CN116478997B

CN116478997B - siRNA for inhibiting FGL1, and modification and application thereof

Info

Publication number: CN116478997B
Application number: CN202310665046.4A
Authority: CN
Inventors: 杜宏; 张佩琢
Original assignee: Suzhou Genepharma Co ltd
Current assignee: Suzhou Genepharma Co ltd
Priority date: 2023-06-06
Filing date: 2023-06-06
Publication date: 2023-12-29
Anticipated expiration: 2043-06-06
Also published as: CN116478997A

Abstract

The invention relates to siRNA for inhibiting FGL1, and a modifier and application thereof, and belongs to the technical field of biology. The invention provides siRNA for inhibiting FGL1, and experiments prove that the siRNA has high inhibition activity on FGL 1. The invention also provides modified siRNAs for inhibiting FGL1, wherein the modification comprises methoxy modification, fluoro modification and phosphorothioate linkage, and experiments prove that the modified siRNA still has better FGL1 inhibition effect at the concentration of 0.1nM, and the modified siRNA has more than 90% inhibition effect after single administration at the dose of 3mg/kg in mice.

Description

siRNA for inhibiting FGL1, and modification and application thereof

Technical Field

The invention relates to siRNA for inhibiting FGL1, and a modified product and application thereof, and belongs to the technical field of biology.

Background

Fibrinogen-like protein 1 (fgl 1) is a proliferation and metabolism-related factor secreted by the liver. FGL1 is normally expressed in the liver under normal physiological conditions, but FGL1 is up-regulated in tumor tissue (including lung, prostate, melanoma, colorectal, breast and brain tumors) when tumors develop. FGL1 has been shown to be a novel LAG3 ligand that binds to LAG3 to form a novel immune checkpoint pathway independent of PD-1/PD-L1, leading to T cell depletion and subsequent dysfunction, and tumor cell evasion immune surveillance (Chen et al, 2019). Inhibition of FGL1 expression may be used to treat or delay progression of a tumor.

Small interfering ribonucleic acids (small interfering RNAs, sirnas), typically double-stranded RNAs 20 to 25 nucleotides in length, modulate gene expression in a specific manner, primarily through RNA interference (RNAi) mechanisms, for the purpose of treating disease. Therefore, developing an siRNA that inhibits FGL1 production would be an effective way to treat tumors.

Disclosure of Invention

In order to solve the above problems, the present invention provides an siRNA for inhibiting FGL1, the siRNA comprising a sense strand and an antisense strand, the sense strand and the antisense strand being at least partially reverse-complementary to form a double-stranded region,

wherein the sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides that have at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID No.1 or to the complete nucleotide sequence of SEQ ID No.1, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides that have at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID No.2 or to the complete nucleotide sequence of SEQ ID No. 2; or alternatively, the first and second heat exchangers may be,

the sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID No.3 or to the complete nucleotide sequence of SEQ ID No.3, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID No.4 or to the complete nucleotide sequence of SEQ ID No. 4; or alternatively, the first and second heat exchangers may be,

The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID No.5 or to the complete nucleotide sequence of SEQ ID No.5, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID No.6 or to the complete nucleotide sequence of SEQ ID No. 6; or alternatively, the first and second heat exchangers may be,

the sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID No.7 or to the complete nucleotide sequence of SEQ ID No.7, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID No.8 or to the complete nucleotide sequence of SEQ ID No. 8; or alternatively, the first and second heat exchangers may be,

the sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID No.9 or to the complete nucleotide sequence of SEQ ID No.9, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID No.10 or to the complete nucleotide sequence of SEQ ID No. 10; or alternatively, the first and second heat exchangers may be,

The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID No.11 or to the complete nucleotide sequence of SEQ ID No.11, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID No.12 or to the complete nucleotide sequence of SEQ ID No. 12; or alternatively, the first and second heat exchangers may be,

the sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID No.13 or to the complete nucleotide sequence of SEQ ID No.13, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID No.14 or to the complete nucleotide sequence of SEQ ID No. 14; or alternatively, the first and second heat exchangers may be,

the sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID No.15 or to the complete nucleotide sequence of SEQ ID No.15, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID No.16 or to the complete nucleotide sequence of SEQ ID No. 16; or alternatively, the first and second heat exchangers may be,

The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID No.17 or to the complete nucleotide sequence of SEQ ID No.17, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID No.18 or to the complete nucleotide sequence of SEQ ID No. 18; or alternatively, the first and second heat exchangers may be,

the sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID No.19 or to the complete nucleotide sequence of SEQ ID No.19, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID No.20 or to the complete nucleotide sequence of SEQ ID No. 20; or alternatively, the first and second heat exchangers may be,

the sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID No.21 or to the complete nucleotide sequence of SEQ ID No.21, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID No.22 or to the complete nucleotide sequence of SEQ ID No. 22; or alternatively, the first and second heat exchangers may be,

The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides that have at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID No.23 or to the complete nucleotide sequence of SEQ ID No.23, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides that have at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID No.24 or to the complete nucleotide sequence of SEQ ID No. 24; or alternatively, the first and second heat exchangers may be,

the sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides that have at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID No.25 or to the complete nucleotide sequence of SEQ ID No.25, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides that have at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID No.26 or to the complete nucleotide sequence of SEQ ID No. 26; or alternatively, the first and second heat exchangers may be,

the sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides that have at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID No.27 or to the complete nucleotide sequence of SEQ ID No.27, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides that have at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID No.28 or to the complete nucleotide sequence of SEQ ID No. 28; or alternatively, the first and second heat exchangers may be,

The sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID No.29 or to the complete nucleotide sequence of SEQ ID No.29, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID No.30 or to the complete nucleotide sequence of SEQ ID No. 30; or alternatively, the first and second heat exchangers may be,

the sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides that have at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID No.31 or to the complete nucleotide sequence of SEQ ID No.31, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides that have at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID No.32 or to the complete nucleotide sequence of SEQ ID No. 32; or alternatively, the first and second heat exchangers may be,

the sense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID No.33 or to the complete nucleotide sequence of SEQ ID No.33, and the antisense strand comprises a nucleotide sequence comprising at least 15 consecutive nucleotides having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of SEQ ID No.34 or to the complete nucleotide sequence of SEQ ID No. 34.

In one embodiment of the invention, the sense strand comprises: a nucleotide sequence as set forth in SEQ ID No.1 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity to the nucleotide sequence as set forth in SEQ ID No.1 and retaining the biological function of the sequence from which it is derived, said antisense strand comprising: a nucleotide sequence as set forth in SEQ ID No.2 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity to the nucleotide sequence as set forth in SEQ ID No.2 and retaining the biological function of the sequence from which it is derived; or alternatively, the first and second heat exchangers may be,

the sense strand comprises: a nucleotide sequence as set forth in SEQ ID No.3 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity to the nucleotide sequence as set forth in SEQ ID No.3 and retaining the biological function of the sequence from which it is derived, said antisense strand comprising: a nucleotide sequence as set forth in SEQ ID No.4 or a nucleotide sequence which is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as set forth in SEQ ID No.4 and retains the biological function of the sequence from which it is derived; or alternatively, the first and second heat exchangers may be,

The sense strand comprises: a nucleotide sequence as set forth in SEQ ID No.5 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity to the nucleotide sequence as set forth in SEQ ID No.5 and retaining the biological function of the sequence from which it is derived, said antisense strand comprising: a nucleotide sequence as set forth in SEQ ID No.6 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity to the nucleotide sequence as set forth in SEQ ID No.6 and retaining the biological function of the sequence from which it is derived; or alternatively, the first and second heat exchangers may be,

the sense strand comprises: a nucleotide sequence as set forth in SEQ ID No.7 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity to the nucleotide sequence as set forth in SEQ ID No.7 and retaining the biological function of the sequence from which it is derived, said antisense strand comprising: a nucleotide sequence as set forth in SEQ ID No.8 or a nucleotide sequence which is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as set forth in SEQ ID No.8 and retains the biological function of the sequence from which it is derived; or alternatively, the first and second heat exchangers may be,

