CN117264950A - Double-stranded ribonucleic acid for inhibiting C5 gene expression, and modification, conjugate and application thereof - Google Patents

Double-stranded ribonucleic acid for inhibiting C5 gene expression, and modification, conjugate and application thereof Download PDF

Info

Publication number
CN117264950A
CN117264950A CN202310823538.1A CN202310823538A CN117264950A CN 117264950 A CN117264950 A CN 117264950A CN 202310823538 A CN202310823538 A CN 202310823538A CN 117264950 A CN117264950 A CN 117264950A
Authority
CN
China
Prior art keywords
seq
nucleotide sequence
strand comprises
antisense strand
sense strand
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310823538.1A
Other languages
Chinese (zh)
Inventor
王书成
黄河
刘薇
王岩
林国良
产运霞
耿玉先
汪小君
荣梅
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing Fuyuan Pharmaceutical Co ltd
Original Assignee
Beijing Fuyuan Pharmaceutical Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing Fuyuan Pharmaceutical Co ltd filed Critical Beijing Fuyuan Pharmaceutical Co ltd
Publication of CN117264950A publication Critical patent/CN117264950A/en
Pending legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7115—Nucleic acids or oligonucleotides having modified bases, i.e. other than adenine, guanine, cytosine, uracil or thymine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/712—Nucleic acids or oligonucleotides having modified sugars, i.e. other than ribose or 2'-deoxyribose
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7125—Nucleic acids or oligonucleotides having modified internucleoside linkage, i.e. other than 3'-5' phosphodiesters
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/472—Complement proteins, e.g. anaphylatoxin, C3a, C5a
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C12N2310/141—MicroRNAs, miRNAs

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Biomedical Technology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present disclosure relates to double-stranded ribonucleic acids and modifications, conjugates, and uses thereof for inhibiting C5 gene expression. In particular, the present disclosure relates to double-stranded ribonucleic acid, double-stranded ribonucleic acid modifications, double-stranded ribonucleic acid conjugates, pharmaceutical compositions and uses for inhibiting C5 gene expression, and methods for inhibiting intracellular C5 gene expression. The double-stranded ribonucleic acid provided by the disclosure can be combined in cells to form an RNA-induced silencing complex (RISC), cut mRNA transcribed by a complement C5 gene, efficiently and specifically inhibit the expression of the complement C5 gene, is used for treating diseases mediated by improper activation of a complement system, and has important application prospects in clinical disease treatment.

