undetectable in homozygous mice.

10. Use of the method according to any one of claims 1-9 for the development of a medicament for the treatment/prevention of spinal muscular atrophy.