The sense strand comprises: a nucleotide sequence as set forth in SEQ ID No.9 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity to the nucleotide sequence as set forth in SEQ ID No.9 and retaining the biological function of the sequence from which it is derived, said antisense strand comprising: a nucleotide sequence as set forth in SEQ ID No.10 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity to the nucleotide sequence as set forth in SEQ ID No.10 and retaining the biological function of the sequence from which it is derived; or alternatively, the first and second heat exchangers may be,

the sense strand comprises: a nucleotide sequence as set forth in SEQ ID No.11 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity to the nucleotide sequence as set forth in SEQ ID No.11 and retaining the biological function of the sequence from which it is derived, said antisense strand comprising: a nucleotide sequence as set forth in SEQ ID No.12 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity to the nucleotide sequence as set forth in SEQ ID No.12 and retaining the biological function of the sequence from which it is derived; or alternatively, the first and second heat exchangers may be,

The sense strand comprises: a nucleotide sequence as set forth in SEQ ID No.13 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity to the nucleotide sequence as set forth in SEQ ID No.13 and retaining the biological function of the sequence from which it is derived, said antisense strand comprising: a nucleotide sequence as set forth in SEQ ID No.14 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity to the nucleotide sequence as set forth in SEQ ID No.14 and retaining the biological function of the sequence from which it is derived; or alternatively, the first and second heat exchangers may be,

the sense strand comprises: a nucleotide sequence as set forth in SEQ ID No.15 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity to the nucleotide sequence as set forth in SEQ ID No.15 and retaining the biological function of the sequence from which it is derived, said antisense strand comprising: a nucleotide sequence as set forth in SEQ ID No.16 or a nucleotide sequence which is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as set forth in SEQ ID No.16 and retains the biological function of the sequence from which it is derived; or alternatively, the first and second heat exchangers may be,

The sense strand comprises: a nucleotide sequence as set forth in SEQ ID No.17 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity to a nucleotide sequence as set forth in SEQ ID No.17 and retaining the biological function of the sequence from which it is derived, said antisense strand comprising: a nucleotide sequence as set forth in SEQ ID No.18 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity to the nucleotide sequence as set forth in SEQ ID No.18 and retaining the biological function of the sequence from which it is derived; or alternatively, the first and second heat exchangers may be,

the sense strand comprises: a nucleotide sequence as set forth in SEQ ID No.19 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity to the nucleotide sequence as set forth in SEQ ID No.19 and retaining the biological function of the sequence from which it is derived, said antisense strand comprising: a nucleotide sequence as set forth in SEQ ID No.20 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity to the nucleotide sequence as set forth in SEQ ID No.20 and retaining the biological function of the sequence from which it is derived; or alternatively, the first and second heat exchangers may be,

The sense strand comprises: a nucleotide sequence as set forth in SEQ ID No.21 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity to the nucleotide sequence as set forth in SEQ ID No.21 and retaining the biological function of the sequence from which it is derived, said antisense strand comprising: a nucleotide sequence as set forth in SEQ ID No.22 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity to the nucleotide sequence as set forth in SEQ ID No.22 and retaining the biological function of the sequence from which it is derived; or alternatively, the first and second heat exchangers may be,

the sense strand comprises: a nucleotide sequence as set forth in SEQ ID No.23 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity to the nucleotide sequence as set forth in SEQ ID No.23 and retaining the biological function of the sequence from which it is derived, said antisense strand comprising: a nucleotide sequence as set forth in SEQ ID No.24 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity to the nucleotide sequence as set forth in SEQ ID No.24 and retaining the biological function of the sequence from which it is derived; or alternatively, the first and second heat exchangers may be,

The sense strand comprises: a nucleotide sequence as set forth in SEQ ID No.25 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity to a nucleotide sequence as set forth in SEQ ID No.25 and retaining the biological function of the sequence from which it is derived, said antisense strand comprising: a nucleotide sequence as set forth in SEQ ID No.26 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity to the nucleotide sequence as set forth in SEQ ID No.26 and retaining the biological function of the sequence from which it is derived; or alternatively, the first and second heat exchangers may be,

the sense strand comprises: a nucleotide sequence as set forth in SEQ ID No.27 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity to the nucleotide sequence as set forth in SEQ ID No.27 and retaining the biological function of the sequence from which it is derived, said antisense strand comprising: a nucleotide sequence as set forth in SEQ ID No.28 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity to the nucleotide sequence as set forth in SEQ ID No.28 and retaining the biological function of the sequence from which it is derived; or alternatively, the first and second heat exchangers may be,

The sense strand comprises: a nucleotide sequence as set forth in SEQ ID No.29 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity to the nucleotide sequence as set forth in SEQ ID No.29 and retaining the biological function of the sequence from which it is derived, said antisense strand comprising: a nucleotide sequence as set forth in SEQ ID No.30 or a nucleotide sequence which is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as set forth in SEQ ID No.30 and retains the biological function of the sequence from which it is derived; or alternatively, the first and second heat exchangers may be,

the sense strand comprises: a nucleotide sequence as set forth in SEQ ID No.31 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity to the nucleotide sequence as set forth in SEQ ID No.31 and retaining the biological function of the sequence from which it is derived, said antisense strand comprising: a nucleotide sequence as set forth in SEQ ID No.32 or a nucleotide sequence which is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as set forth in SEQ ID No.32 and retains the biological function of the sequence from which it is derived; or alternatively, the first and second heat exchangers may be,

The sense strand comprises: a nucleotide sequence as set forth in SEQ ID No.33 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity to the nucleotide sequence as set forth in SEQ ID No.33 and retaining the biological function of the sequence from which it is derived, said antisense strand comprising: the nucleotide sequence as set forth in SEQ ID No.34 or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identical to the nucleotide sequence as set forth in SEQ ID No.34 and retains the biological function of the sequence from which it is derived.

In one embodiment of the invention, the sense strand consists of the nucleotide sequence shown as SEQ ID NO.1 and the antisense strand consists of the nucleotide sequence shown as SEQ ID NO. 2; or alternatively, the first and second heat exchangers may be,

the sense strand consists of a nucleotide sequence shown as SEQ ID NO.3, and the antisense strand consists of a nucleotide sequence shown as SEQ ID NO. 4; or alternatively, the first and second heat exchangers may be,

the sense strand consists of a nucleotide sequence shown as SEQ ID NO.5, and the antisense strand consists of a nucleotide sequence shown as SEQ ID NO. 6; or alternatively, the first and second heat exchangers may be,

the sense strand consists of a nucleotide sequence shown as SEQ ID NO.7, and the antisense strand consists of a nucleotide sequence shown as SEQ ID NO. 8; or alternatively, the first and second heat exchangers may be,

The sense strand consists of a nucleotide sequence shown as SEQ ID NO.9, and the antisense strand consists of a nucleotide sequence shown as SEQ ID NO. 10; or alternatively, the first and second heat exchangers may be,

the sense strand consists of a nucleotide sequence shown as SEQ ID NO.11, and the antisense strand consists of a nucleotide sequence shown as SEQ ID NO. 12; or alternatively, the first and second heat exchangers may be,

the sense strand consists of a nucleotide sequence shown as SEQ ID NO.13, and the antisense strand consists of a nucleotide sequence shown as SEQ ID NO. 14; or alternatively, the first and second heat exchangers may be,

the sense strand consists of a nucleotide sequence shown as SEQ ID NO.15, and the antisense strand consists of a nucleotide sequence shown as SEQ ID NO. 16; or alternatively, the first and second heat exchangers may be,

the sense strand consists of a nucleotide sequence shown as SEQ ID NO.17, and the antisense strand consists of a nucleotide sequence shown as SEQ ID NO. 18; or alternatively, the first and second heat exchangers may be,

the sense strand consists of a nucleotide sequence shown as SEQ ID NO.19, and the antisense strand consists of a nucleotide sequence shown as SEQ ID NO. 20; or alternatively, the first and second heat exchangers may be,

the sense strand consists of a nucleotide sequence shown as SEQ ID NO.21, and the antisense strand consists of a nucleotide sequence shown as SEQ ID NO. 22; or alternatively, the first and second heat exchangers may be,

the sense strand consists of a nucleotide sequence shown as SEQ ID NO.23, and the antisense strand consists of a nucleotide sequence shown as SEQ ID NO. 24; or alternatively, the first and second heat exchangers may be,