Description

Double-stranded ribonucleic acid for inhibiting C5 gene expression, and modification, conjugate and application thereof
Technical Field
The present disclosure is in the field of biological medicine, and in particular, relates to a double-stranded ribonucleic acid, a double-stranded ribonucleic acid modification, a double-stranded ribonucleic acid conjugate, a pharmaceutical composition and use for inhibiting the expression of a C5 gene in a cell, and a method for inhibiting the expression of the C5 gene in the cell.
Background
Complement (C) is a group of proteins present in human and animal serum and tissue fluids that are thermolabile, enzymatically active, and mediate immune and inflammatory responses. After activation of the complement system (Complement system), a range of cellular responses are mediated, such as cytolysis, opsonophagocytosis (antigen-antibody binding), inflammatory responses, clearance of immune complexes, and the like. The complement system is mainly composed of more than 30 glycoproteins, such as intrinsic components, regulatory proteins and receptors, which exist as soluble proteins in blood or as membrane-associated proteins. Complement is activated by one of the classical, alternative and lectin pathways, producing a series of proteolytic enzymes to enhance immune responses or form a Membrane Attack Complex (MAC). The C5 convertase is the last enzyme to cleave C5, releasing C5a and C5b. C5b binds to four other complement proteins (C6, C7, C8 and C9) to form MAC, a transmembrane channel that induces cell lysis.
Inappropriate activation of complement protein C5 is responsible for proliferation and/or initiating lesions in many diseases including, for example, paroxysmal sleep hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), myasthenia gravis (gMG), and thromboembolism.
Development of C5 complement inhibitors is a promising therapeutic approach, with only Soliris (Eculizumab) and Ultomiris (Ravulizumab) currently available worldwide for treatment of PNH, both developed by Alexion. However, currently available C5 inhibitors are all antibody drugs, and no related RNA drugs have been marketed. Therefore, the development of novel complement C5 inhibitors has great clinical value and market prospect.
Disclosure of Invention
Problems to be solved by the invention
In view of the problems in the prior art, there is a need, for example, to develop more C5 complement inhibitors for the treatment of diseases mediated by inappropriate activation of the complement system. The present disclosure aims at providing a series of double-stranded ribonucleic acid, double-stranded ribonucleic acid modifier, double-stranded ribonucleic acid conjugate and pharmaceutical composition for inhibiting the expression of complement C5 gene, which can inhibit the expression of C5 gene and has important application prospect in clinical disease treatment.
Solution for solving the problem
A double-stranded ribonucleic acid comprising a sense strand and an antisense strand, the sense strand being complementary to and/or substantially reverse complementary to the antisense strand to form a double-stranded region of the double-stranded ribonucleic acid;
wherein the sense strand comprises a sequence a that differs by no more than 3 nucleotides from at least 15 consecutive nucleotides in the target sequence, and the antisense strand comprises a sequence B that differs by no more than 3 nucleotides from the reverse complement of at least 15 consecutive nucleotides in the target sequence;
The target sequence is selected from nucleotide sequences shown in any one of SEQ ID NO 1-7 and SEQ ID NO 595-614.
The double-stranded ribonucleic acid according to [1], wherein the target sequence is selected from the nucleotide sequences shown in any one of SEQ ID NOS: 8 to 51, 615 to 657, the sense strand comprises a sequence A consisting of at least 15 consecutive nucleotides in the nucleotide sequences shown in any one of SEQ ID NOS: 8 to 51, 615 to 657, and the antisense strand comprises a sequence B consisting of at least 15 consecutive nucleotides in the nucleotide sequences shown in any one of SEQ ID NOS: 8 to 51, 615 to 657, which is reverse-complementary and/or substantially reverse-complementary.
The double-stranded ribonucleic acid according to [1] or [2], wherein the sense strand consists of 15 to 28 nucleotides, preferably 19 to 25 nucleotides, more preferably 19 to 23 nucleotides, more preferably 19, 21 or 23 nucleotides.
The double-stranded ribonucleic acid according to [3], wherein the nucleotide sequence of the sense strand is a sequence A consisting of 15 to 28 consecutive nucleotides, preferably 19 to 25 consecutive nucleotides, more preferably 19 to 23 consecutive nucleotides, still more preferably 19, 21 or 23 nucleotides in the nucleotide sequence shown in any one of SEQ ID NOS: 8 to 51, 615 to 657.
The double-stranded ribonucleic acid according to any one of [1] to [4], wherein the antisense strand consists of 15 to 28 nucleotides, preferably 19 to 25 nucleotides, more preferably 19 to 23 nucleotides, more preferably 19, 21 or 23 nucleotides.
The double-stranded ribonucleic acid according to [5], wherein the nucleotide sequence of the antisense strand is a sequence B which is reverse complementary and/or substantially reverse complementary to a sequence consisting of 15 to 28 consecutive nucleotides in the nucleotide sequence shown in any one of SEQ ID NOS: 8 to 51, SEQ ID NOS: 615 to 657, preferably 19 to 25 consecutive nucleotides, more preferably 19 to 23 consecutive nucleotides, more preferably 19, 21 or 23 nucleotides.
The double-stranded ribonucleic acid according to any one of [1] to [6], wherein the double-stranded region is 15 to 25 nucleotides in length, preferably 19 to 23 nucleotides, more preferably 19 to 21 nucleotides, more preferably 19, 21 or 23 nucleotides.
The double-stranded ribonucleic acid according to any one of [1] to [7], wherein,
the sense strand is complementary to the antisense strand to form the double-stranded region, and the 3 'end of the sense strand has 1-2 protruding nucleotides extending out of the double-stranded region, the 3' end of the antisense strand forming a blunt end; or,
the sense strand is complementary to the antisense strand to form the double-stranded region, and the 3 'end of the antisense strand has 1-2 protruding nucleotides extending out of the double-stranded region, the 3' end of the sense strand forming a blunt end; or,
The sense strand and the antisense strand are complementary to form the double-stranded region, and the 3' -ends of the sense strand and the antisense strand each have 1-2 protruding nucleotides extending out of the double-stranded region; or,
the sense strand is complementary to the antisense strand to form the double-stranded region, and the sense strand and the 3' -end of the antisense strand each form a blunt end.
The double-stranded ribonucleic acid of any one of [1] to [8], wherein the sense strand and the antisense strand are selected from the following combinations:
125 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 283 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 370;
1) The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 52 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 145;
2) The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 53 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 146;
3) The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 54 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 147;
4) The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 55 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 148;
5) The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 56 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 149;
6) The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 57 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 150;
7) The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 58 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 151;
8) The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 59, and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 152;
9) The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 60, and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 153;
10 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 61 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 154;
11 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 62 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 155;
12 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 63 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 156;
13 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 64 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 157;
14 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 65 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 158;
15 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 66 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 159;
16 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 67 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 160;
17 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 68 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 161;
18 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 69 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 162;
19 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 70 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 163;
20 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 71 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 164;
21 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 72 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 165;
22 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 73 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 166;
23 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 74 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 167;
24 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 75 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 168;
25 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 76 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 169;
26 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 77 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 170;
27 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 78 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 171;
28 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 79 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 172;
29 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 80 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 173;
30 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 81 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 174;
31 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 82 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 175;
32 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 83 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 176;
33 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 84 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 177;
34 The sense strand comprises the nucleotide sequence set forth in SEQ ID NO. 85 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO. 178;
35 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 86 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 179;
36 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 87, and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 180;
37 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 88 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 181;
38 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 89, and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 182;
39 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 90 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 183;
40 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 91 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 184;
41 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 92 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 185;
42 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 93 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 186;
43 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 94 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 187;
44 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 95 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 188;
45 The sense strand comprises the nucleotide sequence set forth in SEQ ID NO. 96 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO. 189;
46 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 97 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 190;
47 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 98 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 191;
48 The sense strand comprises the nucleotide sequence set forth in SEQ ID NO. 99 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO. 192;
49 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 100 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 193;
50 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 101 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 194;
51 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 102 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 195;
52 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 103 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 196;
53 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 104 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 197;
54 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 105 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 198;
55 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 106 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 199;
56 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 107 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 200;
57 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 108 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 201;
58 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 109 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 202;
59 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 110 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 203;
60 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 111 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 204;
61 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 112 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 205;
62 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 113 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 206;
63 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 114 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 207;
64 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 115 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 208;
65 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 116, and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 209;
66 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 117 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 210;
67 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 118 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 211;
68 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 119 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 212;
69 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 120 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 213;
70 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 121 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 214;
71 The sense strand comprises the nucleotide sequence set forth in SEQ ID NO. 122 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO. 215;
72 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 123 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 216;
73 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 124 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 217;
74 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 125 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 218;
75 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 126 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 219;
76 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 127 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 220;
77 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 128 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 221;
78 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 129 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 222;
79 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 130 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 223;
80 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 131, and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 224;
81 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 132 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 225;
82 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 133 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 226;
83 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 134 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 227;
84 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 135 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 228;
85 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 136 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 229;
86 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 137 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 230;
87 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 138 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 231;
88 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 139 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 232;
89 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 140 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 233;
90 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 141 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 234;
91 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 142 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 235;
92 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO:143 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 236;
93 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 144 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 237;
106 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 262 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 349;
107 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 263 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 350;
108 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 264 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 351;
109 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 265 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 352;
110 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 266 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 353;
111 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 267 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 354;
112 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 268 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 355;
113 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 270 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 357;
114 The sense strand comprises the nucleotide sequence shown as SEQ ID NO:271 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO: 358;
115 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 272 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 359;
116 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 273 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 360;
117 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO:274 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 361;
118 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO:276 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 363;
119 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 277 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 364;
120 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 278 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 365;
121 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 279 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 366;
122 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 280 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 367;
123 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 281 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 368;
124 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 282 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 369;
126 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 284 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 371;
127 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 285 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 372;
128 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 286 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 373;
129 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 288 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 375;
130 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO:289 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 376;
131 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 290 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 377;
132 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 291 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 378;
133 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 292, and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 379;
134 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 293 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 380;
135 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 294 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 381;
136 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO:295 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 382;
137 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 296 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 383;
138 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 297 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 384;
139 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 298 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 385;
140 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 299, and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 386;
141 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 300 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 387;
142 The sense strand comprises the nucleotide sequence set forth in SEQ ID NO. 302 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO. 389;
143 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 303 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 390;
144 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 305 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 392;
145 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 306 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 393;
146 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 307 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 394;
147 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 308 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 395;
148 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 310 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 397;
149 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 311 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 398;
150 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 312 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 399;
151 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 315 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 402;
152 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 316 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 403;
153 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 317 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 404;
154 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 318, and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 405;
155 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 319 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 406;
156 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 320 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 407;
157 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 321 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 408;
158 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 322 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 409;
159 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 323 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 410;
160 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 324 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 411;
161 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 325 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 412;
162 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 326 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 413;
163 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 327 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 414;
164 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 328 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 415;
165 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 329 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 416;
166 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 330 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 417;
167 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 331 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 418;
168 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 332 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 419;
169 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 334 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 421;
170 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 335 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 422;
171 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 336 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 423;
172 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 337 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 424;
173 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 338 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 425;
174 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 340 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 427;
175 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 341 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 428;
176 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 344 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 431;
177 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 345 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 432;
178 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 346 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 433;
179 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 347 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 434;
231 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 530 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 541;
232 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO:531 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 542;
233 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 532 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 543;
234 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO 533 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO 544;
235 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 534 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 545;
236 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 535 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 546;
237 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 536 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 547;
238 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 537 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 548;
239 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 538 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 549;
240 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 539 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 550;
241 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 540 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 551.
The double-stranded ribonucleic acid according to any one of [1] to [9], wherein each nucleotide in the sense strand is a modified nucleotide or an unmodified nucleotide independently of each other and/or each nucleotide in the antisense strand is a modified nucleotide or an unmodified nucleotide independently of each other.
The double-stranded ribonucleic acid according to any one of [1] to [10], wherein two arbitrarily linked nucleotides in the sense strand are linked by a phosphodiester bond or a phosphorothioate bond, and/or two arbitrarily linked nucleotides in the antisense strand are linked by a phosphodiester bond or a phosphorothioate diester bond.
The double-stranded ribonucleic acid according to any one of [1] to [11], wherein the 5 '-terminal nucleotide of the sense strand is linked to a 5' -phosphate group or a 5 '-phosphate derivative group, and/or the 5' -terminal nucleotide of the antisense strand is linked to a 5 '-phosphate group or a 5' -phosphate derivative group.
The double-stranded ribonucleic acid according to any one of [1] to [12], wherein the double-stranded ribonucleic acid is an siRNA.
The double-stranded ribonucleic acid according to any one of [1] to [13], wherein the double-stranded ribonucleic acid is an siRNA for inhibiting the expression of C5 gene.
A double-stranded ribonucleic acid modification according to any one of [1] to [14], comprising a chemical modification of at least one of:
(1) Modification of at least one nucleotide in the sense strand,
(2) Modification of the phosphodiester bond in at least one position in the sense strand,
(3) Modification of at least one nucleotide in the antisense strand,
(4) Modification of the phosphodiester bond at least one position in the antisense strand;
optionally, the 3' -end of sequence A in the sense strand of the double-stranded ribonucleic acid is linked to a sequence D consisting of 1-2 nucleotides, preferably 1-2 thymine deoxyribonucleotides; and/or, the 3' -end of the sequence B in the antisense strand of the double-stranded ribonucleic acid is connected with a sequence E consisting of 1-2 nucleotides, preferably a sequence E consisting of 1-2 thymine deoxyribonucleotides; and/or, the 3 '-end of the sequence A in the sense strand of the double-stranded ribonucleic acid excludes 1-2 nucleotides to form a sequence A';
Alternatively, the sense strand and the antisense strand of the double-stranded ribonucleic acid modification are selected from the following sequence combinations:
the nucleotide sequence of the sense strand is a sequence shown in a sequence A, and the nucleotide sequence of the antisense strand is a sequence shown in a sequence B;
or the nucleotide sequence of the sense strand is a sequence shown in a sequence A, and the nucleotide sequence of the antisense strand is a sequence shown in a sequence B and a connecting sequence E;
or the nucleotide sequence of the sense strand is a sequence shown in a sequence A and a connecting sequence D, and the nucleotide sequence of the antisense strand is a sequence shown in a sequence B;
or the nucleotide sequence of the sense strand is a sequence shown in a sequence A connected with a sequence D, and the nucleotide sequence of the antisense strand is a sequence shown in a sequence B connected with a sequence E;
alternatively, the nucleotide sequence of the sense strand is the sequence shown in the sequence A', and the nucleotide sequence of the antisense strand is the sequence shown in the sequence B;
alternatively, the nucleotide sequence of the sense strand is the sequence shown in the sequence A', and the nucleotide sequence of the antisense strand is the sequence shown in the sequence B and the connecting sequence E.
The double-stranded ribonucleic acid modification of [15], wherein the modification of the nucleotide is selected from the group consisting of 2 '-fluoro modification, 2' -alkoxy modification, 2 '-substituted alkoxy modification, 2' -alkyl modification, 2 '-substituted alkyl modification, 2' -deoxy modification, nucleotide derivative modification, and a combination of any two or more thereof.
According to [15]]Or [16]]The double-stranded ribonucleic acid modifier, wherein the nucleotide modification is selected from the group consisting of 2'-F modification, 2' -O-CH modification 3 Modification, 2' -O-CH 2 -CH 2 -O-CH 3 Modification, 2' -O-CH 2 -CH＝CH 2 Modification, 2' -CH 2 -CH 2 -CH＝CH 2 Modification, 2' -deoxy modification, nucleotide derivative modification, or a combination of any two or more thereof.
The double-stranded ribonucleic acid modification of [16] or [17], wherein the nucleotide derivative in the nucleotide derivative modification is selected from the group consisting of an isocucleotide, LNA, ENA, cET, UNA and GNA.
According to [15]]-[18]The double-stranded ribonucleic acid modification of any one of, wherein the ribonucleotides at positions 7, 9, 10 and 11 in the sense strand are 2'-F modified ribonucleotides in the direction from the 5' terminus to the 3 'terminus, and the ribonucleotides at the remaining positions in the sense strand are 2' -O-CH 3 Modified ribonucleotides.
The double-stranded ribonucleic acid modification of any one of [15] to [19], wherein the sense strand comprises a phosphorothioate linkage at the position shown below in the 5 '-terminal to 3' -terminal direction:
between nucleotide 1 and nucleotide 2 from the 5' end of the sense strand;
between nucleotide 2 and nucleotide 3 from the 5' end of the sense strand;
Between nucleotide 1 and nucleotide 2 from the 3' end of the sense strand;
between nucleotide 2 and nucleotide 3 from the 3' end of the sense strand;
or,
the sense strand comprises phosphorothioate linkages at the positions shown below:
between nucleotide 1 and nucleotide 2 from the 5' end of the sense strand;
between nucleotide 2 and nucleotide 3 from the 5' end of the sense strand;
or,
the sense strand comprises phosphorothioate linkages at the positions shown below:
between nucleotide 1 and nucleotide 2 from the 5' end of the sense strand;
between nucleotide 2 and nucleotide 3 from the 5' end of the sense strand;
between nucleotide 3 and nucleotide 4 from the 5' end of the sense strand;
between nucleotide 1 and nucleotide 2 from the 3' end of the sense strand;
between nucleotide 2 and nucleotide 3 from the 3' end of the sense strand;
between nucleotide 3 and nucleotide 4, the 3' end of the sense strand is initiated.
According to [15 ]]-[20]The double-stranded ribonucleic acid modification of any one of the above, wherein the ribonucleotide at any odd number position in the antisense strand in the direction from the 5' -end to the 3' -end is 2' -O-CH 3 Modified ribonucleotides, any of the antisense strandsThe ribonucleotides at the even numbered positions are 2' -F modified ribonucleotides;
alternatively, the ribonucleotides at positions 2, 6, 14 and 16 in the antisense strand are 2'-F modified ribonucleotides in the direction of the 5' end toward the 3 'end, and the ribonucleotides at the remaining positions in the antisense strand are 2' -O-CH 3 Modified ribonucleotides;
alternatively, the ribonucleotides at positions 2, 6, 8, 9, 14 and 16 in the antisense strand are 2'-F modified ribonucleotides in the direction from the 5' end to the 3 'end, and the ribonucleotides at the remaining positions in the antisense strand are 2' -O-CH 3 Modified ribonucleotides;
alternatively, the ribonucleotides at positions 2, 14 and 16 in the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 6 in the antisense strand is a nucleotide derivative GNA modified ribonucleotide, and the ribonucleotides at the rest positions in the antisense strand are 2' -O-CH 3 Modified ribonucleotides;
alternatively, in the direction from the 5 '-end to the 3' -end, the ribonucleotides at positions 2, 6, 14 and 16 in the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 7 in the antisense strand is a nucleotide derivative GNA modified ribonucleotide, and the ribonucleotides at the rest positions in the antisense strand are 2' -O-CH 3 Modified ribonucleotides.
The double-stranded ribonucleic acid modification of any one of [15] to [21], wherein a nucleotide at the 5' -end of the antisense strand is linked to a 5' -phosphate group or a 5' -phosphate derivative group in a direction from the 5' -end to the 3' -end.
The double-stranded ribonucleic acid modification of any one of [15] to [22], wherein the antisense strand comprises a phosphorothioate diester linkage at the positions shown below:
between nucleotide 1 and nucleotide 2 from the 5' end of the antisense strand;
between nucleotide 2 and nucleotide 3 from the 5' end of the antisense strand;
between nucleotide 1 and nucleotide 2 from the 3' end of the antisense strand;
between nucleotide 2 and nucleotide 3 from the 3' end of the antisense strand;
or,
the antisense strand comprises phosphorothioate linkages at the positions shown below:
between nucleotide 1 and nucleotide 2 from the 5' end of the antisense strand;
between nucleotide 2 and nucleotide 3 from the 5' end of the antisense strand;
between nucleotide 3 and nucleotide 4 from the 5' end of the antisense strand;
between nucleotide 1 and nucleotide 2 from the 3' end of the antisense strand;
Between nucleotide 2 and nucleotide 3 from the 3' end of the antisense strand;
the antisense strand is between nucleotide 3 and nucleotide 4 starting at the 3' end.
According to [15 ]]-[23]The double-stranded ribonucleic acid modification of any one of, wherein the sense strand of the double-stranded ribonucleic acid modification has a nucleotide sequence as set forth in (a) 1 )-(a 6 ) The structure shown in any one of:
(a 1 )5’-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’，
(a 2 )5’-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’，
(a 3 )5’-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’，
(a 4 )5’-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3’，
(a 5 )5’-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -3’，
(a 6 )5’-mN 1 -(s)-mN 2 -(s)-mN 3 -(s)-mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -(s)-mN 19 -(s)-T-(s)-T-3’；
wherein N is 1 -N 23 Independently of one another, from ribonucleotides of base A, U, C or G,
the capital letter T denotes a deoxyribonucleotide with the base thymine,
the lower case letter m indicates that one ribonucleotide adjacent to the right side of the letter m is 2' -O-CH 3 The modified ribonucleotides are used as the amino acids,
the lower case letter F indicates that the adjacent ribonucleotide to the left of the letter F is a 2' -F modified ribonucleotide,
-(s) -means that two nucleotides adjacent to each other are linked by a phosphorothioate linkage.
According to [15 ]]-[24]The double-stranded ribonucleic acid modification of any one of, wherein the antisense strand of the double-stranded ribonucleic acid modification has a nucleotide sequence as shown in (b) 1 )-(b 17 ) The structure shown in any one of:
(b 1 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -N 4 f-mN 5 -N 6 f-mN 7 -N 8 f-mN 9 -N 10 f-mN 11 -N 12 f-mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -N 18 f-mN 19 -(s)-T-(s)-T-3’，
(b 2 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -N 4 f-mN 5 -N 6 f-mN 7 -N 8 f-mN 9 -N 10 f-mN 11 -N 12 f-mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -N 18 f-mN 19 -(s)-N 20 f-(s)-mN 21 -3’，
(b 3 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -N 4 f-mN 5 -N 6 f-mN 7 -N 8 f-mN 9 -N 10 f-mN 11 -N 12 f-mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -N 18 f-mN 19 -N 20 f-mN 21 -(s)-N 22 f-(s)-mN 23 -3’，
(b 4 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’，
(b 5 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’，
(b 6 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’，
(b 7 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -N 8 f-N 9 f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’，
(b 8 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -N 8 f-N 9 f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’，
(b 9 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -N 8 f-N 9 f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’，
(b 10 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -[GNA]N 6 -mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’，
(b 11 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -[GNA]N 6 -mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’，
(b 12 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -[GNA]N 6 -mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’，
(b 13 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-[GNA]N 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’，
(b 14 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-[GNA]N 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’，
(b 15 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-[GNA]N 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’，
(b 16 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -(s)-N 4 f-mN 5 -N 6 f-mN 7 -N 8 f-mN 9 -N 10 f-mN 11 -N 12 f-mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -N 18 f-(s)-mN 19 -(s)-T-(s)-T-3’，
(b 17 )5’-EVPmN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’；
wherein N is 1 -N 23 Independently of one another, from ribonucleotides of base A, U, C or G,
the capital letter T denotes a deoxyribonucleotide with the base thymine,
The lower case letter m indicates that one ribonucleotide adjacent to the right side of the letter m is 2' -O-CH 3 The modified ribonucleotides are used as the amino acids,
the lower case letter F indicates that the adjacent ribonucleotide to the left of the letter F is a 2' -F modified ribonucleotide,
p1 represents that one nucleotide adjacent to the right side of the letter is a nucleotide 5' -phosphate,
EVP means that one nucleotide adjacent to the right thereof is a nucleotide of 5' -trans-vinylphosphate,
-(s) -means that two nucleotides adjacent to each other are linked by phosphorothioate linkages,
[ GNA ] means that one of the ribonucleotides adjacent to the right thereof is a ribonucleotide in which GNA modification is present.
The double-stranded ribonucleic acid modification according to any one of [15] to [25], wherein the double-stranded ribonucleic acid modification is an siRNA modification.
The double-stranded ribonucleic acid modification according to any one of [15] to [26], wherein the double-stranded ribonucleic acid modification is an siRNA modification for inhibiting the expression of C5 genes.