The sense strand consists of a nucleotide sequence shown as SEQ ID NO.25, and the antisense strand consists of a nucleotide sequence shown as SEQ ID NO. 26; or alternatively, the first and second heat exchangers may be,

the sense strand consists of a nucleotide sequence shown as SEQ ID NO.27, and the antisense strand consists of a nucleotide sequence shown as SEQ ID NO. 28; or alternatively, the first and second heat exchangers may be,

the sense strand consists of a nucleotide sequence shown as SEQ ID NO.29, and the antisense strand consists of a nucleotide sequence shown as SEQ ID NO. 30; or alternatively, the first and second heat exchangers may be,

the sense strand consists of a nucleotide sequence shown as SEQ ID NO.31, and the antisense strand consists of a nucleotide sequence shown as SEQ ID NO. 32; or alternatively, the first and second heat exchangers may be,

the sense strand consists of the nucleotide sequence shown as SEQ ID NO.33, and the antisense strand consists of the nucleotide sequence shown as SEQ ID NO. 34.

In one embodiment of the present invention, the siRNA is prepared by solid phase synthesis or liquid phase synthesis.

In one embodiment of the invention, the nucleotides in the siRNA are each independently modified or unmodified nucleotides.

In one embodiment of the present invention, each nucleotide in the siRNA is an unmodified nucleotide.

In one embodiment of the invention, some or all of the nucleotides in the siRNA are modified nucleotides, and these modifications in the nucleotide groups do not result in a significant impairment or loss of the function of the siRNA of the present disclosure to inhibit FGL1 gene expression.

In one embodiment of the present invention, at least one nucleotide in the sense strand or the antisense strand of the siRNA is a modified nucleotide.

In one embodiment of the present invention, at least one phosphate group in the sense strand or the antisense strand of the siRNA is a phosphate group having a modifying group.

In one embodiment of the present invention, at least a portion of the phosphate groups and/or ribose groups in at least one single stranded phosphate-sugar backbone in the sense strand and the antisense strand of the siRNA are phosphate groups having a modifying group and/or ribose groups having a modifying group.

In one embodiment of the invention, all of the nucleotides in the sense strand and/or antisense strand of the siRNA are modified nucleotides, and such modifications on the nucleotide groups do not result in a significant impairment or loss of the function of the siRNA of the present disclosure to inhibit FGL1 gene expression.

In one embodiment of the invention, each nucleotide in the sense strand and the antisense strand of the siRNA is independently a fluoro-modified nucleotide or a non-fluoro-modified nucleotide.

In one embodiment of the invention, the modification is a chemical modification selected from one or more of methoxy modification, fluoro modification or phosphorothioate linkage.

In one embodiment of the present invention, the "fluoro-modified nucleotide" refers to a nucleotide in which the hydroxyl group at the 2' -position of the ribosyl group of the nucleotide is substituted with fluorine, which has a structure represented by the following formula (1). The non-fluoro modified nucleotide is independently selected from one of nucleotides or nucleotide analogues formed by substituting a hydroxyl group at the 2' -position of a ribosyl of the nucleotide with a non-fluoro group.

In one embodiment of the present invention, the nucleotides formed by substitution of the hydroxyl group at the 2 '-position of the ribosyl group with a non-fluorine group are well known to those skilled in the art and may be selected from one of 2' -alkoxy-modified nucleotides, 2 '-substituted alkoxy-modified nucleotides, 2' -alkyl-modified nucleotides, 2 '-substituted alkyl-modified nucleotides, 2' -amino-modified nucleotides, 2 '-substituted amino-modified nucleotides, 2' -deoxynucleotides.

In one embodiment of the invention, the 2' -alkoxy-modified nucleotide is a 2' -methoxy (2 ' -OMe) -modified nucleotide, as shown in formula (2); 2' -substituted alkoxy-modified nucleotides, for example, may be 2' -O-methoxyethyl (2 ' -MOE) -modified nucleotides, as shown in formula (3), 2' -amino (2 ' -NH) ₂ ) The modified nucleotide is shown as a formula (4), and the 2' -Deoxynucleotide (DNA) is shown as a formula (5):

in one embodiment of the invention, the fluoro-modified nucleotides are located in the antisense and sense strands of the nucleotide sequence, and the nucleotides at least at positions 9, 10, 11 of the sense strand are fluoro-modified nucleotides and the nucleotides at least at positions 2, 6, 14, 16 of the antisense strand are fluoro-modified nucleotides in the direction from the 5 'end to the 3' end.

In one embodiment of the invention, the fluoro-modified nucleotides are located in the antisense and sense strands of the nucleotide sequence, and at least nucleotides at positions 7, 8, 9 of the sense strand are fluoro-modified nucleotides and at least nucleotides at positions 2, 6, 14, 16 of the antisense strand are fluoro-modified nucleotides in the direction from the 5 'end to the 3' end.

In one embodiment of the invention, the fluoro-modified nucleotides are located in a sense strand in which there are no more than 5 fluoro-modified nucleotides and at least nucleotides at positions 7, 8, 9 of the sense strand are fluoro-modified nucleotides in the direction from the 5 'end to the 3' end, and an antisense strand in which there are no more than 7 fluoro-modified nucleotides and at least nucleotides at positions 2, 6, 14, 16 of the antisense strand are fluoro-modified nucleotides.

In one embodiment of the invention, in the sense strand, the nucleotides at positions 7, 8, 9 or 5, 7, 8, 9 of the sense strand are fluoro-modified nucleotides, the nucleotides at the remaining positions in the sense strand are non-fluoro-modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 6, 14, 16 or 2, 6, 8, 9, 14, 16 of the antisense strand are fluoro-modified nucleotides.

In one embodiment of the invention, the methoxy-modified nucleotides are located in the antisense and sense strands of the nucleotide sequence, and at least nucleotides at positions 1, 2, 3, 4, 5, 6, 7, 8, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 of the sense strand are methoxy-modified nucleotides, and at least nucleotides at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, 21, 22, 23, 24 of the antisense strand are methoxy-modified nucleotides, in a 5 'to 3' end direction.

In one embodiment of the invention, the methoxy modified nucleotides are located in the antisense and sense strands of the nucleotide sequence, and at least nucleotides at positions 1, 2, 3, 4, 5, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 of the sense strand are methoxy modified nucleotides, and at least nucleotides at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, 21 of the antisense strand are methoxy modified nucleotides, in a 5 'to 3' end direction.

In one embodiment of the invention, the nucleotide analog refers to a group that is capable of replacing a nucleotide in a nucleic acid, but that differs in structure from adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine deoxyribonucleotide.

In one embodiment of the invention, the nucleotide analog may be an isopucleotide, a bridged nucleotide or an acyclic nucleotide.

In one embodiment of the invention, the bridged nucleotide (bridged nucleic acid, abbreviated BNA) refers to a constrained or inaccessible nucleotide, and BNA may contain a five-, six-, or seven-membered ring bridging structure with "fixed" C3' -endo-sugar tucks, typically incorporated into the 2' -, 4' -position of the ribose to provide a 2',4' -BNA nucleotide.

In one embodiment of the present invention, the BNA may be LNA, ENA, cret BNA, etc., wherein LNA is shown in formula (6), ENA is shown in formula (7), cret BNA is shown in formula (8):

in one embodiment of the present invention, at least a portion of the phosphate groups in the phosphate-sugar backbone of at least one single strand of the sense strand and the antisense strand of the siRNA are phosphate groups having a modifying group.

In one embodiment of the present invention, the phosphate group having a modifying group is a phosphorothioate group formed by substitution of at least one oxygen atom of a phosphodiester bond in the phosphate group with a sulfur atom.

In one embodiment of the present invention, the phosphate group having a modifying group is a phosphorothioate group having a structure shown in formula (9):

in one embodiment of the invention, the phosphorothioate linkage is present at least one of the group consisting of: between the first and second nucleotides at either end of the sense strand or the antisense strand; between the second and third nucleotides at either end of the sense strand or the antisense strand; or any combination of the above.