The double-stranded ribonucleic acid modification of any one of [15] to [27], wherein the sense strand and the antisense strand are selected from the following combinations:
94 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 238 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 250;
95 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 239 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 251;
96 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 240 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 252;
97 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 241 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 253;
98 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 242 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 254;
99 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 243 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 255;
100 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 244 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 256;
101 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 245 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 257;
102 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 246 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 251;
103 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 247 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 257;
104 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 248 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 255;
105 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 249 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 252;
181 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 436 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 472;
182 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 437, and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 473;
183 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 437 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 474;
184 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 438 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 475;
185 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 439 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 475;
186 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 438 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 476;
187 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 440 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 477;
188 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 440 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 478;
189 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 441 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 478;
190 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 440 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 479;
191 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 440 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 480;
192 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 442 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 481;
193 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 442 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 482;
194 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 443 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 483;
195 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 444 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 484;
196 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 444 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 485;
197 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 445 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 486;
198 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 446 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 486;
199 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 445 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 487;
200 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 445 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 488;
201 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 445 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 489;
202 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 447 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 490;
203 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 448 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 491;
204 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 449 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 492;
205 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 450 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 493;
206 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 451 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 494;
207 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 451 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 495;
208 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 452 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 496;
209 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 453 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 497;
210 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 454 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 498;
211 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 455 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 499;
212 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 456 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 500;
213 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 457 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 501;
214 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 457 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 502;
215 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 458 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 503;
216 The sense strand comprises the nucleotide sequence shown as SEQ ID NO:459 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO: 504;
217 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 460 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 505;
218 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 461 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 506;
219 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 461 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 507;
220 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 462 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 508;
221 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 463 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 509;
222 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 463 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 510;
223 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 464 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 511;
224 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 465 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 512;
225 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 466 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 513;
226 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 467 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 514;
227 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 468 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 515;
228 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 469 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 516;
229 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 470 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 517;
230 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 471 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 518;
242 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 239 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 565;
243 The sense strand comprises the nucleotide sequence set forth in SEQ ID NO. 246 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO. 565;
244 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 239 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 566;
245 The sense strand comprises the nucleotide sequence set forth in SEQ ID NO. 246 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO. 566;
246 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 239 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 567;
247 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 239 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 568;
248 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 552 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 569;
249 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 245 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 570;
250 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 247 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 570;
251 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 245 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 571;
252 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 247 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 571;
253 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 245 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 572;
254 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 245 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 573;
255 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 243 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 574;
256 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 248 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 574;
257 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 243 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 575;
258 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 243 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 576;
259 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 243 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 577;
260 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 245 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 578;
261 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 240 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 579;
262 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 249 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 579;
263 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 240 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 580;
264 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 240 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 581;
265 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 240 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 582;
266 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 553 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 583;
267 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO:554, and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 584;
268 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO:555 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 585;
269 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 556 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 586;
270 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO:557, and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 587;
271 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 558 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 588;
272 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO:559, and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 589;
273 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 560 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 590;
274 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 561 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 591;
275 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 562 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 592;
276 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 563 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 593;
277 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 564 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 594.
A double-stranded ribonucleic acid conjugate, wherein the double-stranded ribonucleic acid conjugate comprises the double-stranded ribonucleic acid of any one of [1] to [14], or the double-stranded ribonucleic acid modification of any one of [15] to [28 ]; and, conjugating a conjugation group attached to the double-stranded ribonucleic acid or the double-stranded ribonucleic acid modification.
The double-stranded ribonucleic acid conjugate of [29], wherein the conjugate group has a structure as shown below:
the double-stranded ribonucleic acid conjugate of [29] or [30], wherein the conjugate group is attached to the 3' -end of the sense strand.
The double-stranded ribonucleic acid conjugate of [31], wherein the conjugate group is conjugated to the 3' -end of the sense strand via a phosphodiester bond;
preferably, the sense strand and the antisense strand of the double-stranded ribonucleic acid conjugate are complementary to form a double-stranded region of the double-stranded ribonucleic acid conjugate, and the 3 'end of the sense strand forms a blunt end, the 3' end of the antisense strand having 1-2 protruding nucleotides extending out of the double-stranded region;
Or,
the sense strand and the antisense strand of the double-stranded ribonucleic acid conjugate are complementary to form a double-stranded region of the double-stranded ribonucleic acid conjugate, and the 3 'end of the sense strand forms a blunt end and the 3' end of the antisense strand forms a blunt end.
The double-stranded ribonucleic acid conjugate of any one of [29] to [32], wherein the double-stranded ribonucleic acid conjugate has a structure as shown below:
/>
wherein the double helix structure is double-stranded ribonucleic acid or double-stranded ribonucleic acid modifier.
The double-stranded ribonucleic acid conjugate of any one of [29] to [33], wherein the double-stranded ribonucleic acid conjugate is an siRNA conjugate.
The double-stranded ribonucleic acid conjugate of any one of [29] to [34], wherein the double-stranded ribonucleic acid conjugate is an siRNA conjugate for inhibiting expression of a C5 gene.
The double-stranded ribonucleic acid conjugate of any one of [29] to [35], wherein the double-stranded ribonucleic acid conjugate is formed by linking any one of the siRNAs shown in Table 1 to a conjugate group, or the double-stranded ribonucleic acid conjugate is formed by linking any one of the siRNA modifications shown in Table 2 to a conjugate group;
preferably, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 258 and the antisense strand comprises the sequence shown as SEQ ID NO. 251;
Alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 259 and the antisense strand comprises the sequence shown as SEQ ID NO. 257;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises a sequence as shown in SEQ ID NO. 260 and the antisense strand comprises a sequence as shown in SEQ ID NO. 255;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO:261 and the antisense strand comprises the sequence shown as SEQ ID NO: 252;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 519 and the antisense strand comprises the sequence shown as SEQ ID NO. 477;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises a sequence as shown in SEQ ID NO. 519 and the antisense strand comprises a sequence as shown in SEQ ID NO. 478;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 520 and the antisense strand comprises the sequence shown as SEQ ID NO. 509;
Alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 519 and the antisense strand comprises the sequence shown as SEQ ID NO. 479;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 519 and the antisense strand comprises the sequence shown as SEQ ID NO. 480;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 521 and the antisense strand comprises the sequence shown as SEQ ID NO. 481;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 521 and the antisense strand comprises the sequence shown as SEQ ID NO. 482;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises a sequence as shown in SEQ ID NO. 522 and the antisense strand comprises a sequence as shown in SEQ ID NO. 486;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises a sequence as shown in SEQ ID NO. 522 and the antisense strand comprises a sequence as shown in SEQ ID NO. 487;
Alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises a sequence as shown in SEQ ID NO. 522 and the antisense strand comprises a sequence as shown in SEQ ID NO. 488;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises a sequence as shown in SEQ ID NO. 522 and the antisense strand comprises a sequence as shown in SEQ ID NO. 489;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises a sequence as shown in SEQ ID NO:523 and the antisense strand comprises a sequence as shown in SEQ ID NO: 492;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 524 and the antisense strand comprises the sequence shown as SEQ ID NO. 493;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 525 and the antisense strand comprises the sequence shown as SEQ ID NO. 494;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 525 and the antisense strand comprises the sequence shown as SEQ ID NO. 495;
Alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises a sequence as shown in SEQ ID NO. 526 and the antisense strand comprises a sequence as shown in SEQ ID NO. 499;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises a sequence as shown in SEQ ID NO. 527 and the antisense strand comprises a sequence as shown in SEQ ID NO. 500;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises a sequence as shown in SEQ ID NO. 528 and the antisense strand comprises a sequence as shown in SEQ ID NO. 501;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 528 and the antisense strand comprises the sequence shown as SEQ ID NO. 502;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises a sequence as shown in SEQ ID NO. 529 and the antisense strand comprises a sequence as shown in SEQ ID NO. 508;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 258 and the antisense strand comprises the sequence shown as SEQ ID NO. 565;
Alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 258 and the antisense strand comprises the sequence shown as SEQ ID NO. 566;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 258 and the antisense strand comprises the sequence shown as SEQ ID NO. 567;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 258 and the antisense strand comprises the sequence shown as SEQ ID NO. 568;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 259 and the antisense strand comprises the sequence shown as SEQ ID NO. 570;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 259 and the antisense strand comprises the sequence shown as SEQ ID NO. 571;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 259 and the antisense strand comprises the sequence shown as SEQ ID NO. 572;
Alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 259 and the antisense strand comprises the sequence shown as SEQ ID NO. 573;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 259 and the antisense strand comprises the sequence shown as SEQ ID NO. 578;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 260 and the antisense strand comprises the sequence shown as SEQ ID NO. 574;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises a sequence as shown in SEQ ID NO. 260 and the antisense strand comprises a sequence as shown in SEQ ID NO. 575;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 260 and the antisense strand comprises the sequence shown as SEQ ID NO. 576;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 260 and the antisense strand comprises the sequence shown as SEQ ID NO. 577;
Alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises a sequence as shown in SEQ ID NO:261 and the antisense strand comprises a sequence as shown in SEQ ID NO: 579;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises a sequence as shown in SEQ ID NO:261 and the antisense strand comprises a sequence as shown in SEQ ID NO: 580;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises a sequence as shown in SEQ ID NO:261 and the antisense strand comprises a sequence as shown in SEQ ID NO: 581;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO:261 and the antisense strand comprises the sequence shown as SEQ ID NO: 582.
A pharmaceutical composition, wherein the pharmaceutical composition comprises at least one of: the double-stranded ribonucleic acid according to any one of [1] to [14], a double-stranded ribonucleic acid modification according to any one of [15] to [28], a double-stranded ribonucleic acid conjugate according to any one of [29] to [36 ].
The pharmaceutical composition of [37], wherein the pharmaceutical composition further comprises one or more pharmaceutically acceptable carriers.
The double-stranded ribonucleic acid according to any one of [1] to [14], the double-stranded ribonucleic acid modification according to any one of [15] to [28], the double-stranded ribonucleic acid conjugate according to any one of [29] to [36], or the pharmaceutical composition according to any one of [37] to [38], for use in at least one of:
(1) Inhibiting C5 gene expression, or preparing a medicament for inhibiting C5 gene expression;
(2) For preventing or treating a disease associated with abnormal expression of a C5 gene, or for preparing a medicament for preventing or treating a disease associated with abnormal expression of a C5 gene;
(3) For treating a subject suffering from a disease that would benefit from reduced expression of the complement C5 gene, or for preparing a medicament for treating a subject suffering from a disease that would benefit from reduced expression of the complement C5 gene.
The use according to [39], wherein the disease associated with abnormal expression of C5 gene is selected from the group consisting of:
paroxysmal nocturnal hemoglobinuria, atypical hemolytic uremic syndrome, extensive myasthenia gravis, thromboembolism, neuromyelitis optica, antibody-mediated renal graft rejection, ji Lanba Rate syndrome, anti-neutrophil cytoplasmic antibody-associated vasculitis, amyotrophic lateral sclerosis, parkinson's disease, autoimmune encephalitis, igG 4-associated diseases, asthma, anti-phospholipid antibody syndrome, ischemia reperfusion injury, atypical hemolytic uremic syndrome, multifocal motor neuropathy, multiple sclerosis, thrombotic thrombocytopenic purpura, traumatic brain injury, condensed collectin disease, dermatomyositis, hemolytic uremic syndrome associated with shiga toxin-producing escherichia coli, graft dysfunction, myocardial infarction, sepsis, atherosclerosis, infective shock, spinal cord injury, psoriasis, autoimmune hemolytic anemia, antiphospholipid syndrome, myocarditis, immune complex vasculitis, high-amp disease, kawasaki disease, and rheumatoid arthritis.
A method for inhibiting expression of a C5 gene in a cell, wherein the method comprises contacting the cell with the double-stranded ribonucleic acid according to any one of [1] to [14], the double-stranded ribonucleic acid modification according to any one of [15] to [28], the double-stranded ribonucleic acid conjugate according to any one of [29] to [36], or the pharmaceutical composition of any one of [37] to [38 ].
The method of [41], wherein the cell is an in vivo cell or an in vitro cell.
The method of [41] or [42], wherein the cell is in a subject.
The method of [43], wherein the subject is a mammal, preferably a human.
The method of [43] or [44], wherein the subject has at least one of the following properties:
abnormal expression of C5 gene in vivo, more specifically abnormal high expression of C5 gene;
suffering from a disease associated with abnormal expression of the C5 gene;
with diseases that would benefit from reduced C5 gene expression.
ADVANTAGEOUS EFFECTS OF INVENTION
In some embodiments, the double-stranded ribonucleic acids provided by the present disclosure are capable of intracellular binding to form an RNA-induced silencing complex (RISC), cleaving mRNA transcribed from the complement C5 gene, and efficiently and specifically inhibiting expression of the complement C5 gene for use in treating diseases mediated by inappropriate activation of the complement system.
Furthermore, the double-stranded ribonucleic acid in the present disclosure is siRNA, which targets and binds to and degrades mRNA of transcription product of C5 gene, plays a role of RNA interference, inhibits protein expression of C5 gene, and is a C5 complement inhibitor with high inhibition rate and good specificity.
In some embodiments, the present disclosure modifies double-stranded ribonucleic acid to provide a double-stranded ribonucleic acid modification having high stability suitable for use in the treatment of in vivo diseases.
Furthermore, the double-stranded ribonucleic acid modifier is an siRNA modifier, and has high stability and good inhibition activity.
In some embodiments, the conjugate of double-stranded ribonucleic acid or double-stranded ribonucleic acid modifier is obtained by connecting a conjugate group on double-stranded ribonucleic acid or double-stranded ribonucleic acid modifier, can be used for high-efficiency targeted delivery into tissues and cells, reduces the influence of double-stranded ribonucleic acid or double-stranded ribonucleic acid modifier on non-targeted normal tissues and cells, and improves the safety of the double-stranded ribonucleic acid or double-stranded ribonucleic acid modifier in clinical disease treatment.
Furthermore, the double-stranded ribonucleic acid conjugate is an siRNA conjugate, has organ or tissue targeting property while maintaining the inhibition activity and stability of the siRNA, can reduce the influence on other tissues or organs and the use amount of siRNA molecules, and can achieve the purposes of reducing toxicity and lowering cost.
Further, the conjugate group in the present disclosure is a group (GalNAc) of the structure shown in formula I, and GalNAc can be used for targeted delivery into liver cells and tissues, and for highly inhibiting expression of C5 gene in liver.
Detailed Description
Definition of the definition
Unless stated to the contrary, the terms used in the present invention have the following meanings.
In the claims and/or the specification of the present invention, the words "a" or "an" or "the" may mean "one" but may also mean "one or more", "at least one", and "one or more".
As used in the claims and specification, the terms "comprising," "having," "including," or "containing" are intended to be inclusive or open-ended and do not exclude additional, unrecited elements or method steps.
Throughout this application, the term-about "means: one value includes the standard deviation of the error of the device or method used to determine the value. The numerical ranges and parameters set forth herein are approximations that may vary depending upon the particular application. Any numerical value, however, inherently contains certain standard deviations found in their respective testing methods or apparatus. Accordingly, unless explicitly stated otherwise, it is to be understood that all ranges, amounts, values and percentages used in this disclosure are modified by the term "about". Herein, about generally means that the actual value is within plus or minus 10%, 5%, 1% or 0.5% of a particular value or range.
The terms "C5", "complement C5", "C5 complement", "complement C5 (C5)", as used in the context of the present disclosure, refer to well known genes and polypeptides, also known in the art as: C5D; c5a; c5b; ECLZB; CPAMD 4. The C5 gene, C5 mRNA sequence is readily available, for example, using the following: gene banks (GenBank), databases (UniProt), human mendelian genetic Online (OMIM), and the like.
The term "C5 gene" may be a wild-type C5 gene, or a C5 gene mutant having sequence variation. Many sequence variations in the C5 gene have been identified and can be found in, for example, ncbidb snp and UniProt (see, e.g., ncbi.nlm.nih.gov/snp).
The terms "polypeptide", "protein" interchangeably refer to a string of at least two amino acid residues, which may be recombinant polypeptides, natural polypeptides or synthetic polypeptides, that are linked to each other by a covalent bond (e.g., a peptide bond). The polypeptide may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non-amino acids. The term also includes amino acid polymers that have been modified (e.g., disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component).
The term "target sequence" as used in the context of the present disclosure refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during transcription of a target gene, including mRNA that is the product of RNA processing of the primary transcript.
In some embodiments, the target sequence is a nucleotide sequence consisting of no less than 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 50, 80, 100, 150, 200, 300, 400, 500, 600, 700, or 800 consecutive linked nucleosides. Exemplary target sequences are nucleotide sequences consisting of 19, 20, 22, 23, 25, 26, 27, 28, 29, 30, 31, 33, 35, 36, 38, 41, 44, 45, 65, 77, 84, 113, 123, 129, 135, 136, 139, 148, 157, 159, 192, 245, 258, 259, 290, 353, 426, 614, 684, 693, or 731 consecutive linked nucleosides. In some alternative embodiments, another shorter target sequence may be included in the target sequence. In some embodiments, one or more shorter target sequences may be included in the target sequence. It is believed that more than two shorter target sequences contained in the same segment of target sequence have the same characteristics.
In some embodiments, the target gene is a C5 gene. In some embodiments, the target portion of the sequence will be at least long enough to serve as a substrate for iRNA-directed cleavage at or near the nucleotide sequence portion of the mRNA molecule formed during transcription of the C5 gene.
In the art, "G", "C", "a", "T" and "U" generally represent bases of guanine, cytosine, adenine, thymine, uracil, respectively, but it is also generally known in the art that "G", "C", "a", "T" and "U" each also generally represent nucleotides containing guanine, cytosine, adenine, thymine and uracil, respectively, as bases, which is a common manner in the expression of deoxyribonucleic acid sequences and/or ribonucleic acid sequences, and thus in the context of the present disclosure, the meaning of "G", "C", "a", "T", "U" includes the various possible scenarios described above. However, it is understood that the term "ribonucleotide" or "nucleotide" may also refer to a modified nucleotide (as described in further detail below) or an alternative replacement moiety. Those skilled in the art will appreciate that guanine, cytosine, adenine and uracil can be replaced with other moieties without substantially altering the base pairing properties of an oligonucleotide (including a nucleotide having such a replaced portion). For example, without limitation, a nucleotide that includes inosine as its base may base pair with a nucleotide that includes adenine, cytosine, or uracil. Thus, nucleotides containing uracil, guanine or adenine may be replaced in the nucleotide sequence of the dsRNA characterized in the present invention by nucleotides containing, for example, inosine. In another example, adenine and cytosine anywhere in the oligonucleotide may be replaced with guanine and uracil, respectively, to form G-U wobble base pairing with the target mRNA. Sequences containing such substitutions are suitable for use in the compositions and methods of the present invention.
The terms "iRNA," "RNAi agent," "iRNA agent," "RNA interfering agent," as used in the context of the present disclosure, are used interchangeably herein to refer to the term as defined herein comprising siRNA and mediating targeted cleavage of RNA transcripts through the RNA-induced silencing complex (RISC) pathway. iRNA directs sequence-specific degradation of mRNA by a process known as RNA interference (RNAi). iRNA modulates, e.g., inhibits, expression of a target gene in a cell (e.g., a cell of a subject (e.g., a mammalian subject)).
The terms "double-stranded ribonucleic acid", "double-stranded RNA (dsRNA) molecule", "dsRNA" as used in the context of the present disclosure may be used interchangeably. The term "dsRNA" refers to a complex of ribonucleic acid molecules having a double-stranded structure comprising two antiparallel and substantially complementary nucleic acid strands, referred to as having "sense" and "antisense" orientations relative to a target gene, e.g., a C5 gene. In some embodiments, double-stranded ribonucleic acid (dsRNA) triggers degradation of target RNA, e.g., mRNA, by a post-transcriptional gene silencing mechanism (referred to herein as RNA interference or RNAi).
Typically, the majority of the nucleotides of each strand of a dsRNA molecule are ribonucleotides, but as detailed herein, each or both of the two strands may also include one or more non-ribonucleotides, e.g., deoxyribonucleotides and/or modified nucleotides. In addition, as used in this disclosure, "double-stranded ribonucleic acid" may include ribonucleotides with chemical modification, phosphate backbones, and the like. Such modifications may include all types of modifications disclosed herein or known in the art.
The term "oligonucleotide" as used in the context of the present disclosure refers to a compound in which the position of a base on the ribose ring in a nucleotide is changed, for example, a compound in which a base is not linked to the 1' -position of the ribose ring, but is linked to the 2' -or 3' -position of the ribose ring.
In some embodiments, the double-stranded ribonucleic acid of the present disclosure is an siRNA that interacts with a target gene transcribed mRNA sequence (e.g., a C5 gene transcribed mRNA sequence) to direct cleavage of the target RNA. Without wishing to be bound by theory, long double stranded RNA introduced into the cell is referred to as the cleavage of type III endonuclease(s) into siRNA (summer et al, genes Dev.) 2001, 15:485). Dicer (ribonuclease III-like enzyme) processes dsRNA into 19-23 base pair short interfering RNA with a characteristic double base 3' overhang (Bernstein et al, (2001) Nature 409:363). These siRNAs are then incorporated into an RNA-induced silencing complex (RISC), where one or more helices cleave the siRNA duplex, which makes it possible for the complementary antisense strand to direct target recognition (Nykanen et al, (2001) cells (Cell) 107:309). Once bound to the appropriate target mRNA, one or more endonucleases within the RISC cleave the target to induce silencing (balshier et al, (2001) Genes and development (Genes dev.) 15:188).
The term "protruding nucleotide" as used in the context of the present disclosure refers to one or more unpaired nucleotides protruding from the duplex structure of a double-stranded ribonucleic acid when one 3 'end of the other strand extends beyond the 5' end of the other strand, or vice versa. "blunt end" or "blunt end" means that there are no unpaired nucleotides at that end of the double-stranded ribonucleic acid, i.e., no nucleotide overhangs. A "blunt-ended" double-stranded ribonucleic acid is a dsRNA that is double-stranded throughout its length, i.e., has no nucleotide overhangs at either end of the molecule.
The term "antisense strand" refers to a strand of a double-stranded ribonucleic acid that is substantially complementary to a region of a target sequence (e.g., derived from human C5 mRNA). Where the region of complementarity is not fully complementary to the target sequence, mismatches are most tolerable in the terminal region, and if mismatches occur, they are typically within one or more regions of the terminal, e.g., 5, 4, 3, 2 or 1 nucleotides of the 5' and/or 3 terminal.
The term "sense strand" refers to a nucleic acid strand in a double-stranded ribonucleic acid that contains a region that is substantially complementary to a region of the antisense strand.
The terms "complementary" or "reverse complementary" are used interchangeably and have the meaning well known to those skilled in the art that in a double stranded nucleic acid molecule, the bases of one strand pair with the bases on the other strand in a complementary manner. In DNA, the purine base adenine (a) is always paired with the pyrimidine base thymine (T) (or uracil (U) in RNA); the purine base guanine (C) is always paired with the pyrimidine base cytosine (G). Each base pair includes a purine and a pyrimidine. When adenine on one strand always pairs with thymine (or uracil) on the other strand, and guanine always pairs with cytosine, the two strands are considered complementary to each other, and the sequence of the strand can be deduced from the sequence of its complementary strand. Accordingly, "mismatch" means in the art that bases at corresponding positions do not exist in complementary pairs in a double-stranded nucleic acid.
The term "substantially reverse complementary" means that there are no more than 3 base mismatches between the two nucleotide sequences involved, i.e., there are 1, 2 or 3 base mismatches between the two nucleotide sequences involved; "perfect complementarity" means that there is no base mismatch between two nucleotide sequences.
The terms-complementary ", -fully complementary" and-substantially complementary "can be used with respect to base pairing between the sense strand and the antisense strand of a dsRNA, or between the antisense strand of a dsRNA and a target sequence, as will be understood from the context of its use.
The term "inhibit" may be used interchangeably with "reduce," "silence," "down-regulate," "suppress," and other similar terms, and includes any level of inhibition.
The term "inhibiting expression of a C5 gene" includes inhibiting expression of any C5 gene (such as, for example, a mouse C5 gene, a rat C5 gene, a monkey C5 gene, or a human C5 gene) as well as variants (e.g., naturally occurring variants) or mutants of the C5 gene. Thus, the C5 gene may be a wild-type C5 gene, a mutated C5 gene, or a transgenic C5 gene in the case of a genetically manipulated cell, group of cells, or organism.
"inhibiting C5 gene expression" includes any level of inhibition of a C5 gene, e.g., at least partially inhibiting expression of a C5 gene, such as inhibiting at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.
The term "independently" means that at least two groups (or ring systems) present in the structure that are identical or similar in value range may have the same or different meanings in the particular case. For example, substituent X and substituent Y are each independently hydrogen, hydroxy, alkyl or aryl, then when substituent X is hydrogen, substituent Y may be either hydrogen or hydroxy, alkyl or aryl; similarly, when the substituent Y is hydrogen, the substituent X may be either hydrogen or hydroxy, alkyl or aryl.
The term-alkyl "includes straight, branched or cyclic saturated alkyl groups. For example, alkyl groups include, but are not limited to, methyl, ethyl, propyl, cyclopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, cyclobutyl, n-pentyl, cyclohexyl, and the like. exemplary-C 1-6 C in alkyl 1-6 "refers to a group comprising an array of straight, branched, or cyclic forms of 1, 2, 3, 4, 5, or 6 carbon atoms.
The term-alkoxy "as used herein refers to an alkyl group attached to the remainder of the molecule through an oxygen atom (-O-alkyl), wherein the alkyl is as defined herein. Non-limiting examples of alkoxy groups include methoxy, ethoxy, trifluoromethoxy, difluoromethoxy, n-propoxy, isopropoxy, n-butoxy, tert-butoxy, n-pentoxy, and the like.
The term-therapeutic "means: after suffering from the disease, the subject is exposed (e.g., administered) to double-stranded ribonucleic acid, double-stranded ribonucleic acid modifications, double-stranded ribonucleic acid conjugates, pharmaceutical compositions, thereby alleviating the symptoms of the disease compared to when not exposed, and does not mean that the symptoms of the disease must be completely inhibited. The suffering from the disease is: the body develops symptoms of the disease.
The term-prophylactic "means: by contacting (e.g., administering) a subject with a double-stranded ribonucleic acid, double-stranded ribonucleic acid modification, double-stranded ribonucleic acid conjugate, pharmaceutical composition of the present disclosure prior to the onset of a disease, thereby alleviating the symptoms after the onset of a disease as compared to when not contacted, is not meant to necessarily completely inhibit the disease.
The term "effective amount" refers to an amount or dose of a double-stranded ribonucleic acid, double-stranded ribonucleic acid modification, double-stranded ribonucleic acid conjugate, or pharmaceutical composition of the present invention that, upon administration to a patient in single or multiple doses, produces a desired effect in a patient in need of treatment or prevention. The effective amount can be readily determined by the attending physician as a person skilled in the art by considering a number of factors: species such as mammals; its size, age and general health; specific diseases involved; the extent or severity of the disease; response of individual patients; specific antibodies administered; mode of administration; the bioavailability characteristics of the administration formulation; a selected dosing regimen; and the use of any concomitant therapy.
The term "disease associated with abnormal expression of C5 gene" is a disease or disorder caused by or associated with complement activation. The term "disease associated with aberrant expression of the C5 gene" includes a disease, disorder or condition that would benefit from reduced expression of C5 (i.e., "C5-related disease"). Such diseases are typically associated with inflammation and/or immune system activation, for example, including Paroxysmal Nocturnal Hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), generalized myasthenia gravis (gMG), thromboembolism, neuromyelitis optica (NMO), antibody-mediated renal transplant rejection, ji Lanba rade syndrome (Guillain Barre syndrome, GBS), anti-neutrophil cytoplasmic antibody-associated vasculitis (ANCA-associated vasculitis), amyotrophic Lateral Sclerosis (ALS), parkinson's Disease (PD), autoimmune encephalitis, igG 4-associated diseases, asthma, antiphospholipid antibody syndrome, ischemia reperfusion injury, typically hemolytic uremic syndrome (tHUS), multifocal Motor Neuropathy (MMN), multiple Sclerosis (MS), thrombotic Thrombocytopenic Purpura (TTP), spontaneous abortion, habitual abortion, traumatic brain injury, condensed pigment disease, dermatomyositis, hemolytic uremic syndrome associated with Shiga toxin-producing escherichia coli (Shiga toxin-producing Escherichia coli), graft dysfunction, myocardial infarction, sepsis, atherosclerosis, infectious shock, spinal cord injury, psoriasis, autoimmune hemolytic anemia (AIHA), antiphospholipid syndrome (APS), myocarditis, immune complex vasculitis, high-ampere disease (tayasu "s disease", kawasaki disease, arthritis, and the like.