In one embodiment of the invention, phosphorothioate linkages are present at all of the above positions except the 5' end of the sense strand.

In one embodiment of the invention, phosphorothioate linkages are present at all of the above positions except at the 3' end of the sense strand.

In one embodiment of the invention, the phosphorothioate linkage is present in at least one of the following positions:

between nucleotide 1 and nucleotide 2 of the 5' end of the sense strand;

Between nucleotide 2 and nucleotide 3 of the 5' end of the sense strand;

the 3' end of the sense strand is between nucleotide 1 and nucleotide 2;

the 3' end of the sense strand is between nucleotide 2 and nucleotide 3;

the 5' end of the antisense strand is between nucleotide 1 and nucleotide 2;

the 5' end of the antisense strand is between nucleotide 2 and nucleotide 3;

the 3' end of the antisense strand is between nucleotide 1 and nucleotide 2; and

the 3' -end of the antisense strand is between nucleotide 2 and nucleotide 3.

In one embodiment of the invention, the phosphorothioate-linked nucleotides are located in the antisense and sense strands of the nucleotide sequence, and at least between the nucleotides at positions 1 and 2, 2 and 3 of the sense strand are linked by phosphorothioate groups in the 5 'to 3' end direction; at least the nucleotides at positions 1 and 2, 2 and 3, 21 and 22, 22 and 23 of the antisense strand are linked by phosphorothioate groups according to the direction from the 5 'end to the 3' end.

In one embodiment of the invention, the phosphorothioate-linked nucleotides are located in the antisense and sense strands of the nucleotide sequence, and at least between the nucleotides at positions 1 and 2, 2 and 3 of the sense strand are linked by phosphorothioate groups in the 5 'to 3' end direction; at least the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, 20 and 21 of the antisense strand are linked by phosphorothioate groups in the direction from the 5 'end to the 3' end.

In one embodiment of the invention, the siRNA incorporates modified nucleotides by using nucleotide monomers with corresponding modifications.

The invention also provides a product for inhibiting FGL1, which comprises an active ingredient and a pharmaceutically acceptable carrier, wherein the active ingredient is the siRNA or the modified siRNA.

In one embodiment of the invention, the product is a pharmaceutical composition or kit.

In one embodiment of the invention, the product is a pharmaceutical composition and the pharmaceutically acceptable carrier may be a carrier conventionally used in the field of siRNA administration, such as, but not limited to, magnetic nanoparticles (magnetic nanoparticles, e.g., based on Fe ₃ O ₄ Or Fe (Fe) ₂ O ₃ Nano-particles of (c), carbon nanotubes (ca)rbonnotubes), mesoporous silica (mesoporous silicon), calcium phosphate nanoparticles (calcium phosphatenanoparticles), polyethylenimine (PEI), polyamidedendrimers (polyamidoamine (PAMAM) dendrimers), polylysine (poly (L-lysine), PLL), chitosan (chitosan), 1, 2-dioleoyl-3-trimethylammoniopropane (1, 2-dioleoyl-3-trimethylonium-production, DOTAP), poly-D-or L-lactic acid/glycolic acid copolymers (poly (D) &L-lactic/glycolic acid) copolymer, poly (aminoethylethylphosphate) (poly (2-aminoethyl ethylene phosphate), PPEEA) and poly (2-dimethylaminoethyl methacrylate), PDMAEMA) and derivatives thereof.

In one embodiment of the present invention, the content of the siRNA and the pharmaceutically acceptable carrier is not particularly limited and may be the conventional content of each component.

In one embodiment of the present invention, the weight ratio of the active ingredient to the pharmaceutically acceptable carrier in the pharmaceutical composition is 1 (1-500).

In one embodiment of the present invention, the weight ratio of the active ingredient to the pharmaceutically acceptable carrier in the pharmaceutical composition is 1 (1-50).

In one embodiment of the present invention, the pharmaceutical composition may further comprise other pharmaceutically acceptable excipients, which may be one or more of various formulations or compounds conventionally employed in the art.

In one embodiment of the present invention, the pharmaceutically acceptable additional excipients may include at least one of a pH buffer, a protectant, and an osmolality regulator.

In one embodiment of the present invention, the pH buffer may be a tris hydrochloride buffer having a pH of 7.5 to 8.5 and/or a phosphate buffer having a pH of 5.5 to 8.5.

In one embodiment of the present invention, the protective agent may be at least one of inositol, sorbitol, sucrose, trehalose, mannose, maltose, lactose, and glucose.

In one embodiment of the present invention, the protective agent may be contained in an amount of 0.01 to 30% by weight based on the total weight of the pharmaceutical composition.

In one embodiment of the invention, the osmolality adjusting agent may be sodium chloride and/or potassium chloride.

In one embodiment of the present invention, the osmolality adjusting agent is present in an amount such that the osmolality of the pharmaceutical composition is 200 to 700 milliosmoles per liter (mOSM/L), which can be readily determined by one skilled in the art depending on the desired osmolality.

In one embodiment of the present invention, the pharmaceutical composition may be a liquid formulation, such as an injection; or freeze-dried powder injection, and is mixed with liquid adjuvant to make into liquid preparation.

In one embodiment of the invention, the liquid formulation may be administered, but is not limited to, subcutaneously, intramuscularly or intravenously, but may also be administered, but is not limited to, by spraying to the lungs, or by spraying through the lungs to other visceral tissues such as the liver.

In one embodiment of the invention, the pharmaceutical composition is for intravenous administration.

In one embodiment of the invention, the pharmaceutical composition may be in the form of a liposomal formulation.

In one embodiment of the invention, the pharmaceutically acceptable carrier used in the liposomal formulation comprises an amine-containing transfection compound (which may also be referred to hereinafter as an organic amine), a helper lipid and/or a pegylated lipid.

In one embodiment of the present invention, the organic amine, the helper lipid and the pegylated lipid may be selected from one or more of the amine-containing transfection compounds described in CN108220295B (which is incorporated herein by reference in its entirety) or pharmaceutically acceptable salts or derivatives thereof, the helper lipid and the pegylated lipid, respectively.

In one embodiment of the invention, the pharmaceutically acceptable targeting group in the siRNA conjugate may be galactose or N-acetylgalactosamine (GalNAc), which is a ligand that binds to hepatic surface asialoglycoprotein receptor (asialoglycoprotein receptor, ASGPR), an endocytic receptor for hepatocyte-specific expression, as targeting molecule to deliver small RNAs to the liver.

In one embodiment of the invention, the galactose or N-acetylgalactosamine molecule may be monovalent, divalent, trivalent, tetravalent; the monovalent, divalent, trivalent and tetravalent respectively refer to that after the siRNA molecules and the coupling groups containing galactose or N-acetylgalactosamine molecules as targeting groups form siRNA conjugates, the molar ratio of the siRNA molecules to the galactose or N-acetylgalactosamine molecules in the siRNA conjugates is 1:1, 1:2, 1:3 or 1:4.

In one embodiment of the invention, the N-acetylgalactosamine molecule is trivalent or tetravalent when the siRNA is coupled to a coupling group comprising N-acetylgalactosamine.

In one embodiment of the invention, the N-acetylgalactosamine molecule is trivalent when the siRNA is coupled to a coupling group comprising N-acetylgalactosamine.

In one embodiment of the invention, the targeting group can be attached to the siRNA molecule via a suitable linker, which can be selected by one skilled in the art depending on the specific type of targeting group.

In one embodiment of the present invention, the kind of linker, targeting group and the way of attachment to the siRNA can be found in the disclosure of WO2015006740A2, the entire contents of which are incorporated herein by reference.

In one embodiment of the present invention, an siRNA conjugate formed by GalNAc and an siRNA molecule has a structure represented by the following formula (10):

in one embodiment of the invention, the kit further comprises a pharmaceutically acceptable carrier and/or adjuvant.

In one embodiment of the invention, the siRNA, pharmaceutically acceptable carrier and/or adjuvant in the kit may be present alone, in a mixture of two or more thereof, or in the form of a final pharmaceutical composition.