The term "pharmaceutically acceptable excipients" or "pharmaceutically acceptable carriers" refers to auxiliary materials widely used in the field of pharmaceutical production. The main purpose of the use of auxiliary substances is to provide a pharmaceutical composition which is safe to use, stable in nature and/or has specific functionalities, and to provide a method so that the active ingredient can be dissolved at a desired rate after administration of the drug to a subject, or so that the active ingredient is effectively absorbed in the subject to whom it is administered. Pharmaceutically acceptable excipients may be inert fillers or may be functional ingredients that provide some function to the pharmaceutical composition (e.g., to stabilize the overall pH of the composition or to prevent degradation of the active ingredients in the composition). Non-limiting examples of pharmaceutically acceptable excipients include, but are not limited to, binders, suspending agents, emulsifiers, diluents (or fillers), granulating agents, binders, disintegrants, lubricants, anti-adherent agents, glidants, wetting agents, gelling agents, absorption delaying agents, dissolution inhibitors, reinforcing agents, adsorbents, buffers, chelating agents, preservatives, coloring agents, flavoring agents, sweetening agents, and the like.
The pharmaceutical compositions of the present disclosure may be prepared using any method known to those of skill in the art. For example, conventional mixing, dissolving, granulating, emulsifying, milling, encapsulating, entrapping and/or lyophilizing processes.
In the present disclosure, the route of administration can be varied or adjusted in any suitable manner to meet the needs of the nature of the drug, the convenience of the patient and medical personnel, and other relevant factors.
The terms-individual ', -patient' or-subject "as used in the context of the present disclosure include mammals. Mammals include, but are not limited to, domesticated animals (e.g., cattle, sheep, cats, dogs, and horses), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats).
Unless defined otherwise or clearly indicated by context, all technical and scientific terms in this disclosure have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.
Double-stranded ribonucleic acid
A first aspect of the present disclosure provides a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of a complement C5 gene. One strand of double-stranded ribonucleic acid is the antisense strand, which is complementarily paired with the mRNA sequence formed by the target gene (i.e., C5 gene) during expression, for directing cleavage of the target mRNA (i.e., the transcript of the C5 gene). The other sense strand of the double-stranded ribonucleic acid includes a double-stranded region that is partially complementary and fully complementary to the antisense strand to form the double-stranded ribonucleic acid.
In some embodiments, double-stranded ribonucleic acid acts as a substrate for an endonuclease (Dicer) and is cleaved into small fragments of dsRNA, i.e., siRNA. In some embodiments, the double-stranded ribonucleic acid is an siRNA. siRNA inhibits expression of complement C5 gene by assembly to form RNA-induced silencing complex (RNA-induced silencing complex, RISC) RISC complex, which cleaves target mRNA.
Based on the target sequence derived from human C5 mRNA (nm_ 000064.4), siRNA that binds to the target mRNA was designed. In some embodiments, the target sequence is selected from the nucleotide sequences set forth in any one of SEQ ID NOS.1-7, SEQ ID NOS.595-614. In some more specific embodiments, the target sequence is selected from the nucleotide sequences set forth in any one of SEQ ID NOS.8-51, 615-657.
In some specific embodiments, the nucleotide sequence set forth in SEQ ID NO. 1 comprises the nucleotide sequences set forth in SEQ ID NO. 8-9.
In some specific embodiments, the nucleotide sequence shown as SEQ ID NO. 2 comprises the nucleotide sequences shown as SEQ ID NO. 10-14.
In some specific embodiments, the nucleotide sequence shown as SEQ ID NO. 3 comprises the nucleotide sequences shown as SEQ ID NO. 15-19.
In some specific embodiments, the nucleotide sequence shown as SEQ ID NO. 4 comprises the nucleotide sequences shown as SEQ ID NO. 20-26.
In some specific embodiments, the nucleotide sequence shown as SEQ ID NO. 5 comprises the nucleotide sequences shown as SEQ ID NO. 27-34.
In some specific embodiments, the nucleotide sequence set forth in SEQ ID NO. 6 comprises the nucleotide sequences set forth in SEQ ID NO. 35-40.
In some specific embodiments, the nucleotide sequence shown as SEQ ID NO. 7 comprises the nucleotide sequences shown as SEQ ID NO. 41-51.
In some specific embodiments, the nucleotide sequence shown as SEQ ID NO. 596 comprises the nucleotide sequences shown as SEQ ID NO. 615-616.
In some specific embodiments, the nucleotide sequence shown as SEQ ID NO. 597 comprises the nucleotide sequences shown as SEQ ID NO. 617-621.
In some specific embodiments, the nucleotide sequence set forth in SEQ ID NO. 598 comprises the nucleotide sequences set forth in SEQ ID NO. 622-625.
In some specific embodiments, the nucleotide sequence shown as SEQ ID NO. 599 comprises the nucleotide sequences shown as SEQ ID NO. 626-629.
In some specific embodiments, the nucleotide sequence shown as SEQ ID NO. 604 comprises the nucleotide sequences shown as SEQ ID NO. 630-636.
In some specific embodiments, the nucleotide sequence set forth in SEQ ID NO. 606 comprises the nucleotide sequences set forth in SEQ ID NO. 637-639.
In some specific embodiments, the nucleotide sequence shown as SEQ ID NO:607 comprises the nucleotide sequences shown as SEQ ID NO: 640-643.
In some specific embodiments, the nucleotide sequence shown as SEQ ID NO. 608 comprises the nucleotide sequences shown as SEQ ID NO. 644-647.
In some specific embodiments, the nucleotide sequence set forth in SEQ ID NO. 610 comprises the nucleotide sequences set forth in SEQ ID NO. 648-649.
In some specific embodiments, the nucleotide sequence shown as SEQ ID NO. 611 comprises the nucleotide sequences shown as SEQ ID NO. 650-654.
In some specific embodiments, the nucleotide sequence shown as SEQ ID NO:612 comprises the nucleotide sequences shown as SEQ ID NO: 655-657.
In some embodiments, the antisense strand comprises sequence B that differs by no more than 3 nucleotides from the reverse complement of at least 15 consecutive nucleotides in the target sequence. Specifically, a starting nucleotide is selected in the target sequence in the direction from the 5' -end to the 3' -end, with at least 15 nucleotides extending in the 3' -direction, including the starting nucleotide, as the binding region of the siRNA. The antisense strand comprises the reverse complement of the nucleotide sequence corresponding to the binding region. The starting nucleotide may be a nucleotide at any position of the target sequence, and at least 15 consecutive nucleotides (including a nucleotide at the starting position) may be obtained as long as the nucleotide extends 3' to the target sequence based on the starting nucleotide.
In the present disclosure, the nucleotide sequence of the antisense strand and the target sequence may be fully complementary or substantially complementary. When the nucleotide sequence of the antisense strand is substantially complementary to the target sequence, there are no more than 3 mismatched bases in the nucleotide sequence of the antisense strand that exist with the target sequence. For example, the mismatched bases are 1, 2, or 3. When the nucleotide sequence of the antisense strand is fully complementary to the target sequence, there are no mismatched bases of the nucleotide sequence of the antisense strand to the target sequence.
Further, the antisense strand consists of at least 15 nucleotides. In some embodiments, the antisense strand consists of 15-28 nucleotides. For example, the antisense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides in length.
Preferably, the antisense strand consists of 19-25 nucleotides, more preferably 19-23 nucleotides, most preferably 19, 21 or 23 nucleotides.
In some embodiments, the sense strand comprises sequence a that differs from at least 15 consecutive nucleotides in the target sequence by no more than 3 nucleotides. The sense strand includes a region complementary to the antisense strand, and the nucleotide sequence of the sense strand is identical or substantially identical to the sequence of the antisense strand binding region on the target sequence. Thus, the nucleotide sequence of the sense strand is at least 15 consecutive nucleotides of the target sequence that bind to the antisense strand; alternatively, the nucleotide sequence of the sense strand may have 1, 2 or 3 base different difference nucleotides compared to at least 15 consecutive nucleotides in the target sequence that bind to the antisense strand.
Further, the sense strand consists of at least 15 nucleotides. In some embodiments, the sense strand consists of 15-28 nucleotides. For example, the sense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides in length.
Preferably, the sense strand consists of 19-25 nucleotides, more preferably 19-23 nucleotides, most preferably 19, 21 or 23 nucleotides.
In the present disclosure, the length of the sense strand and the antisense strand may be the same or different.
In some embodiments, the sense strand is the same length as the antisense strand, specifically, the sense strand/antisense strand length ratio is 15/15, 16/16, 17/17, 18/18, 19/19, 20/20, 21/21, 22/22, 23/23, 24/24, 25/25, 26/26, 27/27, or 28/28. Preferably, the length ratio of sense strand/antisense strand is 19/19, 20/20, 21/21, 22/22, 23/23, 24/24 or 25/25, more preferably 19/19, 20/20, 21/21, 22/22 or 23/23, most preferably 19/19, 21/21 or 23/23.
In some embodiments, the sense strand is of a different length than the antisense strand. For example, the length ratio of sense strand/antisense strand is 19/20, 19/21, 19/22, 19/23, 19/24, 19/25, 19/26, 20/19, 20/21, 20/22, 20/23, 20/24, 20/25, 20/26, 21/19, 21/20, 21/22, 21/23, 21/24, 21/25, 21/26, 22/19, 22/20, 22/21, 22/23, 22/24, 22/25, 22/26, 23/19, 23/20, 23/21, 23/22, 23/24, 23/25, or 23/26, etc.; in some preferred embodiments, the sense strand/antisense strand length ratio is 19/21 or 21/23.
In the present disclosure, the sense strand and the antisense strand may be fully complementary or substantially complementary, and when the two are substantially complementary, no more than 3 mismatched bases exist within the double-stranded region formed by the sense strand and the antisense strand.
In some embodiments, after the sense strand and the antisense strand are complementary to form a double-stranded region, the sense strand, the antisense strand, or a combination thereof has protruding nucleotides extending out of the double-stranded region. The number of protruding nucleotides may be 1 or more, for example, 1 or 2. In addition, the 1-2 nucleotides may be located at the 5 'end, the 3' end, or both ends of any antisense strand or sense strand, and each of the nucleotides may be any type of nucleotide.
In some embodiments, the sense strand is complementary to the antisense strand to form the double-stranded region, and the 3 'end of the sense strand has 1-2 protruding nucleotides extending out of the double-stranded region, the 3' end of the antisense strand forming a blunt end.
In some embodiments, the sense strand is complementary to the antisense strand to form the double-stranded region, and the 3 'end of the antisense strand has 1-2 protruding nucleotides extending out of the double-stranded region, the 3' end of the sense strand forming a blunt end.
In some embodiments, the sense strand and the antisense strand are complementary to form the double-stranded region, and the 3' ends of the sense strand and the antisense strand each have 1-2 protruding nucleotides extending out of the double-stranded region.
In some embodiments, the sense strand and the antisense strand are complementary to form the double-stranded region, and the sense strand and the 3' -end of the antisense strand both form blunt ends.
In the present disclosure, as described above, the nucleotide sequence of the antisense strand and the target sequence may be fully complementary or substantially complementary; the sense strand and the antisense strand may be fully complementary or substantially complementary. Thus, in the following description of target sequences SEQ ID NO: 8-SEQ ID NO:51, SEQ ID NO: 1-7, SEQ ID NO: 595-657, and siRNAs that are capable of being complementary to these target sequences, the antisense strand of each siRNA includes a case where the target sequences that are complementary thereto (e.g., any one of SEQ ID NO: 8-SEQ ID NO:51, SEQ ID NO: 1-7, SEQ ID NO: 595-657) are substantially complementary, i.e., there may be a base mismatch in the nucleotide sequence of the antisense strand of each siRNA to the corresponding target sequence; for each sense strand of the siRNA, the target sequence (e.g., any one of SEQ ID NOS: 8-51, 1-7, 595-657) that is complementary thereto is included, i.e., there may be a base mismatch in the nucleotide sequence of each sense strand of the siRNA to the corresponding target sequence. In some embodiments, the base mismatch may be a mismatch that differs from the target sequence by no more than 3 bases, e.g., 1, 2, or 3 mismatched bases.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 8 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 8. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 1 to siRNA2 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 9 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 9. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA3 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 21 consecutive nucleotides of the sequence shown in SEQ ID NO. 10 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 21 consecutive nucleotides of the sequence shown in SEQ ID NO. 10. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 10 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 10. And, the 3' end of the antisense strand has 2 protruding nucleotides extending out of the double-stranded region.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 10 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 10. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 4 to 22 and 120 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 11 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 11. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA23 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 12 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 12. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA24 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 13 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 13. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA25 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 14 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 14. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA26 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 15 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 15. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, double-stranded ribonucleic acid is siRNA27 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 16 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 16. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA28 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 17 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 17. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA29 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 18 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 18. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA30 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 19, and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 19. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA31 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 20 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 20. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 21 consecutive nucleotides of the sequence shown in SEQ ID NO. 20 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 21 consecutive nucleotides of the sequence shown in SEQ ID NO. 20. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 32 to 38 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 21 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 21. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA39 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 22 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 22. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 21 consecutive nucleotides of the sequence shown in SEQ ID NO. 22 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 21 consecutive nucleotides of the sequence shown in SEQ ID NO. 22. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 22 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 22. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 40 to 48 and 151 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 23 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 23. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA49 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 24 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 24. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, double-stranded ribonucleic acids are siRNA50 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 25 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 25. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA51 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 26 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 26. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is an siRNA52 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 27 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 27. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA53 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 28 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 28. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 54 to 56 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 29 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 29. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, double-stranded ribonucleic acids are siRNA57 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 30 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 30. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA58 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 31 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 31. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA59 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 32 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 32. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 60 to 62, 172 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 33 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 33. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 21 consecutive nucleotides of the sequence shown in SEQ ID NO. 33 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 21 consecutive nucleotides of the sequence shown in SEQ ID NO. 33. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 63 to 65 and 175 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 34 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 34. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 66 to 67 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 35 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 35. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA68 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 36 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 36. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA69 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 37 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 37. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is an siRNA70 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 38 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 38. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 71 to 72 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 39, and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 39. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA73 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 40 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 40. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 74 to 75 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 41 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 41. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA76 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 42 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 42. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA77 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 43 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 43. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 78 to 79 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 44 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 44. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA80 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 45 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 45. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA81 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 46 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 46. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is an siRNA82 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 47 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 47. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 83 to 85 and 194 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 48 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 48. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 86 to 88 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 49 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 49. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA89 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown as SEQ ID NO. 50 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown as SEQ ID NO. 50. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is an siRNA90 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 51 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 51. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 91 to 93 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is sequence A consisting of 21 consecutive nucleotides of the sequence shown as SEQ ID NO. 595 and the nucleotide sequence of the antisense strand is sequence B which is reverse complement of the sequence consisting of 21 consecutive nucleotides of the sequence shown as SEQ ID NO. 595. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is siRNA110 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown as SEQ ID NO. 615, and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown as SEQ ID NO. 615. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 111 to 112, and 247 to 249 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 21 consecutive nucleotides of the sequence shown in SEQ ID NO:616 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 21 consecutive nucleotides of the sequence shown in SEQ ID NO: 616. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO:616 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO: 616. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 113, 114 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 23 consecutive nucleotides of the sequence shown as SEQ ID NO. 617 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 23 consecutive nucleotides of the sequence shown as SEQ ID NO. 617. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 115, 116 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 619 and the nucleotide sequence of the antisense strand is a sequence B which is reverse complement of the sequence consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 619. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 118, 119 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO:620 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO: 620. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 121 to 122 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown as SEQ ID NO:621, and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown as SEQ ID NO: 621. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 23 consecutive nucleotides of the sequence shown as SEQ ID NO:621, and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 23 consecutive nucleotides of the sequence shown as SEQ ID NO: 621. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 124, 125 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 622 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 622. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 622 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 622. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 126 to 127, and 250 to 252 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 23 consecutive nucleotides of the sequence shown as SEQ ID NO:623 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 23 consecutive nucleotides of the sequence shown as SEQ ID NO: 623. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is an siRNA128 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 624 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 624. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 21 consecutive nucleotides of the sequence shown in SEQ ID NO. 624 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 21 consecutive nucleotides of the sequence shown in SEQ ID NO. 624. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 129 to 130 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 625 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 625. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 625 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 625. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 131, 253-255 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 626 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 626. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is siRNA132 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence set forth in SEQ ID NO:627 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence set forth in SEQ ID NO: 627. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 21 consecutive nucleotides of the sequence set forth in SEQ ID NO:627 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 21 consecutive nucleotides of the sequence set forth in SEQ ID NO: 627. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 133 to 134 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 628 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 628. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA136 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is sequence A consisting of 23 consecutive nucleotides of the sequence shown as SEQ ID NO. 629 and the nucleotide sequence of the antisense strand is sequence B which is reverse complement of the sequence consisting of 23 consecutive nucleotides of the sequence shown as SEQ ID NO. 629. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is siRNA137 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 600 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 600. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 600 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 600. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 138 to 140 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 601 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 601. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 601 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 601. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 141 to 143 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 602 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 602. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 144 to 145 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown as SEQ ID NO:603 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown as SEQ ID NO: 603. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, double-stranded ribonucleic acids are siRNA146 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 630 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 630. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 147 to 148 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 631 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 631. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 150 to 151, 256 to 257 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 633 and the nucleotide sequence of the antisense strand is sequence B which is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 633. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
In some embodiments, the nucleotide sequence of the sense strand is sequence A consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 633 and the nucleotide sequence of the antisense strand is sequence B which is reverse complement of the sequence consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 633. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 153 to 154 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 634 and the nucleotide sequence of the antisense strand is a sequence B which is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 634. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 21 consecutive nucleotides of the sequence shown in SEQ ID NO. 634 and the nucleotide sequence of the antisense strand is a sequence B which is reverse complement of the sequence consisting of 21 consecutive nucleotides of the sequence shown in SEQ ID NO. 634. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 155 to 156 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 636 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 636. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, double-stranded ribonucleic acid is siRNA158 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 605 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 605. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 159 to 160 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence set forth in SEQ ID NO. 638 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence set forth in SEQ ID NO. 638. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is an siRNA163 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is SEQ ID NO. 639 as set forth as sequence A of 19 consecutive nucleotides and the nucleotide sequence of the antisense strand is SEQ ID NO. 639 as set forth as sequence B of 19 consecutive nucleotides in reverse complement. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA164 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 23 consecutive nucleotides of the sequence shown as SEQ ID NO. 640, and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 23 consecutive nucleotides of the sequence shown as SEQ ID NO. 640. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 165 to 166 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO:641 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO: 641. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, double-stranded ribonucleic acids are sirnas 167 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown as SEQ ID NO:642 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown as SEQ ID NO: 642. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 168 to 169 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is sequence A consisting of 21 consecutive nucleotides of the sequence shown in SEQ ID NO. 643 and the nucleotide sequence of the antisense strand is sequence B which is reverse complement of the sequence consisting of 21 consecutive nucleotides of the sequence shown in SEQ ID NO. 643. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
In some embodiments, the nucleotide sequence of the sense strand is sequence A consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 643 and the nucleotide sequence of the antisense strand is sequence B which is reverse complement of the sequence consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 643. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 170-171 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 644 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 644. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 173 to 174 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO:645 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO: 645. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is siRNA176 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 646 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 646. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA177 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is SEQ ID NO. 647 as set forth as 19 consecutive nucleotides of sequence A and the nucleotide sequence of the antisense strand is SEQ ID NO. 647 as set forth as 19 consecutive nucleotides of sequence B that is reverse complement. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA178 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 609 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 609. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 609 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 609. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 179-180 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 648, and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 648. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is an siRNA182 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is SEQ ID NO. 649 as set forth in sequence A consisting of 19 consecutive nucleotides and the nucleotide sequence of the antisense strand is SEQ ID NO. 649 as set forth in sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is an siRNA183 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown as SEQ ID NO. 650, and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown as SEQ ID NO. 650. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA184 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence of SEQ ID NO. 651 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence of SEQ ID NO. 651. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is an siRNA185 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown as SEQ ID NO. 652 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown as SEQ ID NO. 652. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA186 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence set forth in SEQ ID NO. 654 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence set forth in SEQ ID NO. 654. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA188 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO:655 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO: 655. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is an siRNA189 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence of SEQ ID NO. 613 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence of SEQ ID NO. 613. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 192 to 193 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 614 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 614. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is an siRNA195 shown in table 1.
In some specific embodiments, the sense strand comprises a nucleotide sequence set forth in any one of SEQ ID NOS: 52-144, 262-348, 530-540 and the antisense strand comprises a nucleotide sequence set forth in any one of SEQ ID NOS: 145-237, 349-435, 541-551.
In some specific embodiments, the double-stranded ribonucleic acid is selected from any one of the sirnas as shown in table 1. The siRNA provided by the disclosure has high specificity of combining with target mRNA (C5 mRNA), has better silencing activity of the target mRNA, can obviously inhibit complement C5 gene expression, and is used for treating diseases mediated by inappropriate activation of a complement system.
In some embodiments, the present disclosure provides an siRNA composition comprising any one or a combination of two or more of the sirnas shown in table 1.
In some embodiments, each nucleotide of the sense strand is a modified nucleotide or an unmodified nucleotide, independently of the other. In some embodiments, each nucleotide of the antisense strand is a modified nucleotide or an unmodified nucleotide independently of the other.
In some embodiments, any two nucleotides linked in the sense strand are linked by a phosphodiester linkage or a phosphorothioate linkage. In some embodiments, any two nucleotides linked in the antisense strand are linked by a phosphodiester linkage or a phosphorothioate linkage.
In some embodiments, the 5' terminal nucleotide of the sense strand is linked to a 5' phosphate group or a 5' phosphate derivative group. In some embodiments, the 5' terminal nucleotide of the antisense strand is linked to a 5' phosphate group or a 5' phosphate derivative group.
Exemplary, the structure of the 5' phosphate group is:the structure of the 5' phosphate derivative group includes, but is not limited to:etc.
The nucleotide at the 5' end of the sense or antisense strand is linked to a 5' phosphate group or 5' phosphate derivative group to form the structure shown below:
wherein Base represents a Base, such as A, U, G, C or T. R 'is hydroxyl or substituted with various groups known to those skilled in the art, for example, 2' -fluoro (2 '-F) modified nucleotides, 2' -alkoxy modified nucleotides, 2 '-substituted alkoxy modified nucleotides, 2' -alkyl modified nucleotides, 2 '-substituted alkyl modified nucleotides, 2' -deoxyribonucleotides.
Double-stranded ribonucleic acid modifier
A second aspect of the present disclosure provides a double-stranded ribonucleic acid modification. Further, the double-stranded ribonucleic acid modification is an siRNA modification. The siRNA modifier can improve the stability of siRNA while keeping higher C5 mRNA inhibition activity.
In some embodiments, the double-stranded ribonucleic acid modification comprises a modification of at least one nucleotide. The modification of the nucleotide is at least one selected from the group consisting of modification of a ribose group and modification of a base. In some embodiments, "modification of a nucleotide" refers to substitution of the hydroxyl group at the 2' -position of the ribose group of the nucleotide with other groups to form the nucleotide or nucleotide derivative, or the base on the nucleotide is a nucleotide or nucleotide derivative of the modified base. The nucleotide modification does not result in a significant impairment or loss of the function of the siRNA to inhibit gene expression. For example, modified nucleotides disclosed in J.K.Watts, G.F.Deleavey, and M.J.damha, chemically modified siRNA: tools and applications. Drug discovery Today,2008,13 (19-20): 842-55 may be selected. The stability of siRNA can be improved through nucleotide modification, and the high inhibition efficiency of the siRNA to C5 gene can be maintained.
Illustratively, the modified nucleotide has the structure shown below:
wherein Base represents a Base, such as A, U, G, C or T. The hydroxyl group at the 2' -position of the ribose group is substituted by R. The hydroxyl group at the 2 '-position of these ribosyl groups may be substituted with various groups known to those skilled in the art, for example, a 2' -fluoro (2 '-F) modified nucleotide, a 2' -alkoxy modified nucleotide, a 2 '-substituted alkoxy modified nucleotide, a 2' -alkyl modified nucleotide, a 2 '-substituted alkyl modified nucleotide, a 2' -deoxyribonucleotide.
In some embodiments, the 2 '-alkoxy-modified nucleotide is 2' -methoxy (2 '-OMe,2' -O-CH) 3 ) Modified nucleotides, and the like.
In some embodiments, the 2' -substituted alkoxy-modified nucleotide is 2' -methoxyethoxy (2 ' -O-CH) 2 -CH 2 -O-CH 3 ) Modified nucleotides, 2' -O-CH 2 -CH＝CH 2 Modified nucleotides, and the like.
In some embodiments, the 2 '-substituted alkyl modified nucleotide is 2' -CH 2 -CH 2 -CH＝CH 2 Modified nucleotides, and the like.
In some embodiments, the modification of a nucleotide is a modification of a base. The modification of the base may be of various types known to those skilled in the art. Exemplary modifications of bases include, but are not limited to, m 6 A、Ψ、m 1 A、m 5 A、ms 2 i 6 A、i 6 A、m 3 C、m 5 C、ac 4 C、m 7 G、m 2,2 G、m 2 G、m 1 G、Q、m 5 U、mcm 5 U、ncm 5 U、ncm 5 Um、D、mcm 5 s 2 U、Inosine(I)、hm 5 C、s 4 U、s 2 U, azobenzene, cm, um, gm, t 6 A、yW、ms 2 t 6 A or AA derivative.
In some embodiments, a nucleotide derivative refers to a compound that is capable of replacing a nucleotide in a nucleic acid, but that differs in structure from an adenine ribonucleotide, a guanine ribonucleotide, a cytosine ribonucleotide, a uracil ribonucleotide, or a thymine deoxyribonucleotide. In some embodiments, the nucleotide derivative may be an iso-nucleotide, a bridged nucleotide (bridged nucleic acid, abbreviated BNA), or an acyclic nucleotide. BNA refers to a constrained or inaccessible nucleotide. BNA may contain a five-, six-, or seven-membered ring bridging structure with "fixed" C3' -endo-saccharides tucked. The bridge is typically incorporated at the 2'-, 4' -position of the ribose to provide a 2',4' -BNA nucleotide, such as LNA, ENA, cET, and the like.
LNA is shown in formula (1), ENA is shown in formula (2), and cET is shown in formula (3):
acyclic nucleotides are a class of nucleotides in which the sugar ring of the nucleotide is opened, such as an Unlocking Nucleic Acid (UNA) or a Glycerolipid Nucleic Acid (GNA), wherein UNA is represented by formula (4), and GNA is represented by formula (5):
in the above formula (4) and formula (5), R is selected from H, OH or alkoxy (O-alkyl).
In some embodiments, nucleotide derivative modifications refer to the substitution of a nucleotide in a nucleic acid for a nucleotide derivative. Illustratively, the nucleotide derivative is selected from the group consisting of an isopucleotide, LNA, ENA, cET, UNA or GNA.
In some embodiments, the nucleotides in the nucleic acid are replaced with an isonucleotide, also referred to as an isonucleoside modification in the context of the present disclosure. In some embodiments, the modification of the isonucleoside comprises incorporating the isonucleoside at one or more sites in the sense strand and/or the antisense strand of the siRNA to be modified in place of the natural nucleoside for coupling at the corresponding position.
In some embodiments, the modification of the isonucleoside uses a D-isonucleoside modification. In other embodiments, the modification of the isonucleoside is an L-isonucleoside modification. In still other embodiments, the modification of the isonucleoside uses a D-modification of the isonucleoside and a L-modification of the isonucleoside.
In some embodiments, the double-stranded ribonucleic acid modification comprises a modification of a phosphodiester bond at least one position. In some embodiments, modification of the phosphodiester linkage refers to substitution of at least one oxygen atom in the phosphodiester linkage with a sulfur atom to form a phosphorothioate linkage. Phosphorothioate linkages stabilize the double-stranded structure of the siRNA, preserving base pairing specificity. Exemplary phosphorothioate diester linkages are shown below:
In some embodiments, the double-stranded ribonucleic acid modification comprises a chemical modification of at least one of:
(1) Modification of at least one nucleotide in the sense strand,
(2) Modification of the phosphodiester bond in at least one position in the sense strand,
(3) Modification of at least one nucleotide in the antisense strand,
(4) Modification of the phosphodiester bond in at least one position in the antisense strand.
Further, the double-stranded ribonucleic acid modification is an siRNA modification comprising at least one of the chemical modifications of (1) to (4).
In the present disclosure, after sequence a in the sense strand is complementary to sequence B in the antisense strand to form a double-stranded region, the 3' ends of sequence a and sequence B may be any of the following:
(1) The 3' -ends of the sequence A and the sequence B form blunt ends;
(2) The 3 'end of sequence a has 1-2 protruding nucleotides extending out of the double-stranded region, and the 3' end of sequence B forms a blunt end;
(3) The 3 'end of sequence B has 1-2 protruding nucleotides extending out of the double-stranded region, and the 3' end of sequence a forms a blunt end;
(4) The 3 'end of sequence A has 1-2 protruding nucleotides extending out of the double-stranded region, and the 3' end of sequence B has 1-2 protruding nucleotides extending out of the double-stranded region.
In some embodiments, the nucleotide sequence of the sense strand is the sequence shown in sequence a and the nucleotide sequence of the antisense strand is the sequence shown in sequence B.
In some embodiments, when there are no protruding nucleotides at the 3 'ends of the sense strand and the antisense strand after the nucleotide sequences of the sense strand and the antisense strand are complementary to form a double-stranded region, 1-2 nucleotides are added as protruding nucleotides at the 3' end of at least one of the sense strand and the antisense strand. Wherein 1-2 nucleotides linked to the 3 '-end of the sense strand constitute the sequence D and 1-2 nucleotides linked to the 3' -end of the antisense strand constitute the sequence E. Correspondingly, the nucleotide sequence of the sense strand is the sequence shown in the sequence A and the connection sequence D, and the nucleotide sequence of the antisense strand is the sequence shown in the sequence B and the connection sequence E. Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B and sequence E. Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A and the sequence shown in sequence D, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B.
Illustratively, 2 deoxyribonucleotides (TT) are added as sequence D at the 3 'end of the sense strand and 2 deoxyribonucleotides (TT) are added as sequence E at the 3' end of the antisense strand. Alternatively, 2 deoxyribonucleotides (TT) were added as sequence E only at the 3' -end of the antisense strand. Alternatively, 2 deoxyribonucleotides (TT) were added as sequence D only at the 3' -end of the sense strand.
In some embodiments, when there are no protruding nucleotides at the 3 'end of the sense strand after the sense strand is complementary to the nucleotide sequence of the antisense strand to form a double-stranded region, a sequence D consisting of 1-2 nucleotides is added at the 3' end of the sense strand as the protruding nucleotide. Then, when the nucleotide sequence formed by ligating the sequence A to the sequence D is subjected to chemical modification, the sequence D consisting of 1 to 2 nucleotides is excluded. Correspondingly, in the double-stranded ribonucleic acid modification, the nucleotide sequence of the sense strand is the sequence shown in the sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in the sequence B. Alternatively, in the double-stranded ribonucleic acid modification, the nucleotide sequence of the sense strand is the sequence shown in sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B and the connecting sequence E.
In some embodiments, when sequence a has 1-2 nucleotides protruding from the 3 'end of sequence a beyond the double-stranded region after complementary formation of the double-stranded region with sequence B, the protruding nucleotide at the 3' end of sequence a is excluded as the nucleotide sequence of the sense strand. The sequence of the nucleotide excluding the 3 '-end overhang is called sequence A'. Correspondingly, the nucleotide sequence of the sense strand of the double-stranded ribonucleic acid modification is the sequence shown in the sequence A', and the nucleotide sequence of the antisense strand of the double-stranded ribonucleic acid modification is the sequence shown in the sequence B. Alternatively, the nucleotide sequence of the sense strand of the double-stranded ribonucleic acid modification is the sequence shown in sequence A', and the nucleotide sequence of the antisense strand of the double-stranded ribonucleic acid modification is the sequence shown in sequence B-linked sequence E.
In some embodiments, the sense strand of the siRNA modification comprises the following modifications in the 5 'to 3' terminal direction: ribonucleotides at positions 7, 9, 10 and 11 in the sense strand are 2' -fluoro modified ribonucleotides; the ribonucleotides at other positions in the sense strand are 2' -methoxy modified ribonucleotides.
In some embodiments, the sense strand of the siRNA modification comprises phosphorothioate linkages at the positions shown below, in the direction of the 5 'end towards the 3' end: between nucleotide 1 and nucleotide 2, between nucleotide 2 and nucleotide 3, between nucleotide 1 and nucleotide 2, and between nucleotide 2 and nucleotide 3.
In some embodiments, the sense strand of the siRNA modification comprises phosphorothioate linkages at the positions shown below, in the direction of the 5 'end towards the 3' end: between nucleotide 1 and nucleotide 2 from the 5 'end, and between nucleotide 2 and nucleotide 3 from the 5' end.
In some embodiments, the sense strand of the siRNA modification comprises phosphorothioate linkages at the positions shown below, in the direction of the 5 'end towards the 3' end: between nucleotide 1 and nucleotide 2, between nucleotide 2 and nucleotide 3, between nucleotide 3 and nucleotide 4, between nucleotide 1 and nucleotide 2, between nucleotide 2 and nucleotide 3, between nucleotide 3 and nucleotide 4.
In some specific embodiments, the sense strand of the siRNA modification has a sequence as set forth in (a 1 )-(a 3 ) The structure shown in any one of:
(a 1 )5’-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’，
(a 2 )5’-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’，
(a 3 )5’-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’；
wherein N is 1 -N 23 Independently of one another, from ribonucleotides of base A, U, C or G, the capital letter T representing the deoxyribonucleotide of base thymine and the lowercase letter m representing the adjacent ribonucleotide to the right of the letter m being 2' -O-CH 3 Modified ribonucleotide, lowercase letter F indicates that one ribonucleotide adjacent to the left side of the letter F is a 2' -F modified ribonucleotide, -(s) -indicates that two nucleotides adjacent to one another are linked by a phosphorothioate linkage.
In other specific embodiments, the sense strand of the siRNA modification has a sequence as set forth in (a 4 )-(a 5 ) The structure shown in any one of:
(a 4 )5’-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3’，
(a 5 )5’-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -3’；
wherein N is 1 -N 23 Independently of one another, from ribonucleotides of base A, U, C or G, the capital letter T representing the deoxyribonucleotide of base thymine and the lowercase letter m representing the adjacent ribonucleotide to the right of the letter m being 2' -O-CH 3 Modified ribonucleotide, lowercase letter F indicates that one ribonucleotide adjacent to the left side of the letter F is a 2' -F modified ribonucleotide, -(s) -indicates that two nucleotides adjacent to one another are linked by a phosphorothioate linkage.
In yet other specific embodiments, the sense strand of the siRNA modification has a sequence as set forth in (a 6 ) The structure shown:
(a 6 )5’-mN 1 -(s)-mN 2 -(s)-mN 3 -(s)-mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -(s)-mN 19 -(s)-T-(s)-T-3’；
wherein N is 1 -N 23 Independently of one another, from ribonucleotides of base A, U, C or G, the capital letter T representing the deoxyribonucleotide of base thymine and the lowercase letter m representing the adjacent ribonucleotide to the right of the letter m being 2' -O-CH 3 Modified ribonucleotide, lowercase letter F indicates that one ribonucleotide adjacent to the left side of the letter F is a 2' -F modified ribonucleotide, -(s) -indicates that two nucleotides adjacent to one another are linked by a phosphorothioate linkage.
In some embodiments, the antisense strand of the siRNA modification comprises modifications in the 5 'to 3' terminal direction as follows: the ribonucleotide at any odd number position in the antisense strand is a 2 '-methoxy modified ribonucleotide, and the ribonucleotide at any even number position in the antisense strand is a 2' -fluoro modified ribonucleotide.
In some embodiments, the antisense strand of the siRNA modification comprises modifications in the 5 'to 3' terminal direction as follows: the ribonucleotides at the 2 nd, 6 th, 14 th and 16 th positions in the antisense strand are 2 '-fluoro modified ribonucleotides, and the ribonucleotides at the rest positions in the antisense strand are 2' -methoxy modified ribonucleotides.
In some embodiments, the antisense strand of the siRNA modification comprises modifications in the 5 'to 3' terminal direction as follows: the ribonucleotides at the 2 nd, 6 th, 8 th, 9 th, 14 th and 16 th positions in the antisense strand are 2 '-fluoro modified ribonucleotides along the direction from the 5' end to the 3 'end, and the ribonucleotides at the rest positions in the antisense strand are 2' -methoxy modified ribonucleotides.
In some embodiments, the antisense strand of the siRNA modification comprises modifications in the 5 'to 3' terminal direction as follows: the ribonucleotides at the 2 nd, 14 th and 16 th positions in the antisense strand are 2 '-fluoro modified ribonucleotides, the ribonucleotide at the 6 th position in the antisense strand is a nucleotide derivative GNA modified ribonucleotide, and the ribonucleotides at the rest positions in the antisense strand are 2' -methoxy modified ribonucleotides.
In some embodiments, the antisense strand of the siRNA modification comprises modifications in the 5 'to 3' terminal direction as follows: the ribonucleotides at the 2 nd, 6 th, 14 th and 16 th positions in the antisense strand are 2 '-fluoro modified ribonucleotides, the ribonucleotide at the 7 th position in the antisense strand is a nucleotide derivative GNA modified ribonucleotide, and the ribonucleotides at the rest positions in the antisense strand are 2' -methoxy modified ribonucleotides.
In some embodiments, the antisense strand of the siRNA modification comprises phosphorothioate linkages at the positions shown below, in the direction of the 5 'end toward the 3' end: between nucleotide 1 and nucleotide 2, between nucleotide 2 and nucleotide 3, between nucleotide 1 and nucleotide 2, and between nucleotide 2 and nucleotide 3.
In some embodiments, the antisense strand of the siRNA modification comprises phosphorothioate linkages at the positions shown below, in the direction of the 5 'end toward the 3' end: between nucleotide 1 and nucleotide 2, between nucleotide 2 and nucleotide 3, between nucleotide 3 and nucleotide 4, and between nucleotide 3.
In some embodiments, the nucleotide at the 5' end of the antisense strand is linked to a 5' phosphate group or a 5' phosphate derivative group in a direction from the 5' end to the 3' end. Exemplary, the structure of the 5' phosphate group is: The structure of the 5' phosphate derivative group includes, but is not limited to: />Etc.
In some specific embodiments, the siRNA modifier antisense strand has the following (b 1 )-(b 3 ) The structure shown in any one of:
(b 1 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -N 4 f-mN 5 -N 6 f-mN 7 -N 8 f-mN 9 -N 10 f-mN 11 -N 12 f-mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -N 18 f-mN 19 -(s)-T-(s)-T-3’，
(b 2 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -N 4 f-mN 5 -N 6 f-mN 7 -N 8 f-mN 9 -N 10 f-mN 11 -N 12 f-mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -N 18 f-mN 19 -(s)-N 20 f-(s)-mN 21 -3’，
(b 3 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -N 4 f-mN 5 -N 6 f-mN 7 -N 8 f-mN 9 -N 10 f-mN 11 -N 12 f-mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -N 18 f-mN 19 -N 20 f-mN 21 -(s)-N 22 f-(s)-mN 23 -3’；
wherein N is 1 -N 23 Independently of one another, from ribonucleotides of base A, U, C or G, the capital letter T representing the deoxyribonucleotide of base thymine and the lowercase letter m representing the adjacent ribonucleotide to the right of the letter m being 2' -O-CH 3 Modified ribonucleotide, lower case letter F indicates that one ribonucleotide adjacent to the left side of the letter F is a 2' -F modified ribonucleotide, P1 tableOne nucleotide adjacent to the right of the letter is shown as a 5' -phosphonucleotide, -(s) -means that two nucleotides adjacent to one another are linked by a phosphorothioate diester linkage.
In other specific embodiments, the siRNA modifier antisense strand has the following (b 4 )-(b 17 ) The structure shown in any one of:
(b 4 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’，
(b 5 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’，
(b 6 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’，
(b 7 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -N 8 f-N 9 f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’，
(b 8 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -N 8 f-N 9 f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’，
(b 9 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -N 8 f-N 9 f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’，
(b 10 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -[GNA]N 6 -mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’，
(b 11 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -[GNA]N 6 -mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’，
(b 12 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -[GNA]N 6 -mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’，
(b 13 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-[GNA]N 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’，
(b 14 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-[GNA]N 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’，
(b 15 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-[GNA]N 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’，
(b 16 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -(s)-N 4 f-mN 5 -N 6 f-mN 7 -N 8 f-mN 9 -N 10 f-mN 11 -N 12 f-mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -N 18 f-(s)-mN 19 -(s)-T-(s)-T-3’，
(b 17 )5’-EVPmN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’；
wherein N is 1 -N 23 Independently of one another, from ribonucleotides of base A, U, C or G, the capital letter T denoting the deoxynucleotide of base thymineRibonucleotides, the lower case letter m indicates that the adjacent ribonucleotide to the right of the letter m is 2' -O-CH 3 Modified ribonucleotide, lowercase letter F indicates that one ribonucleotide adjacent to the left of the letter F is a 2' -F modified ribonucleotide, P1 indicates that one nucleotide adjacent to the right of the letter is a 5' -phosphonucleotide, EVP indicates that one nucleotide adjacent to the right thereof is a 5' -trans-vinylphosphonucleotide, -(s) -indicates that two nucleotides adjacent to the front and rear are linked by a phosphorothioate diester linkage, [ GNA ] ]Indicating that the adjacent ribonucleotide on the right hand side is the ribonucleotide with the GNA modification.
In some alternative embodiments, the sense strand comprises a nucleotide sequence set forth in any one of SEQ ID NOS: 238-249, 436-471, 552-564, and the antisense strand comprises a nucleotide sequence set forth in any one of SEQ ID NOS: 250-257, 472-518, 565-594.
In some embodiments, double stranded ribonucleic acid modifications include, but are not limited to, siRNA modifications as shown in table 2.
Double-stranded ribonucleic acid conjugate
A third aspect of the present disclosure provides a double-stranded ribonucleic acid conjugate, which is obtained by conjugation of the double-stranded ribonucleic acid provided in the first aspect of the present disclosure or the double-stranded ribonucleic acid modified provided in the second aspect with a conjugation group.
In the present disclosure, the sense strand and the antisense strand of the double-stranded ribonucleic acid conjugate form a double-stranded region of the double-stranded ribonucleic acid conjugate, and a blunt end is formed at the 3' -end of the sense strand of the double-stranded ribonucleic acid conjugate. In some embodiments, the 3 'end of the sense strand of the double-stranded ribonucleic acid conjugate forms a blunt end, and the 3' end of the antisense strand of the double-stranded ribonucleic acid conjugate has 1-2 protruding nucleotides extending out of the double-stranded region. In other embodiments, the 3 'end of the sense strand of the double-stranded ribonucleic acid conjugate forms a blunt end and the 3' end of the antisense strand of the double-stranded ribonucleic acid conjugate forms a blunt end.
In some preferred embodiments, the double-stranded ribonucleic acid conjugate is obtained by a conjugated linkage of a double-stranded ribonucleic acid modification to a conjugate group. Wherein the sense strand and the antisense strand of the double-stranded ribonucleic acid modification are complementary to form a double-stranded region of the double-stranded ribonucleic acid modification, and the 3 '-end of the sense strand of the double-stranded ribonucleic acid modification forms a blunt end, and the conjugate group is conjugated to the 3' -end of the sense strand having the blunt end to form a double-stranded ribonucleic acid conjugate.
Illustratively, the sense strand of the double-stranded ribonucleic acid modification is the sequence shown in sequence a, and the antisense strand is the sequence shown in sequence B linked to sequence E. And, the 3 '-end of the sense strand of the double-stranded ribonucleic acid modification forms a blunt end, and the 3' -end of the sense strand of the double-stranded ribonucleic acid modification is linked to a conjugate group, forming a double-stranded ribonucleic acid conjugate.
Illustratively, the sense strand of the double-stranded ribonucleic acid modification is the sequence shown in sequence a and the antisense strand is the sequence shown in sequence B. And, the 3 '-end of the sense strand of the double-stranded ribonucleic acid modification forms a blunt end, and the 3' -end of the sense strand of the double-stranded ribonucleic acid modification is connected with a conjugate group to form a double-stranded ribonucleic acid conjugate.
Illustratively, the sense strand of the double-stranded ribonucleic acid modification is the sequence shown by sequence a linked to sequence D and the antisense strand is the sequence shown by sequence B linked to sequence E. The 3' -end of the sense strand of the double-stranded ribonucleic acid modification has a sequence D consisting of 1-2 protruding nucleotides, and the 3' -end of the sense strand of the double-stranded ribonucleic acid modification is removed from the sequence D, and then a conjugate group is attached to the 3' -end of the sequence A to form a double-stranded ribonucleic acid conjugate.
Illustratively, the sense strand of the double-stranded ribonucleic acid modification is the sequence shown in sequence a linked to sequence D and the antisense strand is the sequence shown in sequence B. The 3' -end of the sense strand of the double-stranded ribonucleic acid modification has a sequence D consisting of 1-2 protruding nucleotides, and the 3' -end of the sense strand of the double-stranded ribonucleic acid modification is removed from the sequence D, and then a conjugate group is attached to the 3' -end of the sequence A to form a double-stranded ribonucleic acid conjugate.
Illustratively, the sense strand of the double-stranded ribonucleic acid modification is the sequence shown in sequence a, and the antisense strand is the sequence shown in sequence B linked to sequence E. Wherein the 3' -end of the sequence A has a protruding nucleotide extending out of the double-stranded region, and the sequence (also called sequence A ') from which the protruding nucleotide located at the 3' -end in the sequence A is excluded is used as the nucleotide sequence for the linking conjugate group. Thus, the nucleotide sequence of the sense strand of the double-stranded ribonucleic acid conjugate is the sequence shown as sequence A', and the nucleotide sequence of the antisense strand is the sequence shown as sequence B linked to sequence E.
Illustratively, the sense strand of the double-stranded ribonucleic acid modification is the sequence shown in sequence a and the antisense strand is the sequence shown in sequence B. Wherein the 3' -end of the sequence A has a protruding nucleotide extending out of the double-stranded region, and the sequence (also called sequence A ') from which the protruding nucleotide located at the 3' -end in the sequence A is excluded is used as the nucleotide sequence for the linking conjugate group. Thus, the nucleotide sequence of the sense strand of the double-stranded ribonucleic acid conjugate is the sequence shown as sequence a', and the nucleotide sequence of the antisense strand is the sequence shown as sequence B.
In some alternative embodiments, the sense strand of the double-stranded ribonucleic acid conjugate has a sequence as shown in (d 1 )-(d 2 ) The structure shown in any one of:
(d 1 )5’-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -L96-3’，
(d 2 )5’-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -L96-3’；
wherein N is 1 -N 23 Independently of one another, from ribonucleotides of base A, U, C or G, the capital letter T denoting the deoxyribonucleotide of base thymine, the lowercaseThe letter m indicates that one ribonucleotide adjacent to the right side of the letter m is 2' -O-CH 3 Modified ribonucleotide, lowercase letter F indicates that one ribonucleotide adjacent to the left side of the letter F is a 2' -F modified ribonucleotide, -(s) -indicates that two nucleotides adjacent to one another are linked by a phosphorothioate linkage. L96 is also the conjugate group GalNAc of formula I.
In some alternative embodiments, the antisense strand of the double-stranded ribonucleic acid conjugate has a sequence as shown in (b 1 )-(b 3 ) The structure shown in any one of:
(b 1 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -N 4 f-mN 5 -N 6 f-mN 7 -N 8 f-mN 9 -N 10 f-mN 11 -N 12 f-mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -N 18 f-mN 19 -(s)-T-(s)-T-3’，
(b 2 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -N 4 f-mN 5 -N 6 f-mN 7 -N 8 f-mN 9 -N 10 f-mN 11 -N 12 f-mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -N 18 f-mN 19 -(s)-N 20 f-(s)-mN 21 -3’，
(b 3 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -N 4 f-mN 5 -N 6 f-mN 7 -N 8 f-mN 9 -N 10 f-mN 11 -N 12 f-mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -N 18 f-mN 19 -N 20 f-mN 21 -(s)-N 22 f-(s)-mN 23 -3’；
wherein N is 1 -N 23 Independently of one another, from ribonucleotides of base A, U, C or G, the capital letter T representing the deoxyribonucleotide of base thymine and the lowercase letter m representing the adjacent ribonucleotide to the right of the letter m being 2' -O-CH 3 Modified ribonucleotides, lowercase letter fThe one adjacent to the left of the letter F is shown as a 2'-F modified ribonucleotide, P1 represents the one adjacent to the right of the letter as a 5' -phosphonucleotide, -(s) -represents the joining of two nucleotides adjacent one to the other in phosphorothioate linkages.
In other alternative embodiments, the antisense strand of the double-stranded ribonucleic acid conjugate has a sequence as shown in (b 4 )-(b 17 ) The structure shown in any one of:
(b 4 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’，
(b 5 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’，
(b 6 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’，
(b 7 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -N 8 f-N 9 f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’，
(b 8 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -N 8 f-N 9 f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’，
(b 9 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -N 8 f-N 9 f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’，
(b 10 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -[GNA]N 6 -mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’，
(b 11 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -[GNA]N 6 -mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’，
(b 12 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -[GNA]N 6 -mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’，
(b 13 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-[GNA]N 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’，
(b 14 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-[GNA]N 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’，
(b 15 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-[GNA]N 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’，
(b 16 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -(s)-N 4 f-mN 5 -N 6 f-mN 7 -N 8 f-mN 9 -N 10 f-mN 11 -N 12 f-mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -N 18 f-(s)-mN 19 -(s)-T-(s)-T-3’，
(b 17 )5’-EVPmN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’；
wherein N is 1 -N 23 Are independent of each otherThe standing is selected from ribonucleotides with base A, U, C or G, the capital letter T denotes the deoxyribonucleotide with base thymine, the lower case letter m denotes the adjacent ribonucleotide to the right of the letter m as 2' -O-CH 3 Modified ribonucleotide, lowercase letter F indicates that one ribonucleotide adjacent to the left of the letter F is a 2' -F modified ribonucleotide, P1 indicates that one nucleotide adjacent to the right of the letter is a 5' -phosphate nucleotide, and EVP indicates that one nucleotide adjacent to the right thereof is a 5' -trans-vinylphosphate nucleotide; -(s) -means that two nucleotides adjacent to each other are linked by a phosphorothioate linkage; [ GNA ] ]Indicating that the adjacent ribonucleotide on the right hand side is the ribonucleotide with the GNA modification.
Further, the double-stranded ribonucleic acid conjugate is an siRNA conjugate, wherein the siRNA molecule of the siRNA conjugate attached to the conjugate group may be an unmodified siRNA, or an siRNA modification. The siRNA molecule modified by the conjugate group has better tissue and organ targeting and capability of promoting endocytosis while maintaining higher inhibition activity and stability, can reduce the influence on other tissues or organs and the use amount of the siRNA molecule, and can achieve the aims of reducing toxicity and cost. Alternatively, any one of the siRNA molecules shown in table 1 or table 2 is selected to be linked to a conjugate group to obtain a double-stranded ribonucleic acid conjugate.
The conjugation site of the siRNA to the conjugation group may be at the 3' end or the 5' end of the sense strand of the siRNA, or at the 5' end of the antisense strand, or in the internal sequence of the siRNA. In some embodiments, the conjugation site of the siRNA to the conjugation group is at the 3' end of the sense strand of the siRNA.
In some embodiments, the conjugate group may be attached to the phosphate group, the 2' -hydroxyl group, or the base of the nucleotide. In some embodiments, the conjugate group may also be attached to the 3' -hydroxyl group, in which case the nucleotides are linked using a 2',5' -phosphodiester linkage. When a conjugate group is attached to the end of the siRNA strand, the conjugate group is typically attached to the phosphate group of the nucleotide; when a conjugate group is attached to the internal sequence of the siRNA, the conjugate group is typically attached to a ribose sugar ring or base. Various connection means can be referred to as: muthiah Manoharan et al, siRNA conjugates carrying sequentially assembled trivalent N-acetylgalactosamine linked through nucleosides elicit robust gene silencing in vivo in hepatocytocytocytosis, ACS Chemical biology,2015,10 (5): 1181-7.
In the present disclosure, the conjugate group may be a ligand conventionally used in the field of siRNA administration. In some embodiments, the conjugate group may be selected from one or more of the following ligands formed by the targeting molecule or derivative thereof: lipophilic molecules, such as cholesterol, bile acids, vitamins (e.g. vitamin E), lipid molecules of different chain lengths; polymers, such as polyethylene glycol; polypeptides, such as permeabilizing peptides; an aptamer; an antibody; a quantum dot; sugars, such as lactose, mannose, galactose, N-acetylgalactosamine (GalNAc); folic acid (folate); receptor ligands expressed by hepatic parenchymal cells, such as asialoglycoproteins, asialoglycoresidues, lipoproteins (e.g., high density lipoproteins, low density lipoproteins, etc.), glucagon, neurotransmitters (e.g., epinephrine), growth factors, transferrin, etc.
In some specific embodiments, the conjugate group has the structure shown below:
the conjugate group shown in the formula I is GalNAc, the GalNAc has liver targeting property, and can deliver siRNA molecules into liver tissues with high specificity and specifically inhibit high expression of C5 genes in the liver.
In some specific embodiments, galNAc is conjugated to the 3' end of the sense strand via a phosphodiester linkage to provide an siRNA conjugate of the structure shown below:
Wherein the double helix structure is unmodified siRNA or siRNA modifier.
In some embodiments, double-stranded ribonucleic acid conjugates include, but are not limited to, siRNA conjugates as shown in table 3.
Pharmaceutical composition
A fourth aspect of the present disclosure provides a pharmaceutical composition comprising one or more of the double-stranded ribonucleic acid of the first aspect, the double-stranded ribonucleic acid modification of the second aspect, and the double-stranded ribonucleic acid conjugate of the third aspect.
In some embodiments, the pharmaceutical composition contains an siRNA as described above as an active ingredient and a pharmaceutically acceptable carrier. In the present disclosure, the purpose of using a pharmaceutical composition is to promote administration to a living body, facilitate absorption of an active ingredient, and further exert biological activity. The pharmaceutical compositions of the present disclosure may be administered by any form, including injection (intra-arterial, intravenous, intramuscular, intraperitoneal, subcutaneous), mucosal, oral (oral solid, oral liquid), rectal, inhalation, implant, topical (e.g., ocular) administration, and the like. Non-limiting examples of oral solid formulations include, but are not limited to, powders, capsules, lozenges, granules, tablets, and the like. Non-limiting examples of liquid formulations for oral or mucosal administration include, but are not limited to, suspensions, tinctures, elixirs, solutions, and the like. Non-limiting examples of topical formulations include, but are not limited to, emulsions, gels, ointments, creams, patches, pastes, foams, lotions, drops or serum formulations. Non-limiting examples of parenteral formulations include, but are not limited to, solutions for injection, dry powders for injection, suspensions for injection, emulsions for injection, and the like. The pharmaceutical compositions of the present disclosure may also be formulated in controlled-release or delayed-release dosage forms (e.g., liposomes or microspheres).
In the present disclosure, the route of administration can be varied or adjusted in any suitable manner to meet the needs of the nature of the drug, the convenience of the patient and medical personnel, and other relevant factors.
Medical application
A fifth aspect of the present disclosure provides for at least one of the following uses of a double-stranded ribonucleic acid, a double-stranded ribonucleic acid modification, or a double-stranded ribonucleic acid conjugate:
(1) Inhibiting C5 gene expression, or preparing a medicament for inhibiting C5 gene expression;
(2) For preventing or treating a disease associated with abnormal expression of a C5 gene, or for preparing a medicament for preventing or treating a disease associated with abnormal expression of a C5 gene;
(3) For treating a subject suffering from a disease that would benefit from reduced expression of the complement C5 gene, or for preparing a medicament for treating a subject suffering from a disease that would benefit from reduced expression of the complement C5 gene.
The present disclosure further provides the use of an siRNA molecule (including unmodified siRNA, siRNA modification, siRNA conjugate) or a pharmaceutical composition in at least one of (1) - (3) above.
In the present disclosure, aberrant expression of the C5 gene results in inappropriate activation of the complement system, causing one or more of the following diseases associated with aberrant expression of the C5 gene: paroxysmal nocturnal hemoglobinuria, atypical hemolytic uremic syndrome, extensive myasthenia gravis, thromboembolism, neuromyelitis optica, antibody-mediated renal graft rejection, ji Lanba Rate syndrome, anti-neutrophil cytoplasmic antibody-associated vasculitis, amyotrophic lateral sclerosis, parkinson's disease, autoimmune encephalitis, igG 4-associated diseases, asthma, anti-phospholipid antibody syndrome, ischemia reperfusion injury, atypical hemolytic uremic syndrome, multifocal motor neuropathy, multiple sclerosis, thrombotic thrombocytopenic purpura, traumatic brain injury, condensed collectin disease, dermatomyositis, hemolytic uremic syndrome associated with shiga toxin-producing escherichia coli, graft dysfunction, myocardial infarction, sepsis, atherosclerosis, infectious shock, spinal cord injury, psoriasis, autoimmune hemolytic anemia, antiphospholipid syndrome, myocarditis, immune complex vasculitis, high-amp disease, kawasaki disease, rheumatoid arthritis, and the like.
The siRNA molecule causes the expression of the C5 gene to be inhibited by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, effecting treatment of a disease associated with aberrant expression of the C5 gene.
In some embodiments, the present disclosure provides a method of inhibiting expression of a C5 gene in a cell comprising contacting a double-stranded ribonucleic acid, a double-stranded ribonucleic acid modification, a double-stranded ribonucleic acid conjugate, or a pharmaceutical composition with the cell.
Further, the method for inhibiting the expression of C5 gene in the cell is to introduce siRNA molecule (including unmodified siRNA, siRNA modification, siRNA conjugate) or pharmaceutical composition into the cell.
In some embodiments, the cell is an in vivo cell or an in vitro cell. In some specific embodiments, the cell is in a subject.
In some embodiments, the present disclosure provides methods of preventing or treating a disease comprising administering to a subject double-stranded ribonucleic acid, a double-stranded ribonucleic acid modification, a double-stranded ribonucleic acid conjugate, or a pharmaceutical composition.
Further, the method of preventing or treating a disease is to administer an siRNA molecule (including unmodified siRNA, siRNA modification, siRNA conjugate) or a pharmaceutical composition to a subject.
In the present disclosure, "subject" includes either human or non-human animals, preferably vertebrates, and more preferably mammals. The subject may comprise a transgenic organism. Most preferably, the subject is a human. Further, the subject has at least one of the following characteristics:
(1) Abnormal expression of C5 gene in vivo, more specifically abnormal high expression of C5 gene;
(2) Suffering from a disease associated with abnormal expression of the C5 gene;
(3) With diseases that would benefit from reduced C5 gene expression. Such as a person suffering from or predisposed to a disease associated with abnormal expression of the C5 gene.
TABLE 1siRNA sequence information
/>
/>
/>
/>
/>
/>
/>
/>
/>
TABLE 2siRNA modifier
/>
/>
/>
/>
/>
/>
/>
/>
The capital letters "G", "C", "A", "T" and "U" in the above tables each generally represent nucleotides containing guanine, cytosine, adenine, thymine and uracil, respectively, as bases; mA, mU, mC, mG: a nucleotide representing 2' -methoxy modification; af. Gf, cf, uf: a 2' -fluoro modified nucleotide; the lower case letter s indicates that phosphorothioate linkages are between two nucleotides adjacent to the letter s; p1: indicating that the one nucleotide adjacent to the right of P1 is a nucleotide 5 '-phosphate, EVP indicates that the one nucleotide adjacent to the right thereof is a nucleotide 5' -trans-vinylphosphate; [ GNA ] means that one of the ribonucleotides adjacent to the right thereof is a ribonucleotide in which GNA modification is present.
TABLE 3siRNA conjugates
/>
/>
/>
The capital letters "G", "C", "A", "T" and "U" in the above tables each generally represent nucleotides "containing guanine, cytosine, adenine, thymine and uracil, respectively, as bases; mA, mU, mC, mG: a nucleotide representing 2' -methoxy modification; af. Gf, cf, uf: a 2' -fluoro modified nucleotide; the lower case letter s indicates that phosphorothioate linkages are between two nucleotides adjacent to the letter s; p1: indicating that the one nucleotide adjacent to the right of P1 is a nucleotide 5 '-phosphate, EVP indicates that the one nucleotide adjacent to the right thereof is a nucleotide 5' -trans-vinylphosphate; [ GNA ] means that one of the ribonucleotides adjacent to the right thereof is a ribonucleotide having a GNA modification; l96 is also the conjugate group GalNAc of formula I.
Examples
Other objects, features and advantages of the present disclosure will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating specific embodiments of the disclosure, are given by way of illustration only, since various changes and modifications within the spirit and scope of the disclosure will become apparent to those skilled in the art from this detailed description.
The experimental techniques and methods used in this example are conventional techniques unless otherwise specified, such as those not specified in the following examples, and are generally performed under conventional conditions such as Sambrook et al, molecular cloning: conditions described in the laboratory Manual (New York: cold Spring Harbor Laboratory Press, 1989) or as recommended by the manufacturer. Materials, reagents and the like used in the examples are all available from a regular commercial source unless otherwise specified.
The siRNA, siRNA modification, siRNA conjugate related to the following examples were synthesized by the company of tenin biotechnology (shanghai), and the cell, reagent and instrument consumables used in the examples are shown in table 4:
TABLE 4 Table 4
Example 1: synthesis of siRNA
1.1siRNA sequence design
Multiple pairs of C5 siRNAs were designed at different loci based on human C5 gene mRNA sequences, and all single siRNAs designed were able to target all transcripts of the target gene (as in Table 5), and these multiple pairs of siRNAs were aligned via sequence similarity software to have minimal homology to all other non-target gene sequences.
TABLE 5
Target gene Species of species Gene ID NM_ID
complement C5(C5) Homo sapiens 727 NM_001735.3
Target sequences for designing siRNA are shown below, the target sequences are derived from the gene mRNA sequence of C5 (see nm_ 001735.3).
Target sequence I:
caaaactctgcaatcttaacaatacaaccaaaacaattgcctggaggacaaaacccagtttcttatgtgtatttggaagttgta(SEQ ID NO:1)
target sequence I-1:
caaaactctgcaatcttaacaa(SEQ ID NO:8)
target sequence I-2:
tgtgtatttggaagttgta(SEQ ID NO:9)
target sequence II:
gtatgtggacgatcaaggctaaatataaagaggacttttcaacaactggaaccgcatattttgaagttaaagaatatgtcttgccacatttttctgtctcaatcgagccagaatataatttcattggttacaagaactttaagaattttgaaattactataaaagcaagatatttttataataaagtagtcactgaggctgacgtttatatcacatttggaataagagaagacttaaaagatgatcaaaaagaaatgatgcaaacagcaatgcaaaacacaatgttgata(SEQ ID NO:2)
target sequence II-1:
gtatgtggacgatcaaggctaaatataaaga(SEQ ID NO:10)
target sequence II-2:
accgcatattttgaagtta(SEQ ID NO:11)
target sequence II-3:
atttcattggttacaagaa(SEQ ID NO:12)
target sequence II-4:
actgaggctgacgtttata(SEQ ID NO:13)
target sequence II-5:
gcaaaacacaatgttgata(SEQ ID NO:14)
target sequence III:
tgcacaaacaattgatgtaaaccaagagacatctgacttggatccaagcaaaagtgtaacacgtgttgatgatggagtagcttcctttgtgcttaatctcccatctggagtgacggtgctggagtttaatgtcaaaactgatgctccagatcttccagaagaaaatcaggccagggaaggttaccgagcaatagcatactcatctctcagccaaagttacctttatattgattggactgataaccataaggctttgctagtgggagaacatctgaatattattgttacccccaaaagcccatatattgacaaaataactcactataattacttgattttatccaagggcaaaattatccactttggcacgagggagaaattttcagatgcatcttatcaaagtataaacattccagtaacacagaacatggttccttcatcccgacttctggtctattacatcgtcacaggagaacagacagcagaattagtgtctgattcagtctggttaaatattgaagaaaaatgtggcaaccagctccaggttcatctgtctcctgatgcagatgcatattctccaggccaaactgtgtctcttaatatggcaactggaa(SEQ ID NO:3)