In one embodiment of the invention, the pharmaceutically acceptable carrier in the kit is an amine-containing compound, a helper lipid, and a pegylated lipid.

In one embodiment of the invention, the pharmaceutically acceptable carrier is a mixture or is independently present in the kit.

In one embodiment of the invention, the siRNA, pharmaceutically acceptable carrier and/or adjuvant in the kit is provided in liquid form, dried form or lyophilized form.

In one embodiment of the invention, the siRNA, pharmaceutically acceptable carrier and/or adjuvant in the kit is substantially pure and/or sterile.

In one embodiment of the invention, the kit comprises a container for providing siRNA, one or more containers for providing amine-containing compounds, auxiliary lipids and pegylated lipids, optionally, a container for providing adjuvants.

In one embodiment of the invention, the kit further comprises one or more components necessary or beneficial for the particular application, selected from the group consisting of:

one or more components for achieving desired cell transfection;

one or more components for effecting diagnosis, treatment or prevention of a particular disease or body disorder;

one or more buffers;

positive or negative control samples;

excipients, stabilizers or preservatives.

In one embodiment of the invention, the one or more components for achieving diagnosis, treatment or prevention of a particular disease or body disorder are one or more additional therapeutic compounds or compositions, one or more diagnostic agents.

In one embodiment of the invention, the kit further comprises one or more of sterile water, physiological saline and PBS.

The invention also provides the application of the siRNA or the product in preparing a product for preventing, diagnosing and/or treating pathological conditions or diseases caused by FGL 1.

In one embodiment of the invention, the disease caused by FGL1 is cancer.

In one embodiment of the invention, the cancer is non-small cell lung cancer.

The technical scheme of the invention has the following advantages:

the invention provides siRNA for inhibiting FGL1, the sense strand of the siRNA is shown as SEQ ID NO.1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31 or 33, the antisense strand is shown as SEQ ID NO.2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32 or 34, and psiCHECK is adopted ^TM And 2, constructing a detection plasmid by the plasmid, and judging the targeting relation between the siRNA and the target gene fragment to obtain 17 siRNAs with high inhibition activity.

The present invention provides modified siRNAs for inhibiting FGL1, said modifications including methoxy, fluoro and phosphorothioate linkages, employing psiCHECK ^TM 2 constructing a detection plasmid and judging the targeting relationship between the modified siRNA obtained by chemically modifying the sense strand shown as SEQ ID NO.25, 27 and 29 and the antisense strand shown as SEQ ID NO.26, 28 and 30 and the target gene fragment, wherein 3 modified siRNAs have obvious dose-effect relationship and still have better FGL1 inhibition effect at the concentration of 0.1 nM; after coupling by GalNAc, it was verified in single-dose mice that the modified siRNA obtained by chemical modification of the sense strand shown as SEQ ID NO.25 and the antisense strand shown as SEQ ID NO.26 and by chemical modification of the sense strand shown as SEQ ID NO.27 and the antisense strand shown as SEQ ID NO.28 were used at a dose of 9mg/kg The modified siRNA obtained after chain chemical modification has very outstanding inhibition effect (inhibition ratio is more than 90%), and at a dose of 3mg/kg, the modified siRNA obtained after chain chemical modification by the sense strand shown as SEQ ID NO.27 and the antisense strand shown as SEQ ID NO.28 has very outstanding inhibition effect (inhibition ratio is more than 90%).

Drawings

Fig. 1: target activity of unmodified siRNAs (FGL 001UM to FGL009 UM) for inhibiting FGL 1.

Fig. 2: the target activity of unmodified siRNAs (FGL 010 UM-FGL 017 UM) for inhibiting FGL 1.

Fig. 3: modified siRNAs (RD 34FGL005, RD34FGL 012-RD 34FGL 017) for inhibiting FGL 1.

Fig. 4: single dose assay (9 mg/kg) qPCR assay of modified siRNA conjugates (RD 34FGL 013-RD 34FGL 015) for inhibiting FGL1 in mice.

Fig. 5: single dose assay (3 mg/kg) qPCR assay results for modified siRNA conjugates (RD 34FGL013 and RD34FGL 014) for inhibiting FGL1 in mice.

Detailed Description

The following examples are provided for a better understanding of the present invention and are not limited to the preferred embodiments described herein, but are not intended to limit the scope of the invention, any product which is the same or similar to the present invention, whether in light of the present teachings or in combination with other prior art features, falls within the scope of the present invention.

In the embodiments described in the following description of the embodiments, FGL1 mRNA is characterized by having GeneBank accession numbers NM-201553.1, NM-004467.4, NM-147203.2 mRNAs of the sequences shown in NM-201552.1, NM-145594.2, NM-172010.2 or XM-005562691.3. Further, unless otherwise indicated, the term "target gene" as used in the present disclosure refers to a gene that transcribes the above FGL1 mRNA, and the term "target mRNA" refers to the above FGL1 mRNA.

The following examples do not identify specific experimental procedures or conditions, which may be followed by procedures or conditions of conventional experimental procedures described in the literature in this field. The reagents or apparatus used were conventional reagent products commercially available without the manufacturer's knowledge.

Capital C, G, U, A in the examples below represents ribonucleotides; the lower case letter m indicates that the adjacent nucleotide to the left of the letter m is a methoxy modified nucleotide; the lower case letter f indicates that the adjacent nucleotide to the left of the letter f is a fluoro-modified nucleotide; the lower case letter s indicates that phosphorothioate group modifications are between two nucleotides adjacent to the letter s.

In the following examples, "modified nucleotide" means a nucleotide or nucleotide analogue in which the hydroxyl group at the 2' -position of the ribosyl group of the nucleotide is substituted with another group, or a nucleotide in which the base on the nucleotide is a modified base. "fluoro-modified nucleotide" refers to a nucleotide in which the hydroxyl group at the 2 '-position of the ribosyl group of the nucleotide is substituted with fluorine, and "non-fluoro-modified nucleotide" refers to a nucleotide or nucleotide analogue in which the hydroxyl group at the 2' -position of the ribosyl group of the nucleotide is substituted with a non-fluorine group. "nucleotide analog" refers to a group that is capable of replacing a nucleotide in a nucleic acid, but that differs in structure from adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine deoxyribonucleotide. Such as an iso-nucleotide, a bridged nucleotide (bridged nucleic acid, abbreviated as BNA) or an acyclic nucleotide. "methoxy modified nucleotide" refers to a nucleotide in which the 2' -hydroxy group of the ribosyl group is replaced with methoxy.

The terms "complementary" or "reverse complementary" in the examples below are used interchangeably and have the meaning well known to those skilled in the art, i.e., the bases of one strand pair with the bases on the other strand in a complementary fashion in a double-stranded nucleic acid molecule. In DNA, the purine base adenine (a) is always paired with the pyrimidine base thymine (T) (or uracil (U) in RNA); the purine base guanine (C) is always paired with the pyrimidine base cytosine (G). Each base pair includes a purine and a pyrimidine. When adenine on one strand always pairs with thymine (or uracil) on the other strand, and guanine always pairs with cytosine, the two strands are considered complementary to each other, and the sequence of the strand can be deduced from the sequence of its complementary strand.

In the following examples, particularly when describing the methods of preparing siRNA, pharmaceutical compositions or siRNA conjugates of the present disclosure, nucleoside monomers (nucleoside monomer) refer to modified or unmodified nucleoside phosphoramidite monomers (unmodified or modified RNA phosphoramidites, sometimes RNA phosphoramidites also referred to as Nucleoside phosphoramidites) used in phosphoramidite solid phase synthesis depending on the type and order of nucleotides in the siRNA or siRNA conjugate to be prepared, unless otherwise specified. Phosphoramidite solid phase synthesis is a method well known to those skilled in the art for use in RNA synthesis. Nucleoside monomers useful in the present disclosure are all commercially available.

"coupled" in the examples below means that two or more chemical moieties each having a specific function are covalently linked to each other; accordingly, "conjugate" refers to a compound formed by covalent linkage between the chemical moieties. Further, "siRNA conjugate" means a compound formed by covalently attaching one or more chemical moieties having specific functions to an siRNA. siRNA conjugates are understood to be, depending on the context, a generic term for multiple siRNA conjugates or an siRNA conjugate of a certain chemical formula. In the context of the present disclosure, a "coupling molecule" is understood to be a specific compound that can be coupled to an siRNA by reaction, ultimately forming an siRNA conjugate of the present disclosure.

"optional" or "optionally" in the following examples means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not. For example, "optionally substituted" alkyl "includes" alkyl "and" substituted alkyl "as defined below. Those skilled in the art will appreciate that for any group comprising one or more substituents, these groups are not intended to introduce any substitution or pattern of substitution that is sterically impractical, synthetically infeasible, and/or inherently unstable.

The following examples are used interchangeably herein to "treat," alleviate "or" ameliorate. These terms refer to methods of achieving a beneficial or desired result, including but not limited to therapeutic benefit. By "therapeutic benefit" is meant eradication or amelioration of the underlying disorder being treated. In addition, therapeutic benefit is obtained by eradicating or ameliorating one or more of the physiological symptoms associated with the underlying disorder such that an improvement is observed in the subject, although the subject may still be afflicted with the underlying disorder.

The following examples are used interchangeably to "prevent" and "prevent". These terms refer to methods of achieving a beneficial or desired result, including but not limited to prophylactic benefit. To obtain a "prophylactic benefit," the composition may be administered to a subject at risk of suffering from a particular disease, or to a subject reporting one or more pathological symptoms of the disease, even though a diagnosis of the disease may not have been made.

Unless otherwise indicated, reagents and media used in the examples below were commercially available, and the procedures for nucleic acid electrophoresis, real-time PCR, and the like used were carried out by the methods described in "molecular biology (fourth edition)" (Alexander, makrem (Alexander McLennan), et al, 2019).

The experimental cell referred to in the following examples was 293T, purchased from the department of Chinese sciences cell bank;

the experimental animals were C57BL/6J mice, female, purchased from Jiangsu Jiuyaokang biotechnology Co., ltd for 4-6 weeks, and all were kept in SPF-class animal houses of Suzhou Ji Ma Gene Co., ltd. Animals were allowed to ingest food and water freely for 12 hours of light-dark alternation in the day and night, and the experiments were started after 1 week of acclimation. The experimental animals used for research were used and operated in accordance with the requirements of the animal administration committee of the Suzhou Ji Ma gene, inc. on experimental animals and animal welfare.

The siRNA referred to in the following examples is an siRNA sequence synthesized by phosphoramidite solid phase synthesis.

The following examples relate to insertion sequences which were DNA sequences customized from Hongshan Biotech Co., ltd, in particular:

5'-TGGAAATTTTGTCCAAAAACATGGTGAATATTGGTGCACAATATAA GAATTTCAAAGTTGAATATTGGGGAATATTCTGGTTCTCTGAAATCTGTGGTTATGAAAATTAGGCCATTGTTTAAAGTGATTTGAAAAATTCCTGGGAAGTTCTACAATTCTAATTCAGTTTTGACCACTCAAGAAGACTACACTTTAAAAACAGAGGATGGAAAGACTATGAAAATGGCTTGGAGAAGAGATTTAGAATTATGTAGTCCGATGGAGGAGGATGGACTGTAATTCAGAGACGATCTGATGGCAAGAGGCAGTATGCAGATTGTTCAGAGATTTTCAATGATGG-3'(SEQ ID NO：35)。

for specific operations, reference is made to the instructions provided by the manufacturer, using Lipofectamine 2000 (purchased from Invitrogen) as a transfection reagent when transfecting cells with siRNA, siRNA conjugate directed against FGL1 gene or siRNA, siRNA conjugate as a negative control, referred to in the examples below. For qPCR assays HiScript III RT SuperMix for qPCR (available from Vazyme) was used as a reverse transcription reagent, for specific procedures reference to the manufacturer's instructions.

Unless otherwise indicated, the reagent ratios provided below are all calculated as volume ratios (v/v).

Example 1: siRNA for inhibiting FGL1

This example provides an siRNA for inhibiting FGL1, the nucleotide sequence of which was designed based on target mRNA, see table 1.

TABLE 1 nucleotide sequence of siRNA inhibiting FGL1

Experimental example 1: on-target activity detection of unmodified siRNAs for inhibiting FGL1

The experimental example provides an on-target activity detection experiment of unmodified siRNA for inhibiting FGL1, a plasmid vector is constructed by using a psiCHECK2 vector for detection, the psiCHECK2 vector is a plasmid vector, the variation of the expression of a target gene fused with a reporter gene can be monitored, the vector uses renilla luciferase as a main reporter gene, a target fragment is cloned to a multiple cloning site downstream of a renilla luciferase translation termination codon, and RNAi process aiming at the target gene is initiated by the synthesized siRNA, so that the shearing and subsequent degradation of fusion mRNA are caused; the target relationship between the siRNA and the target gene fragment can be judged by detecting the change of the luciferase activity of the Renilla, and the experimental process is as follows:

step one: construction of detection plasmid FGL1-psiCHECK2

By using psiCHECK ^TM -2(Promega ^TM ) Plasmid construction the test plasmid, which contains the sequence as shown in SEQ ID NO:35, which is spliced from a target sequence that is fully complementary to all nucleotide sequences of the antisense strand in the siRNA shown in table 1, and a single copy of the spliced sequence is cloned into psiCHECK ^TM -2 Xho I/Not I sites of the plasmid, resulting in the detection plasmid FGL1-psiCHECK2;

step two: cell culture and transfection

siRNA was added to a 96-well plate at an addition amount of 5. Mu.L per well, opti-MEM containing 20ng of FGL1-psiCHECK2 detection plasmid was added at an addition amount of 12.5. Mu.L per well, opti-MEM (Gibco) was added at an addition amount of 32.5. Mu.L per well, and Lipofectamine2000 (available from Invitrogen under the trade designation 11668-019) was added at an addition amount of 0.3. Mu.L per well, followed by incubation at room temperature (23 ℃) for 15 minutes to obtain a mixture. The mixture was added with an amount of 50. Mu.L per well containing 1X 10 ⁴ DMEM complete medium (available from Transgen Biotech under the trade designation FI 101-01) of the 293T cells was incubated at 37℃for 24h for the subsequent double luciferase assay. Single dose experiments were performed at final siRNA concentrations of 10nM or 1 nM.

Step three: dual luciferase assay

The 5 Xlysate in the double luciferase assay kit (from Promega, cat# E2940) was diluted to 1 Xlysate with water. Taking the cells obtained in the second culture step, discarding the supernatant, diluting and washing each well twice by using PBS buffer (purchased from Hyclone, product number SH 30256.01), and then adding 1 Xlysate into each cell plate in an addition amount of 50 mu L per well, and performing room temperature (23 ℃) pyrolysis for 20min to obtain a cell plate after pyrolysis; respectively sucking 30 mu L/hole lysate from the lysed cell plate, adding the lysate to an opaque 96-hole detection plate, taking a double-luciferase detection kit, preparing a substrate 1 and a substrate 2 according to the specification, respectively adding the substrate 1 and the substrate 2 to the opaque 96-hole detection plate according to the addition amount of 30 mu L of each hole, and detecting by a multifunctional enzyme-labeled instrument after each substrate addition to respectively obtain the numerical results of Firefly (Firefly) luciferase and Renilla (Renilla) luciferase.

Calculating the luminous ratio of each hole of the ELISA plate = Renilla/Firefly, wherein the luminous ratio of each test group or control group is the average value of the luminous ratios of three culture holes; and normalizing the luminescence ratio of each test group by taking the luminescence ratio of the control group as a reference to obtain a ratio R of the luminescence ratio (test)/the luminescence ratio (control), thereby representing the expression level, namely the relative residual activity, of the Renilla reporter gene. The inhibition rate of siRNA was (1-R). Times.100%.

The results of the on-target activities of 17 siRNAs are shown in Table 2, FIG. 1 and FIG. 2, and it is found that 17 siRNAs have high inhibitory activities.