target sequence III-1:
tgcacaaacaattgatgta(SEQ ID NO:15)
target sequence III-2:
attggactgataaccataa(SEQ ID NO:16)
target sequence III-3:
agtataaacattccagtaa(SEQ ID NO:17)
target sequence III-4:
cgtcacaggagaacagaca(SEQ ID NO:18)
target sequence III-5:
cttaatatggcaactggaa(SEQ ID NO:19)
target sequence IV:
gaaattctcaggccaagaagaacgctgcaaaagaagatagaagaaatagctgctaaatataaacattcagtagtgaagaaatgttgttacgatggagcctgcgttaataatgatgaaacctgtgagcagcgagctgcacggattagtttagggccaagatgcatcaaagctttcactgaatgttgtgtcgtcgcaagccagctccgtgctaatatctctcataaagacatgcaattgggaaggctacacatgaagaccctgttaccagtaagcaagccagaaattcggagttattttccagaaagctggttgtgggaagttcatcttgttcccagaagaaaacagttgcagtttgccctacctgattctctaaccacctgggaaattcaaggcgttggcatttcaaacactggtatatgtgttgctgatactgtcaaggcaaaggtgttcaaagatgtcttcctggaaatgaatataccatattctgttgtacgaggagaacagatccaattgaaaggaactgtttacaactataggacttctgggatgcagttctgtgttaaaatgtctgctgtggagggaatctgcacttcggaaagcccagtcattgatcatcagggcacaaagtcctccaaatgtgtgcgccagaaagtagagggctcctccagtcacttggtgacattcactgtgctt(SEQ ID NO:4)
target sequence IV-1:
gaaattctcaggccaagaagaacgctgcaaaagaagataga(SEQ ID NO:20)
target sequence IV-2:
tgcgttaataatgatgaaa(SEQ ID NO:21)
target sequence IV-3:
gattagtttagggccaagatgcatcaaagctttca(SEQ ID NO:22)
target sequence IV-4:
ctcataaagacatgcaatt(SEQ ID NO:23)
target sequence IV-5:
gccctacctgattctctaa(SEQ ID NO:24)
target sequence IV-6:
gttgtacgaggagaacaga(SEQ ID NO:25)
target sequence IV-7:
ggtgacattcactgtgctt(SEQ ID NO:26)
target sequence V:
ggtaccattagcagacgaaaggagttcccatacaggatacccttagatttggtccccaaaacagaaatcaaaaggattttgagtgtaaaaggactgcttgtaggtgagatcttgtctgcagttctaagtcaggaaggcatcaatatcctaacccacctccccaaagggagtgcagaggcggagctgatgagcgttgtcccagtattctatgtttttcactacctggaaacaggaaatcattggaacatttttcattctgacccattaattgaaaagcagaaactgaagaaaaaattaaaagaagggatgttgagcattatgtcctacagaaatgctgactactcttacagtgtgtggaagggtggaagtgctagcacttggttaacagcttttgctttaagagtacttggacaagtaaataaatacgtagagcagaaccaaaattcaatttgtaattctttattgtggctagttgagaattatcaattagataatggatctttcaaggaaaattcacagtatcaaccaataaaattacagggtaccttgcctgttgaagcccgagagaacagcttatatcttacagcctttactgtgattggaattagaaaggctttcgatatatgccccctggtgaaaatcgacacagctctaattaaagctgacaactttctgcttgaaaat(SEQ ID NO:5)
target sequence V-1:
ggtaccattagcagacgaa(SEQ ID NO:27)
target sequence V-2:
tgcagttctaagtcaggaaggcatcaatat(SEQ ID NO:28)
target sequence V-3:
attaattgaaaagcagaaa(SEQ ID NO:29)
target sequence V-4:
tgttgagcattatgtccta(SEQ ID NO:30)
target sequence V-5:
gagtacttggacaagtaaa(SEQ ID NO:31)
target sequence V-6:
tattgtggctagttgagaattatcaatta(SEQ ID NO:32)
target sequence V-7:
gcccgagagaacagcttatatcttaca(SEQ ID NO:33)
target sequence V-8:
acaactttctgcttgaaaat(SEQ ID NO:34)
target sequence VI:
acggcacgtatggtagaaacaactgcctatgctttactcaccagtctgaacttgaaagatataaattatgttaacccagtcatcaaatggctatcagaagagcagaggtatggaggtggcttttattcaacccaggacacaatcaatgccattgagggcctgacggaatattcactcctggttaaacaactccgcttgagtatggacatcgatgtttcttacaagcataaaggtgccttacataattataaaatgacagacaagaatttccttgggaggccagtagaggtgcttctcaatgatgacctcattgtcagtacaggatttggcagtggcttggctacagtacatgtaacaactgtagttcacaaaaccagtacctctgaggaagtttgcagcttttatttgaaaatcgatactcaggat(SEQ ID NO:6)
target sequence VI-1:
acggcacgtatggtagaaa(SEQ ID NO:35)
target sequence VI-2:
ctgaacttgaaagatataa(SEQ ID NO:36)
target sequence VI-3:
ccagtcatcaaatggctat(SEQ ID NO:37)
target sequence VI-4:
gatgtttcttacaagcataa(SEQ ID NO:38)
target sequence VI-5:
ctcattgtcagtacaggat(SEQ ID NO:39)
target sequence VI-6:
cttttatttgaaaatcgatactcaggat(SEQ ID NO:40)
target sequence VII:
tggaatcagtgcaaatgaagaagacttaaaagcccttgtggaaggggtggatcaactattcactgattaccaaatcaaagatggacatgttattctgcaactgaattcgattccctccagtgatttcctttgtgtacgattccggatatttgaactctttgaagttgggtttctcagtcctgccactttcacagtgtacgaataccacagaccagataaacagtgtaccatgttttatagcacttccaatatcaaaattcagaaagtctgtgaaggagccgcgtgcaagtgtgtagaagctgattgtgggcaaatgcaggaagaattggatctgacaatctctgcagagacaagaaaacaaacagcatgtaaaccagagattgcatatgcttataaagttagcatcacatccatcactgtagaaaatgtttttgtcaagtacaaggcaacccttctggatatctacaaaactggggaagctgttgctgagaaagactctgagattaccttcattaaaaaggtaacctgtactaacgctgagctggtaaaaggaagacagtacttaattatgggtaaagaagccctccagataaaatacaatttcagtttcaggtacatctaccctttagattccttgacctggattgaatactggcctagagacacaacatgttcatcgtgtcaagcatttttagctaatttagatgaatttgccgaagatatctttttaa(SEQ ID NO:7)
target sequence VII-1:
tggaatcagtgcaaatgaa(SEQ ID NO:41)
target sequence VII-2:
ccaaatcaaagatggacat(SEQ ID NO:42)
target sequence VII-3:
ggatatttgaactctttgaa(SEQ ID NO:43)
target sequence VII-4:
ctttcacagtgtacgaata(SEQ ID NO:44)
target sequence VII-5:
caagtgtgtagaagctgat(SEQ ID NO:45)
target sequence VII-6:
tgcagagacaagaaaacaa(SEQ ID NO:46)
target sequence VII-7:
gttagcatcacatccatcactgtagaaaa(SEQ ID NO:47)
target sequence VII-8:
gctgagaaagactctgagattaccttcatta(SEQ ID NO:48)
target sequence VII-9:
gctgagctggtaaaaggaa(SEQ ID NO:49)
target sequence VII-10:
tcagtttcaggtacatcta(SEQ ID NO:50)
target sequence VII-11:
gatgaatttgccgaagatatctttttaa(SEQ ID NO:51)
1.2 description of the synthesis method:
the nucleoside monomers are linked one by one in the 3'-5' direction according to the nucleotide arrangement sequence by a solid-phase phosphoramidite method. Each nucleoside monomer attached includes four steps of deprotection, coupling, capping, oxidation or vulcanization. Wherein, when two nucleotides are connected by phosphate, the connection of the latter nucleoside monomer comprises deprotection, coupling, capping and oxidation. When phosphorothioate is adopted to connect two nucleotides, the following nucleoside monomer is connected, and the four steps of protection, coupling, capping and vulcanization are included.
1.3 synthetic conditions were given as follows:
the nucleoside monomer is provided in an acetonitrile solution with the concentration of 0.1M, the deprotection reaction conditions of each step are the same, namely the temperature is 25 ℃, the reaction time is 70 seconds, the deprotection reagent is dichloromethane solution (3%V/V) of dichloroacetic acid, and the molar ratio of the dichloroacetic acid to the 4,4' -dimethoxytrityl protecting group on the solid carrier is 5:1.
The coupling reaction conditions of each step are the same, the temperature is 25 ℃, the mole ratio of the nucleic acid sequence connected on the solid carrier to the nucleoside monomer is 1:10, the mole ratio of the nucleic acid sequence connected on the solid carrier to the coupling reagent is 1:65, the reaction time is 600 seconds, and the coupling reagent is a 0.5M acetonitrile solution of 5-ethylthio-1H-tetrazole.
The capping conditions were the same for each step, including a temperature of 25℃and a reaction time of 15 seconds. The capping reagent solution is a mixed solution of CapA and CapB with a molar ratio of 1:1, and the molar ratio of the capping reagent to the nucleic acid sequence connected to the solid phase carrier is acetic anhydride, N-methylimidazole and the nucleic acid sequence connected to the solid phase carrier=1:1:1.
The oxidation reaction conditions are the same in each step, the temperature is 25 ℃, the reaction time is 15 seconds, and the oxidizing agent is iodine water with the concentration of 0.05M. The molar ratio of iodine to nucleic acid sequence attached to the solid support in the coupling step was 30:1. The reaction was carried out in a mixed solvent of tetrahydrofuran, water, pyridine=3:1:1.
The conditions for each step of sulfiding reaction were the same, including a temperature of 25 ℃, a reaction time of 300 seconds, and the sulfiding reagent was hydrogenation Huang Yuansu. The molar ratio of sulfiding reagent to nucleic acid sequence attached to the solid support in the coupling step was 120:1. The reaction was carried out in a mixed solvent of acetonitrile: pyridine=1:1.
After the last nucleoside monomer is connected, sequentially cutting, deprotecting, purifying and desalting the nucleic acid sequence connected on the solid phase carrier, and then freeze-drying to obtain a sense strand and an antisense strand; and finally, carrying out heating annealing on the two chains to obtain a product, and freeze-drying to obtain freeze-dried powder.
Example 2: synthesis of siRNA conjugates (GalNAc-siRNA)
2.1siRNA conjugates have the structure shown in formula II below:
2.2 Synthesis procedure of siRNA conjugates
In the first step, DMTR-L96 is reacted with succinic anhydride to give compound L96-A:
the preparation process comprises the following steps: DMTR-L96, succinic anhydride, 4-dimethylaminopyridine and diisopropylethylamine are added into dichloromethane, stirred and reacted for 24 hours at 25 ℃, then the reaction liquid is washed by 0.5M triethylamine phosphate, the water phase is washed three times by dichloromethane, and the organic phases are combined and evaporated to dryness under reduced pressure to obtain a crude product. Then purifying by column chromatography to obtain the pure L96-A.
Second, L96-A is reacted with NH 2 SPS reaction gives L96-B:
the preparation process comprises the following steps: L96-A, O-benzotriazol-tetramethyluronium Hexafluorophosphate (HBTU) and diisopropylethylamine were mixed and dissolved in acetonitrile, stirred at room temperature for 5 minutes to give a homogeneous solution, and aminomethyl resin (NH) was added 2 -SPS，100-200 meshes) into the reaction liquid, starting the shaking reaction at 25 ℃, filtering after the reaction is carried out for 18 hours, and washing a filter cake by dichloromethane and acetonitrile in sequence to obtain the filter cake. Capping the filter cake with CapA/CapB mixed solution to obtain L96-B, namely a solid phase carrier containing conjugate molecules, connecting nucleoside monomers to the conjugate molecules under the coupling reaction, synthesizing siRNA sense strand connected to the conjugate molecules according to the siRNA molecule synthesis method, synthesizing siRNA antisense strand by adopting the siRNA molecule synthesis method, and annealing to generate the siRNA conjugate.
Example 3: siRNA and siRNA modifier for inhibiting C5 gene expression
3.1 experimental materials:
HepG2 cells, purchased from ATCC under the accession number HB-8065;
DMEM medium, available from Macgene under the accession number CM15019.
3.2 experimental method:
step 1, the concentration is 16 multiplied by 10 4 500. Mu.l of HepG2 cells/ml were inoculated into 24-well plates containing DMEM medium and cultured for 24 hours.
Step 2, centrifuging the dry powder of the siRNA and the siRNA modification (for convenience of description, the dry powder is collectively called as siRNA in the experimental process description of the embodiment) to be tested at a low temperature and a high speed, and using RNase-free ddH 2 O was dissolved to prepare 100. Mu.M siRNA stock solution.
Step 3, preparing 25nM siRNA transfection diluent
1) 10 mu M siRNA transfection diluent is prepared: mu.M of the siRNA stock solution prepared in the step 2 was taken and 10. Mu.l of RNase-free ddH was added thereto in an amount of 90. Mu.l 2 O, obtaining siRNA stock solution with concentration of 10 mu M;
2) Placing 25 μl of opti-MEM into 2 sterile centrifuge tubes, adding 1 μl of 1 μpost-fectamine 2000 and 1.25 μl of the siRNA stock solution prepared in step 1, and incubating at room temperature for 5min; the 2 solutions were then mixed and incubated for 10min.
Step 4. Transfected HepG2 cells were washed 2 times with PBS buffer in 24 well plates and 450. Mu.l of PS-free DMEM medium (penicillin streptomycin mix) was added. Mu.l of the mixture prepared in step 3 was added to a 24-well plate containing HepG2 cells, and transfected at a final siRNA concentration of 25 nM.
Each siRNA sample was set up with 3 replicates and incubated for 48 hours post-transfection.
Step 5 RNA extraction
1) The old medium in each well was aspirated, washed twice with 500 μl PBS buffer, aspirated, and washed twice repeatedly; add 500. Mu.l of total RNA extraction reagent from Biozol to each well; cracking for 10min at room temperature.
2) Adding chloroform (chloroform) with the volume of 0.2 times, and shaking vigorously for 15s; centrifuge at 12000g for 10min at 4 ℃.
3) Transferring the water phase to a new centrifuge tube, adding 1 time of volume of isopropanol, and vortex oscillating for 15s; the mixture was centrifuged at 12000g for 15min at 4℃to precipitate a precipitate.
4) The supernatant was discarded, 500. Mu.l of 75% ethanol was added, and the pellet was washed with tumbling shaking. Centrifuging 7500g for 5min, and discarding supernatant; the washing was repeated 3 times.
5) The sample was placed in a spin dryer and taken out after 10min. Mu.l of RNase-free ddH was added 2 O, oscillating to dissolve and centrifuging.
6) The RNA concentration of each sample was detected and recorded.
Step 6 reverse transcription
1) Reverse transcription reaction mixtures were prepared and thoroughly mixed as described in the following table, and the procedure was performed on ice.
TABLE 6
2) First strand cDNA synthesis reaction solution
TABLE 7
The mixture obtained in 1) above 10μl
10×RT Mix 2μl
HiScript III Enzyme Mix 2μl
Oligo(dT) 20 VN 1μl
Random hexamers 1μl
RNase-free ddH 2 O 4μl
3) First Strand cDNA Synthesis reaction
TABLE 8
37℃ 15min
85℃ 5s
4) Mu.l of RNase-free ddH was added 2 The reverse transcription product was diluted and stored at-20℃for RT-qPCR analysis.
Step 7.RT-qPCR
1) qPCR reaction mixtures were prepared as shown in the following table. During the whole procedure, all reagents were placed on ice.
TABLE 9
Table 10
2) qPCR procedure was performed as follows
TABLE 11
3) Analysis of results
(1) Using Quant Studio 6 software to automatically calculate Ct value by default; (2) calculating the relative expression amount of the gene using the following formula:
ΔCt＝Ct(C5)–Ct(GAPDH)
ΔΔΔCt =Δct (detection of sample) group) -delta Ct (Mock group)
mRNA expression = 2 relative to Mock group -ΔΔCt 。
Wherein, mock group represents: the group to which no siRNA was added was compared with the test sample group.
3.3 silencing Experimental results the test was performed at a concentration of 25nM
3.3.1 design sequence results
Table 12
/>
3.3.2 modification of sequence IC 50 Measurement
The measured concentration ranges for the siRNA to be tested in table 13 are set (nM) as: 0.005, 0.01, 0.05, 0.1, 0.2, 0.5, 1, 5, 25, 50, 100, and then IC is carried out in a similar manner to 3.2 50 And (5) measuring.
Analysis of results:
a) Using Quant Studio 7 software to automatically calculate Ct value by default;
b) The relative expression amount of the gene was calculated using the following formula:
delta ct=ct (C5 gene) -Ct (GAPDH)
ΔΔct=Δct (detection of sample) group) -deltact (Mock group), wherein Mock groups represent groups to which no siRNA was added compared to the test sample groups;
mRNA expression = 2 relative to Mock group -ΔΔCt
Inhibition ratio (%) = (relative mRNA expression amount of Mock group-relative mRNA expression amount of test sample group)/relative mRNA expression amount of Mock group x 100%;
the log value of siRNA concentration is taken as the X axis, the percent inhibition rate is taken as the Y axis, and the "log (inhibitor) vs. response-variable slope" functional module of analysis software GraphPad Prism 8 is adopted to fit the quantitative effect curve, so that the IC50 value of each siRNA is obtained.
The fitting formula is: y=bottom+ (Top-Bottom)/(1+10++LogIC 50-X. Times HillSlope)
Wherein: top represents percent inhibition at the Top plateau, the Top criterion of the curve is typically between 80% and 120%; bottom represents the percent inhibition at the Bottom plateau, with Bottom of the curve typically between-20% and 20%; hillSlope represents the slope of the percent inhibition curve.
TABLE 13
siRNA ID IC 50 (nM)
N-ER-FY008029M1 0.34
N-ER-FY008029-002M1 0.38
N-ER-FY008036M1 0.26
N-ER-FY008036-001M1 0.18
N-ER-FY008036-002M1 0.25
N-ER-FY008043M1 0.18
N-ER-FY008050M1 0.53
N-ER-FY008050-003M1 0.64
Example 4: delivery system verification
4.1 experimental materials:
human primary hepatocytes PHH cells, supplied by the medicine Mingkang;
PHH medium: invitroGRO CP Meduim serum free BIOVIT, cargo number: s03316
RNAiMAX transfection reagent, available from Invitrogen, cat: 13778-150;
RNA extraction kit96Kit (12), cat No.: QIAGEN-74182;
reverse transcription Kit FastKing RT Kit (With gDNase), cat: tiangen-KR 116-02;
FastStart Universal Probe Master (Roche-04914058001); the C5 and GAPDH primers are provided by Ming Kangde.
4.2 experimental method:
siRNA conjugates (final siRNA conjugate concentrations of 10nM, 2.5nM, 0.63nM, 0.16nM, 0.04nM, 0.01nM, 0.0024nM and 0.0006nM, compound wells) were transfected into PHH cells as follows: taking cryopreserved PHH cells, resuscitating, counting, and adjusting cell to 6×10 5 Cells/ml, while the siRNA conjugate was transferred to cells using Lipofectamine RNAiMax, was seeded into 96-well plates at a density of 54,000 cells per well, with 100 μl of PPH medium added per well. Cells were exposed to 5% CO 2 Culturing in incubator at 37 ℃. After 48 hours, the medium was removed and the cells were collected for RNA extraction. According to the instruction useTotal RNA was extracted at 96 Kit.
The siRNA conjugates (siRNA conjugates at final concentrations of 500nM, 125nM, 31.25nM, 7.81nM, 1.95nM, 0.49nM, 0.12nM and 0.03nM, and multiple wells) entered PHH cells by free uptake as follows: taking cryopreserved PHH cells, resuscitating, counting, and adjusting cell to 6×10 5 Cells/ml, siRNA conjugate was added and seeded into 96-well plates at a density of 54,000 cells per well, 100 μl per well of culture broth. Cells were exposed to 5% CO 2 Culturing in incubator at 37 ℃. After 48 hours, the medium was removed and the cells were collected for RNA extraction. According to the instruction useTotal RNA was extracted at 96 Kit.
Referring to a similar method to example 3, the extracted total RNA was reverse transcribed into cDNA by a reverse transcription reaction. The C5cDNA will be detected by qPCR. GAPDH cDNA will be tested in parallel as an internal control. The PCR reaction procedure was: 10 minutes at 95℃and then enter a cyclic mode, 95℃for 15 seconds followed by 60℃for 60 seconds for a total of 40 cycles.
4.3 analysis of results
a) Using Quant Studio 6pro software to automatically calculate Ct value with default settings;
b) The relative expression amount of the gene was calculated using the following formula:
delta ct=ct (gene of interest) -Ct (GAPDH)
ΔΔΔCt =Δct (detection of sample) group) -delta Ct (Mock group)
mRNA expression = 2 relative to Mock group -ΔΔCt Wherein Mock groups represent groups to which no siRNA conjugate was added compared to the test sample groups.
Inhibition ratio (%) = (relative mRNA expression amount of Mock group-relative mRNA expression amount of test sample group)/relative mRNA expression amount of Mock group x 100%;
the IC50 values of the individual siRNA conjugates were obtained by fitting the dose-response curves using the log of the siRNA conjugate concentration as X-axis and the percent inhibition as Y-axis, using the "log (inhibitor) vs. response-variable slope" function of analytical software GraphPad Prism 8.
The fitting formula is: y=bottom+ (Top-Bottom)/(1+10++LogIC 50-X. Times HillSlope)
Wherein: top represents percent inhibition at the Top plateau, the Top criterion of the curve is typically between 80% and 120%; bottom represents the percent inhibition at the Bottom plateau, with Bottom of the curve typically between-20% and 20%; hillSlope represents the slope of the percent inhibition curve.
TABLE 14
L96 in Table 14 is the conjugate group GalNAc shown in formula I.
Example 5: synthesis of siRNA
5.1siRNA sequence design
The siRNA sequence design concept and method in this example are the same as those in example 1, and the target sequence for designing siRNA is shown below, the target sequence being derived from the gene mRNA sequence of C5 (see nm_ 001735.3).
Target sequence VIII:
gagcatctgaaaatattgtgatt(SEQ ID NO:595)
target sequence IX:
tccaaaactctgcaatcttaacaatacaaccaaaacaattgcctggaggacaaaacccagtttcttatgtgtatttggaagttgtatc aaagcatttttcaaaatcaaaaagaatgccaataacctatgacaatg(SEQ ID NO:596)
target sequence IX-1:
tccaaaactctgcaatcttaacaatacaa(SEQ ID NO:615)
target sequence IX-2:
aagaatgccaataacctatgacaatg(SEQ ID NO:616)
target sequence X:
gacgacttgaagccagccaaaagagaaactgtcttaactttcatagatcctgaaggatcagaagttgacatggtagaagaaattg atcatattggaattatctcttttcctgacttcaagattccgtctaatcctagatatggtatgtggacgatcaaggctaaatataaagaggactttt caacaactggaaccgcatattttgaagttaaagaatatgtcttgccacatttttctgtctcaatcgagccagaatat(SEQ ID NO:597)
target sequence X-1:
gacgacttgaagccagccaaaagagaaactgtcttaactttcata(SEQ ID NO:617)
target sequence X-2:
gatcagaagttgacatggt(SEQ ID NO:618)
target sequence X-3:
tcctgacttcaagattccgtctaatcctagatatg(SEQ ID NO:619)
target sequence X-4:
ttcaacaactggaaccgcatattttgaa(SEQ ID NO:620)
target sequence X-5:
ttctgtctcaatcgagccagaatat(SEQ ID NO:621)
target sequence XI:
gaggctgacgtttatatcacatttggaataagagaagacttaaaagatgatcaaaaagaaatgatgcaaacagcaatgcaaaaca caatgttgataaatggaattgctcaagtcacatttgattctgaaacagcagtcaaagaactgtcatactaca(SEQ ID NO:598)
target sequence XI-1:
gaggctgacgtttatatcacatttggaataa(SEQ ID NO:622)
target sequence XI-2:
agaagacttaaaagatgatcaaaaa(SEQ ID NO:623)
target sequence XI-3:
atgcaaacagcaatgcaaaacacaat(SEQ ID NO:624)
target sequence XI-4:
acagcagtcaaagaactgtcatactaca(SEQ ID NO:625)
target sequence XII:
atatcccatcaaggtgcaggttaaagattcgcttgaccagttggtaggaggagtcccagtaacactgaatgcacaaacaattgat gtaaaccaagagacatctgacttggatccaagcaaaagtgtaacacgtgttgat(SEQ ID NO:599)
target sequence XII-1:
atatcccatcaaggtgcaggttaaa(SEQ ID NO:626)
target sequence XII-2:
aggaggagtcccagtaacactgaatgcacaaacaattgatgtaa(SEQ ID NO:627)
target sequence XII-3:
agagacatctgacttggat(SEQ ID NO:628)
target sequence XII-4:
aagcaaaagtgtaacacgtgttgat(SEQ ID NO:629)
target sequence XIII:
tacctttatattgattggactgataaccataaggctttgctagt(SEQ ID NO:600)
target sequence XIV:
atccactttggcacgagggagaaattttca(SEQ ID NO:601)
target sequence XV:
catcccgacttctggtctattaca(SEQ ID NO:602)
target sequence XVI:
ccaaactgtgtctcttaat(SEQ ID NO:603)
target sequence XVII:
gatggagcctgcgttaataatgatgaaacctgtgagcagcgagctgcacggattagtttagggccaagatgcatcaaagctttcactgaatgttgtgtcgtcgcaagccagctccgtgctaatatctctcataaagacatgcaattgggaaggctacacatgaagaccctgttaccagtaagcaagccagaaattcggagttattttccagaaagctggttgtgggaagttcatcttgttcccagaagaaaacagttgcagtttgccctacctgattctctaaccacctgggaaattcaaggcgttggcatttcaaacactggtatatgtgttgctgatactgtcaaggcaaa(SEQ ID NO:604)
target sequence XVII-1:
gatggagcctgcgttaataatgatgaa(SEQ ID NO:630)
target sequence XVII-2:
gagctgcacggattagtttagggccaagatgcatcaaagctttca(SEQ ID NO:631)
target sequence XVII-3:
gccagctccgtgctaatat(SEQ ID NO:632)
target sequence XVII-4:
ggaaggctacacatgaagaccctgttacc(SEQ ID NO:633)
target sequence XVII-5:
gctggttgtgggaagttcatcttgttcc(SEQ ID NO:634)
target sequence XVII-6:
ggcgttggcatttcaaaca(SEQ ID NO:635)
target sequence XVII-7:
ctgatactgtcaaggcaaa(SEQ ID NO:636)
target sequence XVIII:
ggatgcagttctgtgttaaaatgt(SEQ ID NO:605)
target sequence XIX:
ggagacttggtttggaaaagaaatcttagtaaaaacattacgagtggtgccagaaggtgtcaaaagggaaagctattctggtgtta ctttggatcctaggggtatttatggtaccattagcagacgaaaggagttcccatacaggatacccttagattt(SEQ ID NO:606)
target sequence XIX-1:
ggagacttggtttggaaaa(SEQ ID NO:637)
Target sequence XIX-2:
cctaggggtatttatggtaccattagcagacgaaagga(SEQ ID NO:638)
target sequence XIX-3:
acaggatacccttagattt(SEQ ID NO:639)
target sequence XX:
ttcattctgacccattaattgaaaagcagaaactgaagaaaaaattaaaagaagggatgttgagcattatgtcctacagaaatgctg actactcttacagtgtgtggaagggtggaagtgctagcacttggttaac(SEQ ID NO:607)
target sequence XX-1:
ttcattctgacccattaattgaaaagcagaaac(SEQ ID NO:640)
target sequence XX-2:
gaagggatgttgagcatta(SEQ ID NO:641)
target sequence XX-3:
cagaaatgctgactactcttacagtgt(SEQ ID NO:642)
target sequence XX-4:
agggtggaagtgctagcacttggttaac(SEQ ID NO:643)
target sequence XXI:
gggtaccttgcctgttgaagcccgagagaacagcttatatcttacagcctttactgtgattggaattagaaaggctttcgatatatgc cccctggtgaaaatcgacacagctctaattaaagctgacaa(SEQ ID NO:608)
target sequence XXI-1:
gggtaccttgcctgttgaagcccgagagaa(SEQ ID NO:644)
target sequence XXI-2:
cagcctttactgtgattggaattag(SEQ ID NO:645)
target sequence XXI-3:
cctggtgaaaatcgacaca(SEQ ID NO:646)
target sequence XXI-4:
ctctaattaaagctgacaa(SEQ ID NO:647)
target sequence XXII:
ctcacccacagtttcgttcaattgtttca(SEQ ID NO:609)
target sequence XXIII:
ctggtacggcacgtatggtagaaacaactgcctatgctttactcaccagtctgaacttgaaagat(SEQ ID NO:610)
target sequence XXIII-1:
ctggtacggcacgtatggtagaaac(SEQ ID NO:648)
target sequence XXIII-2:
cagtctgaacttgaaagat(SEQ ID NO:649)
target sequence XXIV:
caacccaggacacaatcaatgccattgagggcctgacggaatattcactcctggttaaacaactccgcttgagtatggacatcga tgtttcttacaagcataaaggtgccttacataattataaaatgacagacaagaatttccttgggaggccagtagaggtgcttctcaatgatga cctcattgtcagta(SEQ ID NO:611)
target sequence XXIV-1:
caacccaggacacaatcaa(SEQ ID NO:650)
target sequence XXIV-2:
cactcctggttaaacaact(SEQ ID NO:651)
target sequence XXIV-3:
gacatcgatgtttcttaca(SEQ ID NO:652)
target sequence XXIV-4:
gcataaaggtgccttacat(SEQ ID NO:653)
target sequence XXIV-5:
gatgacctcattgtcagta(SEQ ID NO:654)
target sequence XXV:
agcagggaagaatcatcatctggatcctctcatgcggtgatggacatctccttgcctactggaatcagtgcaaatgaagaagactt aaaagcccttgtggaaggggtggatcaactattcact(SEQ ID NO:612)
target sequence XXV-1:
agcagggaagaatcatcat(SEQ ID NO:655)
target sequence XXV-2:
ctggaatcagtgcaaatga(SEQ ID NO:656)
target sequence XXV-3:
ggtggatcaactattcact(SEQ ID NO:657)
target sequence XXVI:
caggaagaattggatctgacaatctctgcagagaca(SEQ ID NO:613)
target sequence XXVII:
ctggcctagagacacaacatgttca(SEQ ID NO:614)
5.2, the synthesis method comprises the following steps:
the synthesis method was the same as that in "1.2" in example 1.
5.3 Synthesis conditions:
the synthesis conditions were the same as those in "1.3" in example 1.
Example 6: siRNA and siRNA modifier for inhibiting C5 gene expression
6.1 experimental materials:
6.2 experimental method:
step 1. Taking the concentration of 11.1X10 4 Mu.l of/ml HepG2 cells were inoculated into DMEM mediumIn 96-well plates, incubation was performed for 24 hours.
Step 2, centrifuging the dry powder of the siRNA and the siRNA modification (for convenience of description, the dry powder is collectively called as siRNA in the experimental process description of the embodiment) to be tested at a low temperature and a high speed, and using RNase-free ddH 2 O was dissolved to prepare 100. Mu.M siRNA stock solution.
Step 3, preparing 20nM siRNA diluent Z and 2nM siRNA diluent W
(1) Preparation of 0.1. Mu.M siRNA stock E and 0.01. Mu.M siRNA stock F:
a) Taking 2 mu l of 100 mu M siRNA mother liquor prepared in the step 2, and adding 18 mu l of ultra-pure distilled water to obtain siRNA stock solution Q with the final concentration of 10 mu M;
b) Taking 2 mu l of the 10 mu M siRNA stock solution Q prepared in the step a), and adding 18 mu l of ultra-pure distilled water to obtain an siRNA stock solution Y with the final concentration of 1 mu M;
c) Taking 2 mu l of 1 mu M siRNA stock solution Y prepared in the step b), and adding 18 mu l of ultra-pure distilled water to obtain siRNA stock solution E with the final concentration of 0.1 mu M;
d) Taking 2 μl of 0.1 μM siRNA stock solution E prepared in step c), adding 18 μl of ultrapure distilled water to obtain 0.01 μM siRNA stock solution F;
(2) 2. Mu.l of each of the above-prepared siRNA stock solution E and siRNA stock solution F was added to 8. Mu.l of Opti-MEM to obtain 20nM siRNA dilution Z and 2nM siRNA dilution W, respectively.
Step 4. Transfection of HepG2 cells
(1) Taking 3 μl of Lipofectamine 2000, adding 97 μl of Opti-MEM to obtain Lipofectamine 2000 dilution; lipofectamine 2000 dilutions were mixed with 2nM siRNA dilutions W prepared in step 3 at a 1:1 volume ratio, allowed to stand for 5 minutes, and 10. Mu.l of the transfection mixture was added to 96-well plates to transfect HepG2 cells cultured in step 1 (final volume 100. Mu.l, siRNA concentration in the system was 0.1 nM).
(2) Taking 3 μl of Lipofectamine 2000, adding 97 μl of Opti-MEM to obtain Lipofectamine 2000 dilution; lipofectamine 2000 dilutions were mixed with 20nM siRNA dilutions Z prepared in step 3 at a 1:1 volume ratio to prepare a transfection mixture, which was allowed to stand for 5 minutes, and 10. Mu.l of the transfection mixture was added to a 96-well plate to transfect HepG2 cells cultured in step 1 (final volume 100. Mu.l, siRNA concentration in the system 1 nM).
Step 5. 2 replicates were set for each concentration (1 nM and 0.1 nM), and incubated for 48 hours post-transfection.
Step 6 RNA extraction
7) The old medium in each well was aspirated, 500 μl of PBS buffer was added, the PBS buffer was aspirated, and washing was repeated twice; add 500. Mu.l of Biozol total RNA extraction reagent per well; cracking for 10min at room temperature.
8) Adding chloroform (chloroform) with the volume of 0.2 times, and shaking vigorously for 15s; centrifuge at 12000g for 10min at 4 ℃.
9) Transferring the water phase to a new centrifuge tube, adding 1 time of volume of isopropanol, and vortex oscillating for 15s; the mixture was centrifuged at 12000g for 15min at 4℃to precipitate a precipitate.
10 Removing supernatant, adding 500 μl of 75% ethanol, shaking with inversion, and washing the precipitate. Centrifuging 7500g for 5min, and discarding supernatant; the washing was repeated 3 times.
11 Placing the sample in a spin dryer for 10min, and taking out. Mu.l of RNase-free ddH was added 2 O, oscillating to dissolve and centrifuging.
12 The RNA concentration of each sample was detected and recorded.
Step 7 reverse transcription
1) Reverse transcription reaction mixtures were prepared and thoroughly mixed as described in the following table, and the procedure was performed on ice.
TABLE 15
2) First strand cDNA synthesis reaction solution
Table 16
The mixture obtained in 1) above 10μl
10×RT Mix 2μl
HiScript III Enzyme Mix 2μl
Oligo(dT) 20 VN 1μl
Random hexamers 1μl
RNase-free ddH 2 O 4μl
3) First Strand cDNA Synthesis reaction
TABLE 17
37℃ 15min
85℃ 5s
4) Mu.l of RNase-free ddH was added 2 The reverse transcription product was diluted and stored at-20℃for RT-qPCR analysis.
Step 8.RT-qPCR
1) qPCR reaction mixtures were prepared as shown in the following table. During the whole procedure, all reagents were placed on ice.
TABLE 18
TABLE 19
2) qPCR procedure was performed as follows
Table 20
3) Analysis of results
(1) Using Quant Studio 6 software to automatically calculate Ct value by default;
(2) The relative expression amount of the gene was calculated using the following formula:
ΔCt＝Ct(C5)–Ct(GAPDH)
ΔΔΔCt =Δct (detection of sample) group) -delta Ct (Mock group)
mRNA expression = 2 relative to Mock group -ΔΔCt 。
Wherein, mock group represents: the group to which no siRNA was added was compared with the test sample group.
Inhibition ratio (%) = (relative mRNA expression amount of Mock group-relative mRNA expression amount of test sample group)/relative mRNA expression amount of Mock group x 100%;
6.3 silencing Experimental results
Concentrations of 1nM and 0.1nM were chosen for testing.
6.3.1 design sequence results
Table 21
/>
/>
/>
/>
/>
/>
6.3.2 modification of sequence IC 50 Measurement
The measured concentration ranges for the siRNA to be tested in table 22 are set (nM) as: 10nM, 4-fold dilution, 8 concentration gradients: 10nM, 2.5nM, 0.63nM, 0.16nM, 0.04nM, 0.01nM, 0.0024nM and 0.0006nM, and IC was performed in a similar manner to 6.2 50 And (5) measuring.
Analysis of results:
a) Using Quant Studio 6pro software to automatically calculate Ct value with default settings;
b) The relative expression amount of the gene was calculated using the following formula:
delta ct=ct (C5 gene) -Ct (GAPDH)
ΔΔct=Δct (detection of sample) group) -deltact (Mock group), wherein Mock groups represent groups to which no siRNA was added compared to the test sample groups;
mRNA expression = 2 relative to Mock group -ΔΔCt
Inhibition ratio (%) = (relative mRNA expression amount of Mock group-relative mRNA expression amount of test sample group)/relative mRNA expression amount of Mock group x 100%;
the log value of siRNA concentration is taken as the X axis, the percent inhibition rate is taken as the Y axis, and the "log (inhibitor) vs. response-variable slope" functional module of analysis software GraphPad Prism 8 is adopted to fit the quantitative effect curve, so that the IC50 value of each siRNA is obtained.
The fitting formula is: y=bottom+ (Top-Bottom)/(1+10++LogIC 50-X. Times HillSlope)
Wherein: top represents percent inhibition at the Top plateau, the Top criterion of the curve is typically between 80% and 120%; bottom represents the percent inhibition at the Bottom plateau, with Bottom of the curve typically between-20% and 20%; hillSlope represents the slope of the percent inhibition curve.
Table 22
siRNA ID IC 50 (nM)
N-ER-FY008081M2 0.1676
N-ER-FY008081M3 0.3172
N-ER-FY008082M2 0.1662
N-ER-FY008082M3 0.2295
N-ER-FY008085M2 0.0408
N-ER-FY008085M3 0.0512
N-ER-FY008091M2 0.4142
N-ER-FY008092M2 0.3253
N-ER-FY008093M2 0.0416
N-ER-FY008093M3 0.0234
N-ER-FY008102M2 0.0109
N-ER-FY008103M2 0.0105
N-ER-FY008106M2 0.0060
N-ER-FY008106M3 0.0121
N-ER-FY008121M2 0.2468
Example 7: delivery system verification
7.1 experimental materials:
human primary hepatocytes PHH cells, supplied by the medicine Mingkang;
PHH medium: invitroGRO CP Meduim serum free BIOVIT, cargo number: s03316
RNAiMAX transfection reagent, available from Invitrogen, cat: 13778-150;
RNA extraction kit96Kit (12), cat No.: QIAGEN-74182;
reverse transcription Kit FastKing RT Kit (With gDNase), cat: tiangen-KR 116-02;
FastStart Universal Probe Master (Roche-04914058001); the C5 and GAPDH primers are provided by Ming Kangde.
7.2 experimental method:
siRNA conjugates (final siRNA conjugate concentrations of 5nM and 0.5nM, two replicates per concentration) were introduced into PHH cells by transfection as follows: taking cryopreserved PHH cells, resuscitating, counting, and adjusting cell to 6×10 5 Cells/ml, while siRNA was transferred to cells using Lipofectamine RNAiMax, was seeded into 96-well plates at a density of 54,000 cells per well, and 100 μl of PPH medium was added per well. Cells were exposed to 5% CO 2 Culturing in incubator at 37 ℃. After 48 hours, the medium was removed and the cells were collected for RNA extraction. According to the instruction useTotal RNA was extracted at 96 Kit.
siRNA conjugates (final siRNA conjugate concentrations of 100nM and 10nM, two replicates per concentration) were entered into PHH cells by free uptake, as follows: taking cryopreserved PHH cells, resuscitating, counting, and adjusting cell to 6×10 5 Cells/ml, siRNA conjugate was added and seeded into 96-well plates at a density of 54,000 cells per well, 100 μl per well of culture broth. Cells were exposed to 5% CO 2 Culturing in incubator at 37 ℃. After 48 hours, the medium was removed and the cells were collected for RNA extraction. According to the instruction useTotal RNA was extracted at 96 Kit.
Referring to a similar method to example 6, the extracted total RNA was reverse transcribed into cDNA by a reverse transcription reaction. The C5cDNA will be detected by qPCR. GAPDH cDNA will be tested in parallel as an internal control. The PCR reaction procedure was: 10 minutes at 95℃and then enter a cyclic mode, 95℃for 15 seconds followed by 60℃for 60 seconds for a total of 40 cycles.
7.3 analysis of results
a) Using Quant Studio 7 software to automatically calculate Ct value by default;
b) The relative expression amount of the gene was calculated using the following formula:
Delta ct=ct (gene of interest) -Ct (GAPDH)
ΔΔΔCt =Δct (detection of sample) group) -delta Ct (Mock group)
mRNA expression = 2 relative to Mock group -ΔΔCt Wherein Mock groups represent groups to which no siRNA conjugate was added compared to the test sample groups.
Inhibition ratio (%) = (relative mRNA expression amount of Mock group-relative mRNA expression amount of test sample group)/relative mRNA expression amount of Mock group×100%.
Table 23
/>
/>
/>
Wherein L96 is the conjugate group GalNAc shown in formula I, [ GNA ] represents that one ribonucleotide adjacent to the right side of the conjugate group is the ribonucleotide with GNA modification.
Example 8: siRNA conjugates in humansInhibition of human C5 Gene expression in humanized mice
C57BL/6-hC5 mice (supplied by Shanghai Nannon model biotechnology Co., ltd.) of 6-8 weeks old entered the feeding facility, and after 7 days of adaptive feeding, N-ER-FY008029-002M2L96, N-ER-FY008029-002M3L96, N-ER-FY008036M2L96, N-ER-FY008036M3L96, N-ER-FY008036M7L96, N-ER-FY008081M3L96 and N-ER-FY008085M3L96 (6 mice per group) were subcutaneously administered to the mice in a single dose of 3mg/kg, respectively. Serum hC5 protein expression levels were measured at 7, 14, 21, 28 and 35 days after administration, thereby obtaining the inhibition rate of hC5 protein expression by the siRNA conjugate.
TABLE 24 inhibition of hC5 protein by siRNA conjugates
As can be seen from table 24, the siRNA conjugates of the present disclosure have higher inhibitory activity on the protein expressed by the hC5 gene in vivo, can reduce the hC5 protein level for a long time, can achieve an inhibition rate of 78% or more in the inhibition rate results up to 35 days during the experiment, and can achieve an inhibition rate of 78% or more in the inhibition rate results from 7 days to 28 days, indicating that the designed compounds can better inhibit the generation of hC5 protein.
EXAMPLE 9 plasma kinetics study of siRNA conjugates in CD-1 mice
Test animals: CD-1 mice, SPF grade, male, about 30g, purchased from Si Bei Fu (Beijing) Biotechnology Co., ltd.
Dosage and mode of administration: the siRNA conjugates were administered at a dose of 3mg/kg (10 mL/kg), with a single subcutaneous injection following randomization, with 6 mice per group.
Sample collection: samples of whole blood were collected at 10 points at 0.0833, 0.25, 0.5, 1, 2, 4, 8, 24, 36, 48h post-administration. The front 3 of each group is collected for 0.0833, 0.5, 2, 8 and 36 hours, and the rear 3 is collected for 0.25, 1, 4, 24 and 48 hours, and the whole blood is collected and then the blood plasma is centrifugally separated for detection and analysis.
Sample detection and analysis: the concentration of the original drug in plasma samples at each time point was measured by LC-MS/MS method and PK parameters were calculated using WinNonlin software: c (C) max 、T max 、AUC、MRT、t 1/2 。
From this experiment, it can be concluded that the siRNA conjugates of the present disclosure have a shorter half-life in plasma and are cleared faster.
EXAMPLE 10 tissue distribution assay of siRNA conjugates in CD-1 mice
Test animals: CD-1 mice, SPF grade, male, about 30g, purchased from Si Bei Fu (Beijing) Biotechnology Co., ltd.
Dosage and mode of administration: the siRNA conjugates were administered at a dose of 3mg/kg (10 mL/kg), a single subcutaneous injection following randomization, 3 animals at each time point, and 24 mice total.
Sample collection:
24h after administration: collecting plasma, liver, kidney and spleen;
72h after administration: collecting plasma, liver, kidney and spleen;
168h (1 week) after administration: collecting plasma, liver, kidney, spleen, brain, heart, lung, stomach, small intestine, muscle, testis;
336h (2 weeks) post-dose: collecting plasma, liver, kidney and spleen;
672h (4 weeks) post-dose: collecting plasma, liver, kidney, spleen, brain, heart, lung, stomach, small intestine, muscle, testis; 1008h (6 weeks) after dosing: collecting plasma, liver, kidney and spleen;
1344h (8 weeks) after dosing: collecting plasma, liver, kidney and spleen;
1680h (10 weeks) post-dose: plasma, liver, kidney, spleen, brain, heart, lung, stomach, small intestine, muscle, testis were collected.
Sample detection and analysis: the concentration of the original drug in the plasma and tissue samples at each time point was detected by LC-MS/MS method, and AUC in the plasma and tissue was calculated by trapezoidal area method.
From the experiment, the siRNA conjugate disclosed by the invention is mainly enriched in the liver, has long retention time in tissues and has good stability.
EXAMPLE 11 Single subcutaneous injection of siRNA conjugate C57 mice administration MTD assay
Test animals: c57 mice, SPF grade, male, about 25g, purchased from si Bei Fu (beijing) biotechnology limited. Animals were randomized to body weight based on body weight at the last 1 day of the habituation period, and specific dose designs and groupings are shown in table 25 below:
table 25
/>
Detecting the index:
clinical observation: the administration day was continuously observed for 4 hours, and at least one clinical observation was performed daily during the recovery period.
Weight of: all surviving animals were weighed 2 times per week.
Immunotoxicity: MTD dose animals were alternately bled 1 h.+ -. 2min,4 h.+ -. 5min,8 h.+ -. 10min,24 h.+ -. 20min after D1 dosing, 3 animals per sex/group were harvested at each time point and tested for cytokines (IFN-. Gamma., TNF-. Alpha., IL-2/6/8).
Toxicological kinetics: MTD dose animals are alternately sampled before and 30min 2min,1h 2min,4h 5min,8h 10min and 24h 20min after D1 administration, and blood concentration is detected by collecting 3 animals/sex/animal group at each time point.
Chemistry of blood generation: the primary test animals were sectioned at D28, and the satellite animals were sectioned at batches D7, D14, D21, and D28 for blood biochemistry.
Tissue distribution: the animals of the main test group are subjected to D28 sectioning, the animals of the satellite group are subjected to D7, D14, D21 and D28 sectioning in batches, blood and liver are collected, and the tissue drug concentration is detected.
Histopathological examination: the animals of the main test group were examined by D28 dissection, and the main organs (heart, liver, spleen, lung, kidney, brain, adrenal gland, thymus, stomach, uterus/testis, ovary/epididymis) and the tissues or organs found abnormal were collected, fixed, and subjected to histopathological examination.
From this experiment, it can be seen that the siRNA conjugates of the present disclosure are less toxic, with an excellent window of drug safety.
The above examples of the present disclosure are merely examples for clearly illustrating the present disclosure and are not limiting of the embodiments of the present disclosure. Other variations or modifications of the above teachings will be apparent to those of ordinary skill in the art. It is not necessary here nor is it exhaustive of all embodiments. Any modifications, equivalent substitutions, improvements, etc. that fall within the spirit and principles of the present disclosure are intended to be included within the scope of the claims of the present disclosure.