TABLE 2 on-target Activity of siRNA

Example 2: modified siRNA for inhibiting FGL1

This example provides a modified siRNA for inhibiting FGL1 comprising RD34FGL005, RD34FGL012, RD34FGL013, RD34FGL014, RD34FGL015, RD34FGL016 and RD34FGL017.

The sense strand of RD34FGL005 is obtained by chemical modification of the sequence shown in SEQ ID NO.9, the 1 st and 2 nd, 2 nd and 3 RD nucleotides are connected by phosphorothioate groups according to the direction from the 5 'end to the 3' end, the 1 st, 2, 3, 4, 5, 6, 7, 8, 12, 13, 14, 15, 16, 17, 18, 19, 20 and 21 st nucleotides are methoxy modified nucleotides, the 9 th, 10 th and 11 th nucleotides are fluoro modified nucleotides, the antisense strand of RD34FGL005 is obtained by chemical modification of the sequence shown in SEQ ID NO.10, the 1 st and 2 nd, 2 nd and 3 RD, 21 st and 22 nd, 22 nd and 23 RD nucleotides are connected by phosphorothioate groups according to the direction from the 5 'end to the 3' end, the 1 st, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, 21, 22, 23 and 24 th nucleotides are methoxy modified nucleotides, and the 2 nd, 6, 14 and 16 th nucleotides are fluoro modified nucleotides; or alternatively, the first and second heat exchangers may be,

The sense strands of RD34FGL012, RD34FGL013, RD34FGL014, RD34FGL015, RD34FGL016 and RD34FGL017 are obtained by chemical modification of sequences selected from SEQ ID NO.23, SEQ ID NO.25, SEQ ID NO.27, SEQ ID NO.29, SEQ ID NO.31 and 33, respectively, the nucleotides at positions 1 and 2, 2 and 3 are linked by a phosphorothioate group in the direction from the 5 'end to the 3' end, the nucleotides at positions 1, 2, 3, 4, 5, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 are methoxy-modified nucleotides, the nucleotides at positions 7, 8, 9 are fluoro-modified nucleotides, the antisense strand of RD34FGL012, RD34FGL013, RD34FGL014, RD34FGL015, RD34FGL016 and RD34FGL017 is obtained by chemical modification of a sequence selected from the group consisting of SEQ ID NO.24, SEQ ID NO.26, SEQ ID NO.28, SEQ ID NO.30, SEQ ID NO.32 and SEQ ID NO.34, and the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, 20 and 21 are respectively methoxy-modified nucleotides and fluoro-modified nucleotides at positions 2, 6, 14 and 16 according to the direction from the 5 'end to the 3' end.

Experimental example 2: on-target activity detection of modified siRNAs for inhibiting FGL1

The present experimental example provides an on-target activity detection assay for modified siRNA that inhibits FGL1, retaining step one to step three on the basis of experimental example 1, replacing 17 sirnas described in example 1 in step two with 7 modified sirnas described in example 2: the sense strand of RD34FGL005 is obtained by chemical modification of the sequence shown in SEQ ID NO.9, and the antisense strand is obtained by chemical modification of the sequence shown in SEQ ID NO. 10; the sense strand of RD34FGL012 is obtained by chemical modification of the sequence shown in SEQ ID NO.23, and the antisense strand is obtained by chemical modification of the sequence shown in SEQ ID NO. 24; the sense strand of RD34FGL013 is obtained by chemical modification of the sequence shown in SEQ ID NO.25, and the antisense strand is obtained by chemical modification of the sequence shown in SEQ ID NO. 26; the sense strand of RD34FGL014 is obtained by chemical modification of the sequence shown in SEQ ID NO.27, and the antisense strand is obtained by chemical modification of the sequence shown in SEQ ID NO. 28; the sense strand of RD34FGL015 is obtained by chemical modification of the sequence shown in SEQ ID NO.29, and the antisense strand is obtained by chemical modification of the sequence shown in SEQ ID NO. 30; the sense strand of RD34FGL016 is obtained by chemical modification of the sequence shown in SEQ ID NO.31, and the antisense strand is obtained by chemical modification of the sequence shown in SEQ ID NO. 32; the sense strand of RD34FGL017 is obtained by chemical modification of the sequence shown in SEQ ID NO.33, and the antisense strand is obtained by chemical modification of the sequence shown in SEQ ID NO. 34.

The results of the target activities of the 7 modified siRNAs are shown in Table 3 and FIG. 3, and it is found that the modified siRNAs have high inhibitory activities, and that RD34FGL013, RD34FGL014 and RD34FGL015 still have good inhibitory effects at a concentration of 0.1 nM.

TABLE 3 on-target Activity of modified siRNAs

Experimental example 3: single dose assay of modified siRNA in mice (9 mg/kg)

The experimental example provides a single dose assay of modified siRNA in mice at a dose level of 9mg/kg, as follows:

the siRNA based on GalNAc conjugation technique was first reported to exert interfering activity in mice (Nair et al, j.am.chem.soc.,2014, 136, 16958-16961), the siRNA coupled to three galnacs was reported to exhibit good delivery activity both in vivo and in vitro experiments, and GalNAc-coupled RD34FGL to RD34FGL015 shown in example 2 were used with reference to the preparation methods in the above-mentioned documents to give GalNAc-coupled siRNA, and a single dose of GalNAc-coupled siRNA or saline control of 9mg/kg was subcutaneously administered in 4C 57BL/6J mice (females, 4-6 weeks old) per group, with the administration requirements shown in table 4.

Table 4.9mg/kg Single dose trial administration requirement

Experimental objects	Number of animals (Only)	Target gene	Dosage for administration	Frequency of administration
					Physiological saline	4			1
RD34FGL013G.2	4	FGL1	9mg/kg	1
					RD34FGL014G.2	4	FGL1	9mg/kg	1
RD34FGL015G.2	4	FGL1	9mg/kg	1

On day 7 post-application, mice were sacrificed, liver samples were collected and snap frozen in liquid nitrogen, liver mRNA was extracted and analyzed by RT-qPCR method, the detection procedure for RT-qPCR was as follows:

step one: RNA extraction:

1) Mouse liver tissue was taken at 20mg, 1mL Trizol Lysis Buffer (available from Life technology under the trade designation 410701) was added, and the lysed tissue was ground and the completely lysed mixture was transferred to a 1.5mL centrifuge tube of RNase-free; shaking vigorously for about 15s to fully lyse tissue cells, and standing at room temperature (23 ℃) for 5min;

2) The tube cap was carefully opened and 200. Mu.L of chloroform (available from Shanghai Lingfeng chemical Co., ltd., cat. No. 20140925) was added; shaking vigorously for 20s, and standing at room temperature (23 ℃) for 3min; centrifuging at 4deg.C for 20min at 12000 Xg;

3) After centrifugation, carefully taking out the centrifuge tube onto a centrifuge tube rack, sucking the supernatant into a new 2.0mL centrifuge tube, adding absolute ethyl alcohol (sold by Jiangsu Qiangsheng functional chemical Co., ltd., product number is 20210802) with 1.5 times of the volume of the supernatant, and mixing the materials reversely;

4) Taking a purification column (available from VWI company under the trade designation 11822AG 0627) with a collection tube, adding 700 μl of the mixture of step 3), and standing for 2min; centrifuging at 4deg.C and 10000 Xg for 1min, and discarding filtrate; repeating the steps of the rest mixed solution;

5) Adding 700 μL of 80% (v/v) ethanol into the purification column, centrifuging at 4deg.C and 10000 Xg for 1min, and discarding the filtrate;

6) Adding 700 μL of 80% (v/v) ethanol into the purification column, centrifuging at 4deg.C and 10000 Xg for 1min, and discarding the filtrate;

7) Centrifuging the purified column at 4deg.C and 10000 Xg for 2min;

8) After centrifugation, carefully taking out the purification column with the collection tube (if the collection tube contains liquid, the liquid is not splashed onto the purification column), discarding the collection tube, putting the purification column into a new 1.5mL centrifuge tube, adding 100 mu L DEPC water into the purification column, and standing at room temperature (23 ℃) for 2min; centrifuging at 4deg.C and 10000 Xg for 1min;

9) Collecting the RNA solution in the step 8) for subsequent experiments;

step two: RNA reverse transcription

Experimental procedures using HiScript III RT SuperMix for qPCR (available from Northenan company under the designation R323-01) were referred to the product specifications; preparing a reverse transcription reaction system of 20 mu L according to the reverse transcription operation steps in the instruction of the kit, and carrying out reverse transcription on total RNA of cells; the conditions for reverse transcription are: placing the reverse transcription reaction systems at 37 ℃ for incubation for 15min, then at 85 ℃ for incubation for 5s, and adding 80 mu L of DEPC water into each reverse transcription reaction system to obtain a solution containing cDNA;

step three: qPCR reaction system configuration

For each reverse transcription reaction system, 4. Mu.L of the cDNA-containing solution was used as a template, 20. Mu.L of a qPCR reaction system was prepared on an ice box according to Table 5 using a reagent provided by a AceQ Universal SYBR qPCR Master Mix kit (available from Vazyme under the product number Q511-02), wherein Primer1 and Primer2 are respectively PCR Primer sequences for amplifying the target gene FGL1 and the reference gene GAPDH (as shown in Table 6), each qPCR reaction system was placed on a ABIStepOnePlus Real-Time PCR instrument, amplification was performed by using a three-step method, the amplification procedure was a pre-denaturation at 95℃for 10min, then a denaturation at 95℃for 30s, an annealing at 60℃for 30s, and an extension at 72℃for 30s, and the denaturation, annealing and extension were repeated 40 times in total, to obtain a product W containing amplified target gene FGL1 and reference gene GAPDH; and then, sequentially incubating the product W at 95 ℃ for 15s, incubating the product W at 60 ℃ for 1min and incubating the product W at 95 ℃ for 15s, and respectively collecting dissolution curves of the target gene FGL1 and the reference gene GAPDH in the product W by a real-time fluorescence quantitative PCR instrument to obtain Ct values of the target gene FGL1 and the reference gene GAPDH.

TABLE 5 RNA amplification reaction System

Reagent name	Single pore volume (mu L)
		2×AceQ Universal SYBR qPCR Master Mix	10
Primer1(10μM)	0.4
		Primer2(10μM)	0.4
Template DNA/cDNA	4
		ddH ₂ O	5.2
Total volume of	20ul

TABLE 6 primer information

The comparative Ct (ΔΔct) method was used to perform relative quantitative calculation on the target gene FGL1 in each test group, as follows:

Delta Ct (test group) =ct (test group target gene) -Ct (test group reference gene)

Delta Ct (control) =ct (control target gene) -Ct (control reference gene)

ΔΔct (test group) =Δct (test group) - Δct (control group average)

ΔΔct (control) =Δct (control) - Δct (control average)

Wherein, Δct (control group average) is the arithmetic average of Δct (control group) of each of 4 samples of the control group; thus, each sample of the test and control groups corresponds to one ΔΔct value.

The expression level of FGL1mRNA in the test group was normalized based on the control group, and the expression level of FGL1mRNA in the control group was defined as 100%.

Test group FGL1mRNA relative expression level = 2 ^{-delta delta Ct @ test group} ×100％

FGL1mRNA levels were compared to the reference gene GAPDH, the values were normalized to the mean value of the saline control group, the data were expressed as a percentage relative to the saline control group and presented as mean value plus standard deviation, and the results are shown in fig. 4, which demonstrates that RD34FGL013 and RD34FGL014 showed greater than 90% inhibition at a dose of 9mg/kg in single-dose mice.

Experimental example 4: single dose assay of modified siRNA in mice (3 mg/kg)

The experimental example provides a single dose assay of modified siRNA in mice at a dose level of 3mg/kg, as follows:

according to the results of experimental example 3, galNAc-coupled siRNA or physiological saline control was subcutaneously administered at a single dose of 3mg/kg in five C57BL/6J mice (females, 4-6 weeks) using GalNAc-coupled RD34FGL013 and RD34FGL014 shown in example 2, the mice were sacrificed on day 7 after administration as shown in table 7, liver samples were collected and quick frozen in liquid nitrogen, and liver mRNA was extracted and analyzed by RT-qPCR method.

TABLE 7.3mg/kg Single dose trial administration requirement

According to fig. 5, it was verified that RD34FGL014 had a very prominent inhibitory effect with a greater than 90% inhibition rate at a dose of 3mg/kg in single-dose mice.

It is apparent that the above examples are given by way of illustration only and are not limiting of the embodiments. Other variations or modifications of the above teachings will be apparent to those of ordinary skill in the art. It is not necessary here nor is it exhaustive of all embodiments. While still being apparent from variations or modifications that may be made by those skilled in the art are within the scope of the invention.

Claims

1. siRNA for inhibiting FGL1, characterized in that it comprises a sense strand and an antisense strand, said sense strand being capable of being at least partially reverse-complementary to the antisense strand to form a double-stranded region,

wherein the sense strand comprises the nucleotide sequence shown as SEQ ID NO.27 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 28.

2. The siRNA of claim 1, wherein at least one nucleotide in the sense strand or the antisense strand of the siRNA is a modified nucleotide.

3. The siRNA of claim 2, wherein said modification is a chemical modification selected from one or more of methoxy modification, fluoro modification and phosphorothioate modification.

4. The siRNA of any of claims 2 to 3, wherein the fluoro-modified nucleotides are located in the antisense and sense strands of the nucleotide sequence, and wherein the nucleotides at least at positions 9, 10, 11 of the sense strand are fluoro-modified nucleotides and the nucleotides at least at positions 2, 6, 14, 16 of the antisense strand are fluoro-modified nucleotides in the 5 'to 3' end direction; or alternatively, the first and second heat exchangers may be,

the fluoro-modified nucleotides are located in the antisense strand and the sense strand of the nucleotide sequence, and at least nucleotides at positions 7, 8 and 9 of the sense strand are fluoro-modified nucleotides, and at least nucleotides at positions 2, 6, 14 and 16 of the antisense strand are fluoro-modified nucleotides in the direction from the 5 'end to the 3' end.

5. The siRNA of any one of claims 2 to 3, wherein methoxy-modified nucleotides are located in the antisense and sense strands of the nucleotide sequence, and wherein at least nucleotides at positions 1, 2, 3, 4, 5, 6, 7, 8, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 of the sense strand are methoxy-modified nucleotides in the 5 'to 3' end direction, and at least nucleotides at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, 21, 22, 23, 24 of the antisense strand are methoxy-modified nucleotides; or alternatively, the first and second heat exchangers may be,

the methoxy modified nucleotides are located in the antisense strand and the sense strand of the nucleotide sequence, and at least nucleotides at positions 1, 2, 3, 4, 5, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 of the sense strand are methoxy modified nucleotides, and at least nucleotides at positions 1, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, 21 of the antisense strand are methoxy modified nucleotides in a 5 'to 3' end direction.

6. The siRNA of any of claims 2 to 3, wherein said phosphorothioate linked nucleotides are located in the antisense and sense strands of the nucleotide sequence and, in the 5 'to 3' end direction, at least between nucleotides 1 and 2, 2 and 3 of the sense strand are linked by phosphorothioate groups and at least between nucleotides 1 and 2, 2 and 3, 21 and 22, 22 and 23 of the antisense strand are linked by phosphorothioate groups; or alternatively, the first and second heat exchangers may be,

The phosphorothioate-linked nucleotides are located in the antisense strand and the sense strand of the nucleotide sequence, and at least between the 1 st and 2 nd, 2 nd and 3 rd nucleotides of the sense strand are linked by phosphorothioate groups according to the direction from the 5 'end to the 3' end, and at least between the 1 st and 2 nd, 2 nd and 3 rd, 19 th and 20 th, 20 th and 21 st nucleotides of the antisense strand are linked by phosphorothioate groups.

7. The siRNA of claim 6, wherein a ligand is coupled to the 3' end of the sense strand of said siRNA, said ligand being GalNAc.

8. A product for inhibiting FGL1, comprising an active ingredient and a pharmaceutically acceptable carrier, wherein the active ingredient is the siRNA of any one of claims 1 to 7.

9. The product of claim 8, wherein the product is a pharmaceutical composition or a kit.