Claims (45)

1. A double-stranded ribonucleic acid comprising a sense strand and an antisense strand, the sense strand being complementary to and/or substantially reverse complementary to the antisense strand to form a double-stranded region of the double-stranded ribonucleic acid;
wherein the sense strand comprises a sequence a that differs by no more than 3 nucleotides from at least 15 consecutive nucleotides in the target sequence, and the antisense strand comprises a sequence B that differs by no more than 3 nucleotides from the reverse complement of at least 15 consecutive nucleotides in the target sequence;
the target sequence is selected from nucleotide sequences shown in any one of SEQ ID NO 1-7 and SEQ ID NO 595-614.
2. The double-stranded ribonucleic acid according to claim 1, wherein said target sequence is selected from the group consisting of the nucleotide sequences as shown in any one of SEQ ID NOS.8-51, 615-657, said sense strand comprises a sequence A consisting of at least 15 consecutive nucleotides of the nucleotide sequences as shown in any one of SEQ ID NOS.8-51, 615-657, and said antisense strand comprises a sequence B which is reverse complementary and/or substantially reverse complementary to a sequence consisting of at least 15 consecutive nucleotides of the nucleotide sequences as shown in any one of SEQ ID NOS.8-51, 615-657.
3. The double stranded ribonucleic acid according to claim 1 or 2, wherein said sense strand consists of 15-28 nucleotides, preferably 19-25 nucleotides, more preferably 19-23 nucleotides, more preferably 19, 21 or 23 nucleotides.
4. A double stranded ribonucleic acid according to claim 3, wherein the nucleotide sequence of the sense strand is sequence a consisting of 15 to 28 consecutive nucleotides, preferably 19 to 25 consecutive nucleotides, more preferably 19 to 23 consecutive nucleotides, more preferably 19, 21 or 23 nucleotides of the nucleotide sequence indicated by any one of SEQ ID NOs 8 to 51, 615 to 657.
5. The double stranded ribonucleic acid of any one of claims 1 to 4, wherein the antisense strand consists of 15 to 28 nucleotides, preferably 19 to 25 nucleotides, more preferably 19 to 23 nucleotides, more preferably 19, 21 or 23 nucleotides.
6. The double-stranded ribonucleic acid according to claim 5, wherein the nucleotide sequence of the antisense strand is a sequence B which is reverse complementary and/or substantially reverse complementary to a sequence consisting of 15 to 28 consecutive nucleotides in the nucleotide sequence indicated by any one of SEQ ID NOs 8 to 51, 615 to 657, preferably 19 to 25 consecutive nucleotides, more preferably 19 to 23 consecutive nucleotides, more preferably 19, 21 or 23 nucleotides.
7. The double stranded ribonucleic acid of any one of claims 1 to 6, wherein the double stranded region is 15 to 25 nucleotides in length, preferably 19 to 23 nucleotides, more preferably 19 to 21 nucleotides, more preferably 19, 21 or 23 nucleotides.
8. The double-stranded ribonucleic acid according to any one of claims 1 to 7, wherein,
the sense strand is complementary to the antisense strand to form the double-stranded region, and the 3 'end of the sense strand has 1-2 protruding nucleotides extending out of the double-stranded region, the 3' end of the antisense strand forming a blunt end; or,
the sense strand is complementary to the antisense strand to form the double-stranded region, and the 3 'end of the antisense strand has 1-2 protruding nucleotides extending out of the double-stranded region, the 3' end of the sense strand forming a blunt end; or,
the sense strand and the antisense strand are complementary to form the double-stranded region, and the 3' -ends of the sense strand and the antisense strand each have 1-2 protruding nucleotides extending out of the double-stranded region; or,
the sense strand is complementary to the antisense strand to form the double-stranded region, and the sense strand and the 3' -end of the antisense strand each form a blunt end.
9. The double-stranded ribonucleic acid of any one of claims 1 to 8, wherein the sense strand and the antisense strand are selected from the group consisting of:
125 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 283 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 370;
1) The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 52 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 145;
2) The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 53 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 146;
3) The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 54 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 147;
4) The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 55 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 148;
5) The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 56 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 149;
6) The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 57 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 150;
7) The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 58 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 151;
8) The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 59, and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 152;
9) The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 60, and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 153;
10 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 61 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 154;
11 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 62 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 155;
12 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 63 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 156;
13 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 64 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 157;
14 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 65 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 158;
15 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 66 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 159;
16 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 67 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 160;
17 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 68 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 161;
18 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 69 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 162;
19 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 70 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 163;
20 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 71 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 164;
21 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 72 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 165;
22 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 73 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 166;
23 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 74 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 167;
24 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 75 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 168;
25 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 76 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 169;
26 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 77 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 170;
27 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 78 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 171;
28 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 79 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 172;
29 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 80 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 173;
30 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 81 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 174;
31 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 82 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 175;
32 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 83 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 176;
33 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 84 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 177;
34 The sense strand comprises the nucleotide sequence set forth in SEQ ID NO. 85 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO. 178;
35 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 86 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 179;
36 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 87, and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 180;
37 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 88 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 181;
38 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 89, and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 182;
39 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 90 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 183;
40 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 91 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 184;
41 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 92 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 185;
42 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 93 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 186;
43 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 94 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 187;
44 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 95 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 188;
45 The sense strand comprises the nucleotide sequence set forth in SEQ ID NO. 96 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO. 189;
46 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 97 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 190;
47 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 98 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 191;
48 The sense strand comprises the nucleotide sequence set forth in SEQ ID NO. 99 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO. 192;
49 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 100 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 193;
50 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 101 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 194;
51 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 102 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 195;
52 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 103 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 196;
53 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 104 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 197;
54 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 105 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 198;
55 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 106 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 199;
56 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 107, and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 200;
57 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 108 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 201;
58 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 109 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 202;
59 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 110 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 203;
60 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 111 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 204;
61 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 112 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 205;
62 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 113 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 206;
63 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 114 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 207;
64 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 115 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 208;
65 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 116, and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 209;
66 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 117 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 210;
67 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 118 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 211;
68 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 119 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 212;
69 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 120 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 213;
70 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 121 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 214;
71 The sense strand comprises the nucleotide sequence set forth in SEQ ID NO. 122 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO. 215;
72 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 123 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 216;
73 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 124 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 217;
74 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 125 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 218;
75 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 126 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 219;
76 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 127 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 220;
77 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 128 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 221;
78 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 129 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 222;
79 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 130 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 223;
80 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 131, and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 224;
81 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 132 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 225;
82 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 133 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 226;
83 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 134 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 227;
84 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 135 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 228;
85 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 136 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 229;
86 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 137 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 230;
87 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 138 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 231;
88 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 139 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 232;
89 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 140 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 233;
90 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 141 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 234;
91 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 142 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 235;
92 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO:143 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 236;
93 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 144 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 237;
106 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 262 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 349;
107 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 263 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 350;
108 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 264 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 351;
109 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 265 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 352;
110 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 266 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 353;
111 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 267 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 354;
112 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 268 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 355;
113 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 270 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 357;
114 The sense strand comprises the nucleotide sequence shown as SEQ ID NO:271 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO: 358;
115 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 272 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 359;
116 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 273 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 360;
117 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO:274 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 361;
118 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO:276 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 363;
119 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 277 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 364;
120 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 278 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 365;
121 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 279 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 366;
122 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 280 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 367;
123 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 281 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 368;
124 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 282 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 369;
126 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 284 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 371;
127 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 285 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 372;
128 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 286 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 373;
129 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 288 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 375;
130 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO:289 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 376;
131 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 290 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 377;
132 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 291 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 378;
133 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 292, and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 379;
134 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 293 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 380;
135 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 294 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 381;
136 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO:295 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 382;
137 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 296 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 383;
138 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 297 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 384;
139 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 298 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 385;
140 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 299, and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 386;
141 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 300 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 387;
142 The sense strand comprises the nucleotide sequence set forth in SEQ ID NO. 302 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO. 389;
143 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 303 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 390;
144 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 305 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 392;
145 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 306 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 393;
146 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 307 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 394;
147 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 308 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 395;
148 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 310 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 397;
149 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 311 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 398;
150 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 312 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 399;
151 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 315 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 402;
152 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 316 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 403;
153 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 317 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 404;
154 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 318, and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 405;
155 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 319 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 406;
156 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 320 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 407;
157 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 321 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 408;
158 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 322 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 409;
159 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 323 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 410;
160 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 324 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 411;
161 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 325 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 412;
162 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 326 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 413;
163 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 327 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 414;
164 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 328 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 415;
165 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 329 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 416;
166 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 330 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 417;
167 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 331 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 418;
168 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 332 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 419;
169 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 334 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 421;
170 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 335 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 422;
171 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 336 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 423;
172 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 337 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 424;
173 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 338 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 425;
174 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 340 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 427;
175 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 341 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 428;
176 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 344 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 431;
177 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 345 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 432;
178 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 346 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 433;
179 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 347 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 434;
231 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 530 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 541;
232 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO:531 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 542;
233 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 532 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 543;
234 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO 533 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO 544;
235 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 534 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 545;
236 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 535 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 546;
237 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 536 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 547;
238 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 537 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 548;
239 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 538 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 549;
240 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 539 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 550;
241 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 540 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 551.
10. The double-stranded ribonucleic acid of any one of claims 1 to 9, wherein each nucleotide in the sense strand is a modified nucleotide or an unmodified nucleotide independently of each other and/or each nucleotide in the antisense strand is a modified nucleotide or an unmodified nucleotide independently of each other.
11. The double-stranded ribonucleic acid of any one of claims 1 to 10, wherein any two nucleotides linked in the sense strand are linked by a phosphodiester or phosphorothioate linkage and/or any two nucleotides linked in the antisense strand are linked by a phosphodiester or phosphorothioate linkage.
12. The double stranded ribonucleic acid of any one of claims 1 to 11, wherein the 5 'terminal nucleotide of the sense strand is linked to a 5' phosphate group or a 5 'phosphate derivative group and/or the 5' terminal nucleotide of the antisense strand is linked to a 5 'phosphate group or a 5' phosphate derivative group.
13. The double-stranded ribonucleic acid of any one of claims 1 to 12, wherein the double-stranded ribonucleic acid is an siRNA.
14. The double-stranded ribonucleic acid of any one of claims 1 to 13, wherein the double-stranded ribonucleic acid is an siRNA for inhibiting expression of a C5 gene.
15. A double-stranded ribonucleic acid modification, which is a modification of a double-stranded ribonucleic acid according to any one of claims 1 to 14, said double-stranded ribonucleic acid modification comprising a chemical modification of at least one of:
(1) Modification of at least one nucleotide in the sense strand,
(2) Modification of the phosphodiester bond in at least one position in the sense strand,
(3) Modification of at least one nucleotide in the antisense strand,
(4) Modification of the phosphodiester bond at least one position in the antisense strand;
optionally, the 3' -end of sequence A in the sense strand of the double-stranded ribonucleic acid is linked to a sequence D consisting of 1-2 nucleotides, preferably 1-2 thymine deoxyribonucleotides; and/or, the 3' -end of the sequence B in the antisense strand of the double-stranded ribonucleic acid is connected with a sequence E consisting of 1-2 nucleotides, preferably a sequence E consisting of 1-2 thymine deoxyribonucleotides; and/or, the 3 '-end of the sequence A in the sense strand of the double-stranded ribonucleic acid excludes 1-2 nucleotides to form a sequence A';
Alternatively, the sense strand and the antisense strand of the double-stranded ribonucleic acid modification are selected from the following sequence combinations:
the nucleotide sequence of the sense strand is a sequence shown in a sequence A, and the nucleotide sequence of the antisense strand is a sequence shown in a sequence B;
or the nucleotide sequence of the sense strand is a sequence shown in a sequence A, and the nucleotide sequence of the antisense strand is a sequence shown in a sequence B and a connecting sequence E;
or the nucleotide sequence of the sense strand is a sequence shown in a sequence A and a connecting sequence D, and the nucleotide sequence of the antisense strand is a sequence shown in a sequence B;
or the nucleotide sequence of the sense strand is a sequence shown in a sequence A connected with a sequence D, and the nucleotide sequence of the antisense strand is a sequence shown in a sequence B connected with a sequence E;
alternatively, the nucleotide sequence of the sense strand is the sequence shown in the sequence A', and the nucleotide sequence of the antisense strand is the sequence shown in the sequence B;
alternatively, the nucleotide sequence of the sense strand is the sequence shown in the sequence A', and the nucleotide sequence of the antisense strand is the sequence shown in the sequence B and the connecting sequence E.
16. The double-stranded ribonucleic acid modification of claim 15, where the modification of the nucleotide is selected from a 2 '-fluoro modification, a 2' -alkoxy modification, a 2 '-substituted alkoxy modification, a 2' -alkyl modification, a 2 '-substituted alkyl modification, a 2' -deoxy modification, a nucleotide derivative modification, or a combination of any two or more thereof.
17. The double-stranded ribonucleic acid modification of claim 15 or 16, wherein the modification of the nucleotide is selected from the group consisting of a 2'-F modification, a 2' -O-CH modification 3 Modification, 2' -O-CH 2 -CH 2 -O-CH 3 Modification, 2' -O-CH 2 -CH＝CH 2 Modification, 2' -CH 2 -CH 2 -CH＝CH 2 Modification, 2' -deoxy modification, nucleotide derivative modification, or a combination of any two or more thereof.
18. The double-stranded ribonucleic acid modification of claim 16 or 17, wherein the nucleotide derivative in the nucleotide derivative modification is selected from the group consisting of an iso-nucleotide, LNA, ENA, cET, UNA, or GNA.
19. The double-stranded ribonucleic acid modification of any one of claims 15 to 18, wherein the ribonucleotides at positions 7, 9, 10 and 11 in the sense strand are 2'-F modified ribonucleotides in the direction of the 5' terminus towards the 3 'terminus, the ribonucleotides at the remaining positions in the sense strand being 2' -O-CH 3 Modified ribonucleotides.
20. The double stranded ribonucleic acid modification of any one of claims 15 to 19, wherein the sense strand comprises phosphorothioate linkages at positions as shown in the 5 'to 3' terminal orientation:
between nucleotide 1 and nucleotide 2 from the 5' end of the sense strand;
Between nucleotide 2 and nucleotide 3 from the 5' end of the sense strand;
between nucleotide 1 and nucleotide 2 from the 3' end of the sense strand;
between nucleotide 2 and nucleotide 3 from the 3' end of the sense strand;
or,
the sense strand comprises phosphorothioate linkages at the positions shown below:
between nucleotide 1 and nucleotide 2 from the 5' end of the sense strand;
between nucleotide 2 and nucleotide 3 from the 5' end of the sense strand;
or,
the sense strand comprises phosphorothioate linkages at the positions shown below:
between nucleotide 1 and nucleotide 2 from the 5' end of the sense strand;
between nucleotide 2 and nucleotide 3 from the 5' end of the sense strand;
between nucleotide 3 and nucleotide 4 from the 5' end of the sense strand;
between nucleotide 1 and nucleotide 2 from the 3' end of the sense strand;
between nucleotide 2 and nucleotide 3 from the 3' end of the sense strand;
between nucleotide 3 and nucleotide 4, the 3' end of the sense strand is initiated.
21. The double-stranded ribonucleic acid modification of any one of claims 15 to 20, wherein the ribonucleotide at any odd position in the antisense strand in the 5' to 3' terminal direction is 2' -O-CH 3 A modified ribonucleotide, said ribonucleotide at any even numbered position in the antisense strand being a 2' -F modified ribonucleotide;
alternatively, the ribonucleotides at positions 2, 6, 14 and 16 in the antisense strand are 2'-F modified ribonucleotides in the direction of the 5' end toward the 3 'end, and the ribonucleotides at the remaining positions in the antisense strand are 2' -O-CH 3 Modified ribonucleotides;
alternatively, the ribonucleotides at positions 2, 6, 8, 9, 14 and 16 in the antisense strand are 2'-F modified ribonucleotides in the direction from the 5' end to the 3 'end, and the ribonucleotides at the remaining positions in the antisense strand are 2' -O-CH 3 Modified ribonucleotides;
alternatively, the ribonucleotides at positions 2, 14 and 16 in the antisense strand are 2' -F modified ribonucleotides, the ribonucleotide at position 6 in the antisense strand is a nucleotide derivative GNA modified ribonucleotide, and the ribonucleotides at the rest positions in the antisense strand Is 2' -O-CH 3 Modified ribonucleotides;
alternatively, in the direction from the 5 '-end to the 3' -end, the ribonucleotides at positions 2, 6, 14 and 16 in the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 7 in the antisense strand is a nucleotide derivative GNA modified ribonucleotide, and the ribonucleotides at the rest positions in the antisense strand are 2' -O-CH 3 Modified ribonucleotides.
22. The double stranded ribonucleic acid modification of any one of claims 15 to 21, wherein the nucleotide at the 5' end of the antisense strand is linked to a 5' phosphate group or a 5' phosphate derivative group in the direction of the 5' end towards the 3' end.
23. The double-stranded ribonucleic acid modification of any one of claims 15 to 22, wherein,
the antisense strand comprises phosphorothioate linkages at the positions shown below:
between nucleotide 1 and nucleotide 2 from the 5' end of the antisense strand;
between nucleotide 2 and nucleotide 3 from the 5' end of the antisense strand; between nucleotide 1 and nucleotide 2 from the 3' end of the antisense strand;
between nucleotide 2 and nucleotide 3 from the 3' end of the antisense strand;
Or,
the antisense strand comprises phosphorothioate linkages at the positions shown below:
between nucleotide 1 and nucleotide 2 from the 5' end of the antisense strand;
between nucleotide 2 and nucleotide 3 from the 5' end of the antisense strand;
between nucleotide 3 and nucleotide 4 from the 5' end of the antisense strand;
between nucleotide 1 and nucleotide 2 from the 3' end of the antisense strand;
between nucleotide 2 and nucleotide 3 from the 3' end of the antisense strand;
the antisense strand is between nucleotide 3 and nucleotide 4 starting at the 3' end.
24. The double-stranded ribonucleic acid modification of any one of claims 15 to 23, wherein the sense strand of the double-stranded ribonucleic acid modification has a sequence as defined in (a 1 )-(a 6 ) The structure shown in any one of:
(a 1 )5’-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’，
(a 2 )5’-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’，
(a 3 )5’-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’，
(a 4 )5’-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3’，
(a 5 )5’-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -3’，
(a 6 )5’-mN 1 -(s)-mN 2 -(s)-mN 3 -(s)-mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -(s)-mN 19 -(s)-T-(s)-T-3’；
wherein N is 1 -N 23 Independently of one another, from ribonucleotides of base A, U, C or G,
the capital letter T denotes a deoxyribonucleotide with the base thymine,
the lower case letter m indicates that one ribonucleotide adjacent to the right side of the letter m is 2' -O-CH 3 The modified ribonucleotides are used as the amino acids,
the lower case letter F indicates that the adjacent ribonucleotide to the left of the letter F is a 2' -F modified ribonucleotide,
-(s) -means that two nucleotides adjacent to each other are linked by a phosphorothioate linkage.
25. The double stranded ribonucleic acid modification of any one of claims 15 to 24, wherein the antisense strand of the double stranded ribonucleic acid modification has a sequence as defined in (b 1 )-(b 17 ) The structure shown in any one of:
(b 1 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -N 4 f-mN 5 -N 6 f-mN 7 -N 8 f-mN 9 -N 10 f-mN 11 -N 12 f-mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -N 18 f-mN 19 -(s)-T-(s)-T-3’，
(b 2 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -N 4 f-mN 5 -N 6 f-mN 7 -N 8 f-mN 9 -N 10 f-mN 11 -N 12 f-mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -N 18 f-mN 19 -(s)-N 20 f-(s)-mN 21 -3’，
(b 3 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -N 4 f-mN 5 -N 6 f-mN 7 -N 8 f-mN 9 -N 10 f-mN 11 -N 12 f-mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -N 18 f-mN 19 -N 20 f-mN 21 -(s)-N 22 f-(s)-mN 23 -3’，
(b 4 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’，
(b 5 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’，
(b 6 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’，
(b 7 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -N 8 f-N 9 f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’，
(b 8 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -N 8 f-N 9 f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’，
(b 9 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -N 8 f-N 9 f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’，
(b 10 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -[GNA]N 6 -mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’，
(b 11 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -[GNA]N 6 -mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’，
(b 12 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -[GNA]N 6 -mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’，
(b 13 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-[GNA]N 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’，
(b 14 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-[GNA]N 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’，
(b 15 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-[GNA]N 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’，
(b 16 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -(s)-N 4 f-mN 5 -N 6 f-mN 7 -N 8 f-mN 9 -N 10 f-mN 11 -N 12 f-mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -N 18 f-(s)-mN 19 -(s)-T-(s)-T-3’，
(b 17 )5’-EVPmN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’；
wherein N is 1 -N 23 Independently of one another, from ribonucleotides of base A, U, C or G,
the capital letter T denotes a deoxyribonucleotide with the base thymine,
the lower case letter m indicates that one ribonucleotide adjacent to the right side of the letter m is 2' -O-CH 3 The modified ribonucleotides are used as the amino acids,
the lower case letter F indicates that the adjacent ribonucleotide to the left of the letter F is a 2' -F modified ribonucleotide,
p1 represents that one nucleotide adjacent to the right side of the letter is a nucleotide 5' -phosphate,
EVP means that one nucleotide adjacent to the right thereof is a nucleotide of 5' -trans-vinylphosphate,
-(s) -means that two nucleotides adjacent to each other are linked by phosphorothioate linkages,
[ GNA ] means that one of the ribonucleotides adjacent to the right thereof is a ribonucleotide in which GNA modification is present.
26. The double stranded ribonucleic acid modification of any one of claims 15 to 25, wherein the double stranded ribonucleic acid modification is an siRNA modification.
27. The double stranded ribonucleic acid modification of any one of claims 15 to 26, wherein the double stranded ribonucleic acid modification is an siRNA modification for inhibiting expression of a C5 gene.
28. The double stranded ribonucleic acid modification of any one of claims 15 to 27, wherein the sense strand and the antisense strand are selected from the group consisting of:
94 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 238 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 250;
95 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 239 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 251;
96 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 240 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 252;
97 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 241 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 253;
98 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 242 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 254;
99 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 243 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 255;
100 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 244 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 256;
101 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 245 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 257;
102 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 246 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 251;
103 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 247 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 257;
104 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 248 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 255;
105 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 249 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 252;
181 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 436 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 472;
182 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 437, and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 473;
183 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 437 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 474;
184 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 438 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 475;
185 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 439 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 475;
186 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 438 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 476;
187 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 440 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 477;
188 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 440 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 478;
189 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 441 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 478;
190 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 440 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 479;
191 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 440 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 480;
192 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 442 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 481;
193 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 442 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 482;
194 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 443 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 483;
195 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 444 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 484;
196 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 444 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 485;
197 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 445 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 486;
198 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 446 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 486;
199 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 445 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 487;
200 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 445 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 488;
201 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 445 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 489;
202 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 447 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 490;
203 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 448 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 491;
204 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 449 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 492;
205 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 450 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 493;
206 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 451 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 494;
207 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 451 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 495;
208 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 452 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 496;
209 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 453 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 497;
210 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 454 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 498;
211 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 455 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 499;
212 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 456 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 500;
213 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 457 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 501;
214 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 457 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 502;
215 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 458 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 503;
216 The sense strand comprises the nucleotide sequence shown as SEQ ID NO:459 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO: 504;
217 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 460 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 505;
218 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 461 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 506;
219 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 461 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 507;
220 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 462 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 508;
221 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 463 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 509;
222 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 463 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 510;
223 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 464 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 511;
224 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 465 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 512;
225 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 466 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 513;
226 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 467 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 514;
227 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 468 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 515;
228 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 469 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 516;
229 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 470 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 517;
230 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 471 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 518;
242 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 239 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 565;
243 The sense strand comprises the nucleotide sequence set forth in SEQ ID NO. 246 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO. 565;
244 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 239 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 566;
245 The sense strand comprises the nucleotide sequence set forth in SEQ ID NO. 246 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO. 566;
246 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 239 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 567;
247 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 239 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 568;
248 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 552 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 569;
249 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 245 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 570;
250 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 247 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 570;
251 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 245 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 571;
252 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 247 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 571;
253 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 245 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 572;
254 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 245 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 573;
255 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 243 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 574;
256 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 248 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 574;
257 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 243 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 575;
258 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 243 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 576;
259 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 243 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 577;
260 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 245 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 578;
261 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 240 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 579;
262 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 249 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 579;
263 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 240 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 580;
264 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 240 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 581;
265 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 240 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 582;
266 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 553 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 583;
267 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO:554, and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 584;
268 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO:555 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 585;
269 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 556 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 586;
270 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO:557, and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 587;
271 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 558 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 588;
272 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO:559, and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 589;
273 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 560 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 590;
274 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 561 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 591;
275 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 562 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 592;
276 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 563 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 593;
277 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 564 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 594.
29. A double-stranded ribonucleic acid conjugate, wherein the double-stranded ribonucleic acid conjugate comprises a double-stranded ribonucleic acid according to any one of claims 1 to 14, or a double-stranded ribonucleic acid modification according to any one of claims 15 to 28; and, conjugating a conjugation group attached to the double-stranded ribonucleic acid or the double-stranded ribonucleic acid modification.
30. The double-stranded ribonucleic acid conjugate of claim 29, wherein said conjugate group has the structure:
31. the double stranded ribonucleic acid conjugate of claim 29 or 30, wherein said conjugate group is attached to the 3' end of the sense strand.
32. The double stranded ribonucleic acid conjugate of claim 31, where the conjugate group is attached by a phosphodiester bond conjugated to the 3' end of the sense strand;
preferably, the sense strand and the antisense strand of the double-stranded ribonucleic acid conjugate are complementary to form a double-stranded region of the double-stranded ribonucleic acid conjugate, and the 3 'end of the sense strand forms a blunt end, the 3' end of the antisense strand having 1-2 protruding nucleotides extending out of the double-stranded region;
or,
the sense strand and the antisense strand of the double-stranded ribonucleic acid conjugate are complementary to form a double-stranded region of the double-stranded ribonucleic acid conjugate, and the 3 'end of the sense strand forms a blunt end and the 3' end of the antisense strand forms a blunt end.
33. The double-stranded ribonucleic acid conjugate of any one of claims 29 to 32, wherein the double-stranded ribonucleic acid conjugate has the structure:
wherein the double helix structure is double-stranded ribonucleic acid or double-stranded ribonucleic acid modifier.
34. The double stranded ribonucleic acid conjugate of any of claims 29 to 33, wherein the double stranded ribonucleic acid conjugate is an siRNA conjugate.
35. The double stranded ribonucleic acid conjugate of any one of claims 29 to 34, wherein the double stranded ribonucleic acid conjugate is an siRNA conjugate for inhibiting expression of a C5 gene.
36. The double-stranded ribonucleic acid conjugate of any of claims 29 to 35, wherein said double-stranded ribonucleic acid conjugate is formed by the attachment of any one of the sirnas shown in table 1 to a conjugate group, or said double-stranded ribonucleic acid conjugate is formed by the attachment of any one of the siRNA modifications shown in table 2 to a conjugate group;
preferably, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 258 and the antisense strand comprises the sequence shown as SEQ ID NO. 251;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 259 and the antisense strand comprises the sequence shown as SEQ ID NO. 257;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises a sequence as shown in SEQ ID NO. 260 and the antisense strand comprises a sequence as shown in SEQ ID NO. 255;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO:261 and the antisense strand comprises the sequence shown as SEQ ID NO: 252;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 519 and the antisense strand comprises the sequence shown as SEQ ID NO. 477;
Alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises a sequence as shown in SEQ ID NO. 519 and the antisense strand comprises a sequence as shown in SEQ ID NO. 478;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 520 and the antisense strand comprises the sequence shown as SEQ ID NO. 509;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 519 and the antisense strand comprises the sequence shown as SEQ ID NO. 479;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 519 and the antisense strand comprises the sequence shown as SEQ ID NO. 480;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 521 and the antisense strand comprises the sequence shown as SEQ ID NO. 481;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 521 and the antisense strand comprises the sequence shown as SEQ ID NO. 482;
Alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises a sequence as shown in SEQ ID NO. 522 and the antisense strand comprises a sequence as shown in SEQ ID NO. 486;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises a sequence as shown in SEQ ID NO. 522 and the antisense strand comprises a sequence as shown in SEQ ID NO. 487;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises a sequence as shown in SEQ ID NO. 522 and the antisense strand comprises a sequence as shown in SEQ ID NO. 488;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises a sequence as shown in SEQ ID NO. 522 and the antisense strand comprises a sequence as shown in SEQ ID NO. 489;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises a sequence as shown in SEQ ID NO:523 and the antisense strand comprises a sequence as shown in SEQ ID NO: 492;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 524 and the antisense strand comprises the sequence shown as SEQ ID NO. 493;
Alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 525 and the antisense strand comprises the sequence shown as SEQ ID NO. 494;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 525 and the antisense strand comprises the sequence shown as SEQ ID NO. 495;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises a sequence as shown in SEQ ID NO. 526 and the antisense strand comprises a sequence as shown in SEQ ID NO. 499;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises a sequence as shown in SEQ ID NO. 527 and the antisense strand comprises a sequence as shown in SEQ ID NO. 500;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises a sequence as shown in SEQ ID NO. 528 and the antisense strand comprises a sequence as shown in SEQ ID NO. 501;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 528 and the antisense strand comprises the sequence shown as SEQ ID NO. 502;
Alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises a sequence as shown in SEQ ID NO. 529 and the antisense strand comprises a sequence as shown in SEQ ID NO. 508;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 258 and the antisense strand comprises the sequence shown as SEQ ID NO. 565;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 258 and the antisense strand comprises the sequence shown as SEQ ID NO. 566;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 258 and the antisense strand comprises the sequence shown as SEQ ID NO. 567;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 258 and the antisense strand comprises the sequence shown as SEQ ID NO. 568;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 259 and the antisense strand comprises the sequence shown as SEQ ID NO. 570;
Alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 259 and the antisense strand comprises the sequence shown as SEQ ID NO. 571;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 259 and the antisense strand comprises the sequence shown as SEQ ID NO. 572;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 259 and the antisense strand comprises the sequence shown as SEQ ID NO. 573;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 259 and the antisense strand comprises the sequence shown as SEQ ID NO. 578;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 260 and the antisense strand comprises the sequence shown as SEQ ID NO. 574;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises a sequence as shown in SEQ ID NO. 260 and the antisense strand comprises a sequence as shown in SEQ ID NO. 575;
Alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 260 and the antisense strand comprises the sequence shown as SEQ ID NO. 576;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO. 260 and the antisense strand comprises the sequence shown as SEQ ID NO. 577;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises a sequence as shown in SEQ ID NO:261 and the antisense strand comprises a sequence as shown in SEQ ID NO: 579;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises a sequence as shown in SEQ ID NO:261 and the antisense strand comprises a sequence as shown in SEQ ID NO: 580;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises a sequence as shown in SEQ ID NO:261 and the antisense strand comprises a sequence as shown in SEQ ID NO: 581;
alternatively, in the double-stranded ribonucleic acid conjugate, the sense strand of the linking conjugate group comprises the sequence shown as SEQ ID NO:261 and the antisense strand comprises the sequence shown as SEQ ID NO: 582.
37. A pharmaceutical composition, wherein the pharmaceutical composition comprises at least one of: the double-stranded ribonucleic acid of any one of claims 1 to 14, a double-stranded ribonucleic acid modification of any one of claims 15 to 28, a double-stranded ribonucleic acid conjugate of any one of claims 29 to 36.
38. The pharmaceutical composition of claim 37, wherein the pharmaceutical composition further comprises one or more pharmaceutically acceptable carriers.
39. The double-stranded ribonucleic acid according to any one of claims 1 to 14, a double-stranded ribonucleic acid modification according to any one of claims 15 to 28, a double-stranded ribonucleic acid conjugate according to any one of claims 29 to 36, or a pharmaceutical composition according to any one of claims 37 to 38 for use in at least one of:
(1) Inhibiting C5 gene expression, or preparing a medicament for inhibiting C5 gene expression;
(2) For preventing or treating a disease associated with abnormal expression of a C5 gene, or for preparing a medicament for preventing or treating a disease associated with abnormal expression of a C5 gene;
(3) For treating a subject suffering from a disease that would benefit from reduced expression of the complement C5 gene, or for preparing a medicament for treating a subject suffering from a disease that would benefit from reduced expression of the complement C5 gene.
40. The use according to claim 39, wherein the disease associated with abnormal expression of C5 gene is selected from the group consisting of:
paroxysmal nocturnal hemoglobinuria, atypical hemolytic uremic syndrome, extensive myasthenia gravis, thromboembolism, neuromyelitis optica, antibody-mediated renal graft rejection, ji Lanba Rate syndrome, anti-neutrophil cytoplasmic antibody-associated vasculitis, amyotrophic lateral sclerosis, parkinson's disease, autoimmune encephalitis, igG 4-associated diseases, asthma, anti-phospholipid antibody syndrome, ischemia reperfusion injury, atypical hemolytic uremic syndrome, multifocal motor neuropathy, multiple sclerosis, thrombotic thrombocytopenic purpura, traumatic brain injury, condensed collectin disease, dermatomyositis, hemolytic uremic syndrome associated with shiga toxin-producing escherichia coli, graft dysfunction, myocardial infarction, sepsis, atherosclerosis, infective shock, spinal cord injury, psoriasis, autoimmune hemolytic anemia, antiphospholipid syndrome, myocarditis, immune complex vasculitis, high-amp disease, kawasaki disease, and rheumatoid arthritis.
41. A method for inhibiting expression of a C5 gene in a cell, wherein the method comprises contacting the cell with the double-stranded ribonucleic acid according to any one of claims 1 to 14, the double-stranded ribonucleic acid modification of any one of claims 15 to 28, the double-stranded ribonucleic acid conjugate of any one of claims 29 to 36, or the pharmaceutical composition of any one of claims 37 to 38.
42. The method of claim 41, wherein the cell is an in vivo cell or an in vitro cell.
43. The method of claim 41 or 42, wherein the cell is in a subject.
44. The method according to claim 43, wherein the subject is a mammal, preferably a human.
45. The method of claim 43 or 44, wherein the subject has at least one of the following characteristics:
abnormal expression of C5 gene in vivo, more specifically abnormal high expression of C5 gene;
suffering from a disease associated with abnormal expression of the C5 gene;
with diseases that would benefit from reduced C5 gene expression.
CN202310823538.1A 2022-07-07 2023-07-06 Double-stranded ribonucleic acid for inhibiting C5 gene expression, and modification, conjugate and application thereof Pending CN117264950A (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN2022108037507 2022-07-07
CN202210803750 2022-07-07

Publications (1)

Publication Number Publication Date
CN117264950A true CN117264950A (en) 2023-12-22

Family

ID=89209440

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310823538.1A Pending CN117264950A (en) 2022-07-07 2023-07-06 Double-stranded ribonucleic acid for inhibiting C5 gene expression, and modification, conjugate and application thereof

Country Status (2)

Country Link
CN (1) CN117264950A (en)
WO (1) WO2024008158A1 (en)

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9290760B2 (en) * 2010-09-15 2016-03-22 Alnylam Pharmaceuticals, Inc. Modified iRNA agents
SI2970974T1 (en) * 2013-03-14 2017-12-29 Alnylam Pharmaceuticals, Inc. Complement component c5 irna compositions and methods of use thereof
WO2016040589A1 (en) * 2014-09-12 2016-03-17 Alnylam Pharmaceuticals, Inc. Polynucleotide agents targeting complement component c5 and methods of use thereof
EP3194596A1 (en) * 2014-09-16 2017-07-26 Alnylam Pharmaceuticals, Inc. Complement component c5 irna compositions and methods of use thereof
US10036017B2 (en) * 2015-02-17 2018-07-31 Dicerna Pharmaceuticals, Inc. Methods and compositions for the specific inhibition of complement component 5(C5) by double-stranded RNA
AU2018360697A1 (en) * 2017-11-01 2020-05-14 Alnylam Pharmaceuticals, Inc. Complement component C3 iRNA compositions and methods of use thereof
WO2021026476A1 (en) * 2019-08-08 2021-02-11 Mpeg La, L.L.C. Complement targeting with multimeric oligonucleotides

Also Published As

Publication number Publication date
WO2024008158A1 (en) 2024-01-11

Similar Documents

Publication Publication Date Title
EP3719127A1 (en) Nucleic acid, composition and conjugate containing same, preparation method, and use
JP2020534254A (en) Oligonucleotide composition and its method
WO2020135581A1 (en) Nucleic acid, composition and conjugate containing nucleic acid, preparation method therefor and use thereof
US11896674B2 (en) SiRNA conjugate, preparation method therefor and use thereof
WO2020233650A1 (en) Nucleic acid, pharmaceutical composition, conjugate, preparation method, and use
WO2024088190A1 (en) Rna inhibitor for inhibiting lpa gene expression and use thereof
CN116769780A (en) siRNA for inhibiting expression of complement factor B, conjugate and pharmaceutical composition thereof and use thereof
WO2020233651A1 (en) Nucleic acid, pharmaceutical composition, conjugate, preparation method, and use
WO2023134705A1 (en) Rna interference agent for inhibiting angptl3 expression, and use thereof
CN117264950A (en) Double-stranded ribonucleic acid for inhibiting C5 gene expression, and modification, conjugate and application thereof
WO2023041079A1 (en) Lpa inhibitor and use thereof
CN117264954A (en) Double-stranded ribonucleic acid for inhibiting HMGB1 gene expression, and modification, conjugate and application thereof
CN118185930A (en) Double-stranded ribonucleic acid for inhibiting expression of C1s gene, and modification, conjugate and application thereof
CN117384902A (en) Double-stranded ribonucleic acid for inhibiting CYP27A1 gene expression, and modification, conjugate and application thereof
CN118272372A (en) Double-stranded ribonucleic acid for inhibiting blood coagulation factor XI gene expression, and modification, conjugate and application thereof
CN116622710A (en) Double-stranded ribonucleic acid for inhibiting C3 gene expression, and modification, conjugate and application thereof
CN116987696A (en) Double-stranded ribonucleic acid for inhibiting ANGPTL3 gene expression, and modification, conjugate and application thereof
CN117327698A (en) Double-stranded ribonucleic acid for inhibiting LPA gene expression, and modifications, conjugates and uses thereof
CN118308353A (en) Double-stranded ribonucleic acid for inhibiting FXII gene expression, and modification, conjugate and application thereof
WO2024140986A1 (en) Double-stranded ribonucleic acid, double-stranded ribonucleic acid modifier, and double-stranded ribonucleic acid conjugate and use thereof in inhibiting expression of blood coagulation factor xi gene
CN117757790A (en) siRNA for inhibiting SCAP gene expression, conjugate, pharmaceutical composition and application thereof
CN117645995A (en) SiRNA for inhibiting expression of asialoglycoprotein receptor gene, conjugate, pharmaceutical composition and application thereof
CN116478997B (en) siRNA for inhibiting FGL1, and modification and application thereof
WO2022196668A1 (en) Nucleic acid drug targeting itgav
WO2024141031A1 (en) Nucleic acid, composition and conjugate containing nucleic acid, preparation method therefor and use thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination