CN117264954A - Double-stranded ribonucleic acid for inhibiting HMGB1 gene expression, and modification, conjugate and application thereof - Google Patents

Double-stranded ribonucleic acid for inhibiting HMGB1 gene expression, and modification, conjugate and application thereof Download PDF

Info

Publication number
CN117264954A
CN117264954A CN202311206215.4A CN202311206215A CN117264954A CN 117264954 A CN117264954 A CN 117264954A CN 202311206215 A CN202311206215 A CN 202311206215A CN 117264954 A CN117264954 A CN 117264954A
Authority
CN
China
Prior art keywords
seq
nucleotide sequence
strand comprises
antisense strand
sense strand
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202311206215.4A
Other languages
Chinese (zh)
Inventor
王岩
黄河
王书成
林国良
产运霞
耿玉先
汪小君
荣梅
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing Fuyuan Pharmaceutical Co ltd
Original Assignee
Beijing Fuyuan Pharmaceutical Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing Fuyuan Pharmaceutical Co ltd filed Critical Beijing Fuyuan Pharmaceutical Co ltd
Publication of CN117264954A publication Critical patent/CN117264954A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1136—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against growth factors, growth regulators, cytokines, lymphokines or hormones
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/549—Sugars, nucleosides, nucleotides or nucleic acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/02—Antineoplastic agents specific for leukemia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.

Abstract

The present disclosure relates to double-stranded ribonucleic acids and modifications, conjugates, and uses thereof for inhibiting HMGB1 gene expression. In particular, the present disclosure relates to a double-stranded ribonucleic acid, double-stranded ribonucleic acid modification, double-stranded ribonucleic acid conjugate, pharmaceutical composition and use for inhibiting HMGB1 gene expression, and a method for inhibiting intracellular HMGB1 gene expression. The double-stranded ribonucleic acid provided by the disclosure can be combined in cells to form an RNA-induced silencing complex (RISC), cut mRNA transcribed by the HMGB1 gene, efficiently and specifically inhibit the expression of the HMGB1 gene, is used for treating HMGB1 gene-mediated diseases, and has important application prospects in clinical disease treatment.

Description

Double-stranded ribonucleic acid for inhibiting HMGB1 gene expression, and modification, conjugate and application thereof
Technical Field
The present disclosure is in the field of biological medicine, and in particular, relates to a double-stranded ribonucleic acid, a double-stranded ribonucleic acid modification, a double-stranded ribonucleic acid conjugate, a pharmaceutical composition and use for inhibiting HMGB1 gene expression, and a method for inhibiting intracellular HMGB1 gene expression.
Background
High -mobility group protein-l (high mobility group box-1, hmgb1) is a highly conserved nucleoprotein, widely distributed in mammalian cells. In recent years, research has found that activated mononuclear macrophages or necrotic cells and the like can release a large amount of HMGB1 in the infection and inflammation processes, and can induce and generate pro-inflammatory factors such as TNF-alpha, IL-6 and the like through receptors such as TLR4 and the like. In NASH disease, insulin resistance increases the concentration of free fatty acids in the blood and causes massive lipid deposition at the liver site, so that liver macrophages are damaged, which release massive amounts of HMGB1 and other cytokines and chemokines. In addition, cytokines and chemokines released by liver macrophages recruit and activate a large number of bone marrow-derived macrophages into the liver, which release more HMGB1 and chemokines and recruit more macrophages into the liver, forming a vicious circle. Activated macrophages not only release cytokines that promote disease progression, but their surfaces also express markers of macrophage activation, such as CD163 and mannose receptors. As an important inflammatory factor, HMGB1 is involved in advanced inflammatory reactions of various diseases such as sepsis, arthritis, colitis, acute lung injury and the like, and HMGBl plays an important role in the evolution process of tumors (such as colorectal cancer, gastric cancer, myelodysplastic syndrome, acute myeloid leukemia, chronic myelogenous leukemia, acute lymphoblastic leukemia, lymphoma, multiple myeloma and the like), and in the evolution process of malignant tumors, HMGBl can play a role in chemotactic factors, increase cell movement, induce tumor angiogenesis and other mechanisms, finally lead to malignant transformation and uncontrollable growth of tumors, and promote tumor progression by inhibiting apoptosis, activating proliferation signals, promoting extracellular matrix degradation.
The present invention aims to provide double-stranded ribonucleic acid, double-stranded ribonucleic acid modification, double-stranded ribonucleic acid conjugate, pharmaceutical composition and use for inhibiting HMGB1 gene expression, and a method for inhibiting intracellular HMGB1 gene expression, capable of affecting RNA-induced silencing complex (RISC) -mediated cleavage of RNA transcript of HMGB1 gene, whereby expression of HMGB1 gene can be inhibited, enabling treatment of liver and gall diseases such as nonalcoholic steatohepatitis (NASH hepatitis); sepsis; arthritis; colitis; acute lung injury; and colorectal cancer, gastric cancer, myelodysplastic syndrome, acute myeloid leukemia, chronic myelogenous leukemia, acute lymphocytic leukemia, lymphoma, multiple myeloma, and atherosclerosis.
Disclosure of Invention
Problems to be solved by the invention
In view of the problems of the prior art, for example, there is a need to develop more HMGB1 inhibitors for the treatment of HMGB1 related diseases including non-alcoholic steatohepatitis, sepsis, arthritis, colitis, acute lung injury, colorectal cancer, gastric cancer, myelodysplastic syndrome, acute myeloid leukemia, chronic myelogenous leukemia, acute lymphoblastic leukemia, lymphoma, multiple myeloma, atherosclerosis and the like. The present disclosure aims to provide a series of double-stranded ribonucleic acid, double-stranded ribonucleic acid modifier, double-stranded ribonucleic acid conjugate and pharmaceutical composition for inhibiting HMGB1 gene expression, which can inhibit HMGB1 gene expression, and has important application prospects in clinical disease treatment.
Solution for solving the problem
[1] A double-stranded ribonucleic acid comprising a sense strand and an antisense strand, the sense strand being complementary to and/or substantially reverse complementary to the antisense strand to form a double-stranded region of the double-stranded ribonucleic acid;
wherein the sense strand comprises a sequence a that differs by no more than 3 nucleotides from at least 15 consecutive nucleotides in the target sequence, and the antisense strand comprises a sequence B that differs by no more than 3 nucleotides from the reverse complement of at least 15 consecutive nucleotides in the target sequence;
the target sequence is selected from nucleotide sequences shown in any one of SEQ ID NO 1-16 and SEQ ID NO 560-567.
[2] The double-stranded ribonucleic acid according to [1], wherein the target sequence is selected from the nucleotide sequences shown in any one of SEQ ID NOS.17 to 68, SEQ ID NO 560, and SEQ ID NOS.562 to 569, the sense strand comprises a sequence A consisting of at least 15 consecutive nucleotides in the nucleotide sequences shown in any one of SEQ ID NOS.17 to 68, SEQ ID NO 560, and SEQ ID NO 562 to 569, and the antisense strand comprises a sequence B which is reverse complementary to a sequence consisting of at least 15 consecutive nucleotides in the nucleotide sequences shown in any one of SEQ ID NOS.17 to 68, SEQ ID NO 560, and SEQ ID NO 562 to 569.
[3] The double-stranded ribonucleic acid according to [1] or [2], wherein the sense strand consists of 15 to 28 nucleotides, preferably 19 to 25 nucleotides, more preferably 19 to 23 nucleotides, more preferably 19, 21 or 23 nucleotides.
[4] The double-stranded ribonucleic acid according to [3], wherein the nucleotide sequence of the sense strand differs by not more than 1 nucleotide in sequence A, preferably 19 to 25 consecutive nucleotides, more preferably 19 to 23 consecutive nucleotides, more preferably 19, 21 or 23 nucleotides from a sequence consisting of 15 to 28 consecutive nucleotides in the nucleotide sequences shown in any one of SEQ ID NOS: 17 to 68, SEQ ID NO:560, SEQ ID NOS: 562 to 569.
[5] The double-stranded ribonucleic acid according to any one of [1] to [4], wherein the antisense strand consists of 15 to 28 nucleotides, preferably 19 to 25 nucleotides, more preferably 19 to 23 nucleotides, more preferably 19, 21 or 23 nucleotides.
[6] The double-stranded ribonucleic acid according to [5], wherein the nucleotide sequence of the antisense strand is a sequence B differing by not more than 1 nucleotide, preferably 19 to 25 consecutive nucleotides, more preferably 19 to 23 consecutive nucleotides, still more preferably 19, 21 or 23 nucleotides, from the reverse complement of a sequence consisting of 15 to 28 consecutive nucleotides in the nucleotide sequences shown in any one of SEQ ID NOS: 17 to 68, SEQ ID NO:560, SEQ ID NOS: 562 to 569.
[7] The double-stranded ribonucleic acid according to any one of [1] to [6], wherein the double-stranded region is 15 to 25 nucleotides in length, preferably 19 to 23 nucleotides, more preferably 19 to 21 nucleotides, more preferably 19, 21 or 23 nucleotides.
[8] The double-stranded ribonucleic acid according to any one of [1] to [7], wherein,
the sense strand is complementary to the antisense strand to form the double-stranded region, and the 3 'end of the sense strand has 1-2 protruding nucleotides extending out of the double-stranded region, the 3' end of the antisense strand forming a blunt end; or,
the sense strand is complementary to the antisense strand to form the double-stranded region, and the 3 'end of the antisense strand has 1-2 protruding nucleotides extending out of the double-stranded region, the 3' end of the sense strand forming a blunt end; or,
the sense strand and the antisense strand are complementary to form the double-stranded region, and the 3' -ends of the sense strand and the antisense strand each have 1-2 protruding nucleotides extending out of the double-stranded region; or,
the sense strand is complementary to the antisense strand to form the double-stranded region, and the sense strand and the 3' -end of the antisense strand each form a blunt end.
[9] The double-stranded ribonucleic acid of any one of [1] to [8], wherein the sense strand and the antisense strand are selected from the following combinations:
1) The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 69 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 179;
2) The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 70, and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 180;
3) The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 71 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 181;
4) The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 72 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 182;
5) The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 73 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 183;
6) The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 74 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 184;
7) The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 75 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 185;
8) The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 76 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 186;
9) The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 77 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 187;
10 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 78 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 188;
11 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 79 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 189;
12 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 80 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 190;
13 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 81 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 191;
14 The sense strand comprises the nucleotide sequence set forth in SEQ ID NO. 82 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO. 192;
15 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 83 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 193;
16 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 84 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 194;
17 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 85 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 195;
18 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 86 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 196;
19 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 87 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 197;
20 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 88 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 198;
21 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 89, and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 199;
22 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 90, and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 200;
23 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 91 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 201;
24 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 92, and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 202;
25 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 93 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 203;
26 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 94 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 204;
27 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 95 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 205;
28 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 96 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 206;
29 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 97 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 207;
30 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 98 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 208;
31 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 99 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 209;
32 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 100 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 210;
33 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 101 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 211;
34 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 102 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 212;
35 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 103 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 213;
36 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 104 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 214;
37 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 105 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 215;
38 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 106 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 216;
39 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 107 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 217;
40 The sense strand comprises the nucleotide sequence set forth in SEQ ID NO. 108 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO. 218;
41 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 109 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 219;
42 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 110 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 220;
43 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 111, and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 221;
44 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 112 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 222;
45 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 113 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 223;
46 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 114 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 224;
47 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 115 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 225;
48 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 116, and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 226;
49 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 117 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 227;
50 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 118 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 228;
51 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 119 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 229;
52 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 120 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 230;
53 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 121 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 231;
54 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 122 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 232;
55 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 123 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 233;
56 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 124 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 234;
57 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 125 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 235;
58 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 126 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 236;
59 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 127 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 237;
60 The sense strand comprises the nucleotide sequence set forth in SEQ ID NO. 128 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO. 238;
61 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 129 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 239;
62 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 130 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 240;
63 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 131, and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 241;
64 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 132 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 242;
65 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 133 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 243;
66 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 134 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 244;
67 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 135 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 245;
68 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 136 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 246;
69 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 137 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 247;
70 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 138 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 248;
71 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 139 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 249;
72 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 140 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 250;
73 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 141 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 251;
74 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 142 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 252;
75 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 143 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 253;
76 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 144 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 254;
77 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 145 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 255;
78 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 146 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 256;
79 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 147 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 257;
80 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 148 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 258;
81 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 149 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 259;
82 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 150 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 260;
83 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 151 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 261;
84 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 152 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 262;
85 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 153 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 263;
86 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 154 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 264;
87 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 155 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 265;
88 The sense strand comprises the nucleotide sequence set forth in SEQ ID NO. 156 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO. 266;
89 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 157 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 267;
90 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 158 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 268;
91 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 159 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 269;
92 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 160 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 270;
93 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 161 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 271;
94 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 162 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 272;
95 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 163 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 273;
96 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 164 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 274;
97 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 165 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 275;
98 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 166 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 276;
99 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 167 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 277;
100 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 168 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 278;
101 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 169 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 279;
102 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 170 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 280;
103 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 171 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 281;
104 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 172 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 282;
105 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 173 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 283;
106 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 174 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 284;
107 The sense strand comprises the nucleotide sequence set forth in SEQ ID NO. 175 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO. 285;
108 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 176 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 286;
109 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 177 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 287;
110 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 178 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 288;
111 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO:289 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 299;
112 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 290 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 300;
113 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 291, and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 301;
114 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 292, and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 302;
115 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 293 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 303;
116 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 294 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 304;
117 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 295 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 305;
118 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 296 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 306;
119 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 297 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 307;
120 The sense strand comprises the nucleotide sequence set forth in SEQ ID NO. 298 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO. 308;
167 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 376 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 412;
168 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 377 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 413;
169 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 378 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 414;
170 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 379 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 415;
171 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 380 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 416;
172 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 381 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 417;
173 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 382 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 418;
174 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 383 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 419;
175 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 384 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 420;
176 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 385 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 421;
177 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 386 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 422;
178 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 387 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 423;
179 The sense strand comprises the nucleotide sequence set forth in SEQ ID NO. 388 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO. 424;
180 The sense strand comprises the nucleotide sequence shown as SEQ ID NO:389 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO: 425;
181 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 390 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 426;
182 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 391 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 427;
183 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 392 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 428;
184 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 393 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 429;
185 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 394 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 430;
186 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 395 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 431;
187 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 396 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 432;
188 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 397 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 433;
189 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 398 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 434;
190 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 399 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 435;
191 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 400 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 436;
192 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 401 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 437;
193 The sense strand comprises the nucleotide sequence set forth in SEQ ID NO. 402 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO. 438;
194 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 403 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 439;
195 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 404 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 440;
196 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 405 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 441;
197 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 406 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 442;
198 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 407 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 443;
199 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 408 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 444;
200 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 409 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 445;
201 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 410 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 446;
202 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 411 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 447;
318 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 570 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 603;
319 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 571 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 604;
320 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 572 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 605;
321 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 573 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 606;
322 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 574 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 607;
323 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 575 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 608;
324 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 576 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 609;
325 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 577 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 610;
326 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 578 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 611;
327 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 579 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 612;
328 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 580 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 613;
329 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 581 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 614;
330 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 582 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 615;
331 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 583 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 616;
332 584, and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 617;
333 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 585 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 618;
334 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 586 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 619;
335 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 587 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 620;
336 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 588 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 621;
337 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 589 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 622;
338 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 590 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 623;
339 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 591 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 624;
340 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 592 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 625;
341 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 593 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 626;
342 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 594 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 627;
343 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 595 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 628;
344 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 596 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 629;
345 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 597 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 630;
346 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 598 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 631;
347 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 599 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 632;
348 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 600 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 633;
349 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 601 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 634;
350 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 602 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 635;
preferably, the sense strand and the antisense strand are selected from the following combinations:
7) The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 75 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 185;
30 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 98 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 208;
39 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 107 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 217;
49 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 117 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 227;
55 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 123 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 233;
62 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 130 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 240;
168 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 377 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 413;
169 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 378 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 414;
170 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 379 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 415;
198 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 407 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 443.
[10] The double-stranded ribonucleic acid according to any one of [1] to [9], wherein each nucleotide in the sense strand is a modified nucleotide or an unmodified nucleotide independently of each other and/or each nucleotide in the antisense strand is a modified nucleotide or an unmodified nucleotide independently of each other.
[11] The double-stranded ribonucleic acid according to any one of [1] to [10], wherein two arbitrarily linked nucleotides in the sense strand are linked by a phosphodiester bond or a phosphorothioate bond, and/or two arbitrarily linked nucleotides in the antisense strand are linked by a phosphodiester bond or a phosphorothioate diester bond.
[12] The double-stranded ribonucleic acid according to any one of [1] to [11], wherein the 5 '-terminal nucleotide of the sense strand is linked to a 5' -phosphate group or a 5 '-phosphate derivative group, and/or the 5' -terminal nucleotide of the antisense strand is linked to a 5 '-phosphate group or a 5' -phosphate derivative group.
[13] The double-stranded ribonucleic acid according to any one of [1] to [12], wherein the double-stranded ribonucleic acid is an siRNA.
[14] The double-stranded ribonucleic acid according to any one of [1] to [13], wherein the double-stranded ribonucleic acid is an siRNA for inhibiting expression of HMGB1 gene.
[15] A double-stranded ribonucleic acid modification according to any one of [1] to [14], comprising a chemical modification of at least one of:
(1) Modification of at least one nucleotide in the sense strand,
(2) Modification of the phosphodiester bond in at least one position in the sense strand,
(3) Modification of at least one nucleotide in the antisense strand,
(4) Modification of the phosphodiester bond at least one position in the antisense strand;
optionally, the 3' -end of sequence A in the sense strand of the double-stranded ribonucleic acid is linked to a sequence D consisting of 1-2 nucleotides, preferably 1-2 thymine deoxyribonucleotides; and/or, the 3' -end of the sequence B in the antisense strand of the double-stranded ribonucleic acid is connected with a sequence E consisting of 1-2 nucleotides, preferably a sequence E consisting of 1-2 thymine deoxyribonucleotides; and/or, the 3 '-end of the sequence A in the sense strand of the double-stranded ribonucleic acid excludes 1-2 nucleotides to form a sequence A';
alternatively, the sense strand and the antisense strand of the double-stranded ribonucleic acid modification are selected from the following sequence combinations:
the nucleotide sequence of the sense strand is a sequence shown in a sequence A, and the nucleotide sequence of the antisense strand is a sequence shown in a sequence B;
or the nucleotide sequence of the sense strand is a sequence shown in a sequence A, and the nucleotide sequence of the antisense strand is a sequence shown in a sequence B and a connecting sequence E;
or the nucleotide sequence of the sense strand is a sequence shown in a sequence A and a connecting sequence D, and the nucleotide sequence of the antisense strand is a sequence shown in a sequence B;
Or the nucleotide sequence of the sense strand is a sequence shown in a sequence A connected with a sequence D, and the nucleotide sequence of the antisense strand is a sequence shown in a sequence B connected with a sequence E;
alternatively, the nucleotide sequence of the sense strand is the sequence shown in the sequence A', and the nucleotide sequence of the antisense strand is the sequence shown in the sequence B;
alternatively, the nucleotide sequence of the sense strand is the sequence shown in the sequence A', and the nucleotide sequence of the antisense strand is the sequence shown in the sequence B and the connecting sequence E.
[16] The double-stranded ribonucleic acid modification of [15], wherein the modification of the nucleotide is selected from the group consisting of 2 '-fluoro modification, 2' -alkoxy modification, 2 '-substituted alkoxy modification, 2' -alkyl modification, 2 '-substituted alkyl modification, 2' -deoxy modification, nucleotide derivative modification, and a combination of any two or more thereof.
[17]According to [15]]Or [16]]The double-stranded ribonucleic acid modifier, wherein the nucleotide modification is selected from the group consisting of 2'-F modification, 2' -O-CH modification 3 Modification, 2' -O-CH 2 -CH 2 -O-CH 3 Modification, 2' -O-CH 2 -CH＝CH 2 Modification, 2' -CH 2 -CH 2 -CH＝CH 2 Modification, 2' -deoxy modification, nucleotide derivative modification, or a combination of any two or more thereof.
[18] The double-stranded ribonucleic acid modification of [16] or [17], wherein the nucleotide derivative in the nucleotide derivative modification is selected from the group consisting of an isocucleotide, LNA, ENA, cET, UNA and GNA.
[19]According to [15]]-[18]The double-stranded ribonucleic acid modification of any one of, wherein the ribonucleotides at positions 7, 9, 10 and 11 in the sense strand are 2'-F modified ribonucleotides in the direction from the 5' terminus to the 3 'terminus, and the ribonucleotides at the remaining positions in the sense strand are 2' -O-CH 3 Modified ribonucleotides.
[20] The double-stranded ribonucleic acid modification of any one of [15] to [19], wherein the sense strand comprises a phosphorothioate linkage at the position shown below in the 5 '-terminal to 3' -terminal direction:
between nucleotide 1 and nucleotide 2 from the 5' end of the sense strand;
between nucleotide 2 and nucleotide 3 from the 5' end of the sense strand;
between nucleotide 1 and nucleotide 2 from the 3' end of the sense strand;
between nucleotide 2 and nucleotide 3 from the 3' end of the sense strand;
or,
the sense strand comprises phosphorothioate linkages at the positions shown below:
between nucleotide 1 and nucleotide 2 from the 5' end of the sense strand;
between nucleotide 2 and nucleotide 3, starting at the 5' end of the sense strand.
[21]According to [15 ]]-[20]The double-stranded ribonucleic acid modification of any one of the above, wherein the ribonucleotide at any odd number position in the antisense strand in the direction from the 5' -end to the 3' -end is 2' -O-CH 3 A modified ribonucleotide, said ribonucleotide at any even numbered position in the antisense strand being a 2' -F modified ribonucleotide;
alternatively, the ribonucleotides at positions 2, 6, 14 and 16 in the antisense strand are 2' -F modified ribonuclei in the direction from the 5' end to the 3' endA ribonucleotide, the ribonucleotide at the remaining position in the antisense strand being 2' -O-CH 3 Modified ribonucleotides;
alternatively, the ribonucleotides at positions 2, 6, 8, 9, 14 and 16 in the antisense strand are 2'-F modified ribonucleotides in the direction from the 5' end to the 3 'end, and the ribonucleotides at the remaining positions in the antisense strand are 2' -O-CH 3 Modified ribonucleotides;
alternatively, the ribonucleotides at positions 2, 14 and 16 in the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 6 in the antisense strand is a nucleotide derivative GNA modified ribonucleotide, and the ribonucleotides at the rest positions in the antisense strand are 2' -O-CH 3 Modified ribonucleotides;
alternatively, in the direction from the 5 '-end to the 3' -end, the ribonucleotides at positions 2, 6, 14 and 16 in the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 7 in the antisense strand is a nucleotide derivative GNA modified ribonucleotide, and the ribonucleotides at the rest positions in the antisense strand are 2' -O-CH 3 Modified ribonucleotides.
[22] The double-stranded ribonucleic acid modification of any one of [15] to [21], wherein a nucleotide at the 5' -end of the antisense strand is linked to a 5' -phosphate group or a 5' -phosphate derivative group in a direction from the 5' -end to the 3' -end.
[23] The double-stranded ribonucleic acid modification of any one of [15] to [22], wherein the antisense strand comprises a phosphorothioate diester linkage at the positions shown below:
between nucleotide 1 and nucleotide 2 from the 5' end of the antisense strand;
between nucleotide 2 and nucleotide 3 from the 5' end of the antisense strand;
between nucleotide 1 and nucleotide 2 from the 3' end of the antisense strand;
the antisense strand is between nucleotide 2 and nucleotide 3 from the 3' terminus.
[24]According to [15 ]]-[23]The double-stranded ribonucleic acid modification of any one of, wherein the sense strand of the double-stranded ribonucleic acid modification has a nucleotide sequence as set forth in (a) 1 )-(a 5 ) The structure shown in any one of:
(a 1 )5’-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’，
(a 2 )5’-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’，
(a 3 )5’-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’，
(a 4 )5’-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3’，
(a 5 )5’-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -3’；
wherein N is 1 -N 23 Independently of one another, from ribonucleotides of base A, U, C or G,
the capital letter T denotes a deoxyribonucleotide with the base thymine,
the lower case letter m indicates that one ribonucleotide adjacent to the right side of the letter m is 2' -O-CH 3 The modified ribonucleotides are used as the amino acids,
the lower case letter F indicates that the adjacent ribonucleotide to the left of the letter F is a 2' -F modified ribonucleotide,
-(s) -means that two nucleotides adjacent to each other are linked by a phosphorothioate linkage.
[25]According to [15 ]]-[24]The double-stranded ribonucleic acid modification of any one of, wherein the antisense strand of the double-stranded ribonucleic acid modification has a nucleotide sequence as shown in (b) 1 )-(b 15 ) The structure shown in any one of:
(b 1 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -N 4 f-mN 5 -N 6 f-mN 7 -N 8 f-mN 9 -N 10 f-mN 11 -N 12 f-mN 13 -N 14 f-m N 15 -N 16 f-mN 17 -N 18 f-mN 19 -(s)-T-(s)-T-3’，
(b 2 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -N 4 f-mN 5 -N 6 f-mN 7 -N 8 f-mN 9 -N 10 f-mN 11 -N 12 f-mN 13 -N 14 f-m N 15 -N 16 f-mN 17 -N 18 f-mN 19 -(s)-N 20 f-(s)-mN 21 -3’，
(b 3 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -N 4 f-mN 5 -N 6 f-mN 7 -N 8 f-mN 9 -N 10 f-mN 11 -N 12 f-mN 13 -N 14 f-m N 15 -N 16 f-mN 17 -N 18 f-mN 19 -N 20 f-mN 21 -(s)-N 22 f-(s)-mN 23 -3’，
(b 4 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’，
(b 5 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’，
(b 6 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’，
(b 7 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -N 8 f-N 9 f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’，
(b 8 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -N 8 f-N 9 f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’，
(b 9 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -N 8 f-N 9 f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’，
(b 10 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -[GNA]N 6 -mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’，
(b 11 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -[GNA]N 6 -mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’，
(b 12 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -[GNA]N 6 -mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’，
(b 13 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-[GNA]N 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -m N 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’，
(b 14 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-[GNA]N 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -m N 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’，
(b 15 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-[GNA]N 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -m N 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’，
wherein N is 1 -N 23 Independently of one another, from ribonucleotides of base A, U, C or G,
the capital letter T denotes a deoxyribonucleotide with the base thymine,
the lower case letter m indicates that one ribonucleotide adjacent to the right side of the letter m is 2' -O-CH 3 The modified ribonucleotides are used as the amino acids,
the lower case letter F indicates that the adjacent ribonucleotide to the left of the letter F is a 2' -F modified ribonucleotide,
P1 represents that one nucleotide adjacent to the right side of the letter is a nucleotide 5' -phosphate,
-(s) -means that two nucleotides adjacent to each other are linked by phosphorothioate linkages,
[ GNA ] means that one of the ribonucleotides adjacent to the right thereof is a ribonucleotide in which GNA modification is present.
[26] The double-stranded ribonucleic acid modification according to any one of [15] to [25], wherein the double-stranded ribonucleic acid modification is an siRNA modification.
[27] The double-stranded ribonucleic acid modification according to any one of [15] to [26], wherein the double-stranded ribonucleic acid modification is an siRNA modification for inhibiting expression of HMGB1 gene.
[28] The double-stranded ribonucleic acid modification of any one of [15] to [27], wherein the sense strand and the antisense strand are selected from the following combinations:
121 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 309 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 343;
122 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 310 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 343;
123 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 311 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 344;
124 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 312 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 345;
125 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 313 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 345;
126 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 314 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 346;
127 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 315 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 347;
128 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 316 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 347;
129 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 317 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 348;
130 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 318 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 349;
131 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 319 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 349;
132 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 320 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 350;
133 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 321 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 350;
134 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 322 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 351;
135 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 323 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 351;
136 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 324 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 352;
137 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 325 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 353;
138 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 326 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 353;
139 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO:327 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 354;
140 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 328 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 355;
141 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 329 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 356;
142 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 330 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 356;
143 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 331 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 357;
144 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 332 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 358;
145 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 333 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 358;
146 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 334 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 359;
147 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 335 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 359;
148 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 336 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 360;
149 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 337 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 360;
150 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 338 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 361;
151 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 339 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 361;
152 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 340 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 362;
153 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 341 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 363;
154 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 342 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 363;
203 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 448 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 471;
204 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 449 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 472;
205 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 449 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 473;
206 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 449 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 474;
207 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 450 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 475;
208 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 450 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 476;
209 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 450 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 477;
210 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 450 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 478;
211 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 451 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 479;
212 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 451 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 480;
213 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 451 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 481;
214 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 451 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 482;
215 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 452 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 483;
216 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 452 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 484;
217 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 453 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 485;
218 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 453 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 486;
219 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 309 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 487;
220 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 310 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 487;
221 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 309 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 488;
222 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 309 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 489;
223 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 309 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 490;
224 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 454 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 491;
225 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 454 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 492;
226 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 455 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 493;
227 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 455 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 494;
228 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 456 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 495;
229 The sense strand comprises the nucleotide sequence set forth in SEQ ID NO. 456 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO. 496;
230 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 457 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 497;
231 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 457 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 498;
232 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 458 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 499;
233 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 458 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 500;
234 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO:459 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO: 501;
235 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 459 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 502;
236 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 460 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 503;
237 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 460 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 504;
238 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 461 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 505;
239 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 461 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 506;
240 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 462 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 507;
241 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 462 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 508;
242 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 463 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 509;
243 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 463 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 510;
244 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 464 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 511;
245 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 464 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 512;
246 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 465 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 513;
247 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 465 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 514;
248 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 466 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 515;
249 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 466 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 516;
250 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 318 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 517;
251 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO:319 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO: 517;
252 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 318 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 518;
253 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 318 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 519;
254 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 318 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 520;
255 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 467 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 521;
256 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 467 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 522;
257 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 468 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 523;
258 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 468 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 524;
259 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 469 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 525;
260 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 469 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 526;
261 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 320 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 527;
262 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 321 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 527;
263 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 320 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 528;
264 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 320 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 529;
265 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 320 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 530;
266 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 470 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 531;
267 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 470 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 532;
268 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 322 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 533;
269 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 323 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 533;
270 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 322 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 534;
271 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 322 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 535;
272 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 322 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 536;
273 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 325 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 537;
274 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 326 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 537;
275 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 325 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 538;
276 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 325 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 539;
277 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 325 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 540;
278 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 329 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 541;
279 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 330 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 541;
280 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 329 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 542;
281 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 329 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 543;
282 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 329 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 544;
283 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 332 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 545;
284 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 333 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 545;
285 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 332 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 546;
286 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 332 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 547;
287 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 332 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 548;
288 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 334 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 549;
289 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 335 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 549;
290 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 334 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 550;
291 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 334 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 551;
292 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 334 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 552;
293 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO:336 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 553;
294 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 336 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 554;
295 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO:336 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 555;
296 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 336 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 556;
351 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 449 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 636;
352 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 452 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 637;
353 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 452 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 638;
354 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 454 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 639;
355 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 454 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 640;
356 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO:457 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 641;
357 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 457 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 642;
358 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 465 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 643;
359 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 465 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 644;
360 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 466 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 645;
361 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 466 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 646;
362 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 467 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 647;
363 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 467 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 648;
364 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 468 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 649;
365 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 468 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 650;
366 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 469 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 651;
367 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 469 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 652;
368 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 470 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 653;
369 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 470 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 654.
[29] A double-stranded ribonucleic acid conjugate, wherein the double-stranded ribonucleic acid conjugate comprises the double-stranded ribonucleic acid of any one of [1] to [14], or the double-stranded ribonucleic acid modification of any one of [15] to [28 ]; and, conjugating a conjugation group attached to the double-stranded ribonucleic acid or the double-stranded ribonucleic acid modification.
[30] The double-stranded ribonucleic acid conjugate of [29], wherein the conjugate group has a structure as shown below:
[31] the double-stranded ribonucleic acid conjugate of [29] or [30], wherein the conjugate group is attached to the 3' -end of the sense strand.
[32] The double-stranded ribonucleic acid conjugate of [31], wherein the conjugate group is conjugated to the 3' -end of the sense strand via a phosphodiester bond;
preferably, the sense strand and the antisense strand of the double-stranded ribonucleic acid conjugate are complementary to form a double-stranded region of the double-stranded ribonucleic acid conjugate, and the 3 'end of the sense strand forms a blunt end, the 3' end of the antisense strand having 1-2 protruding nucleotides extending out of the double-stranded region;
or,
the sense strand and the antisense strand of the double-stranded ribonucleic acid conjugate are complementary to form a double-stranded region of the double-stranded ribonucleic acid conjugate, and the 3 'end of the sense strand forms a blunt end and the 3' end of the antisense strand forms a blunt end.
[33] The double-stranded ribonucleic acid conjugate of any one of [29] to [32], wherein the double-stranded ribonucleic acid conjugate has a structure as shown below:
wherein the double helix structure is double-stranded ribonucleic acid or double-stranded ribonucleic acid modifier.
[34] The double-stranded ribonucleic acid conjugate of any one of [29] to [33], wherein the double-stranded ribonucleic acid conjugate is an siRNA conjugate.
[35] The double-stranded ribonucleic acid conjugate of any one of [29] to [34], wherein the double-stranded ribonucleic acid conjugate is an siRNA conjugate for inhibiting HMGB1 gene expression.
[36] The double-stranded ribonucleic acid conjugate of any one of [29] to [35], wherein the double-stranded ribonucleic acid conjugate is formed by linking any one of the siRNAs shown in Table 1 to a conjugate group, or the double-stranded ribonucleic acid conjugate is formed by linking any one of the siRNAs shown in Table 1-1 to a conjugate group, or the double-stranded ribonucleic acid conjugate is formed by linking any one of the siRNA modifications shown in Table 2 to a conjugate group;
preferably, the double-stranded ribonucleic acid conjugate is selected from the following:
155 The sense strand of the linker conjugate group comprises the nucleotide sequence shown as SEQ ID NO. 364 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 349;
156 A sense strand of the linker conjugate group comprising a nucleotide sequence as shown in SEQ ID NO. 365 and an antisense strand comprising a nucleotide sequence as shown in SEQ ID NO. 350;
157 The sense strand of the linker conjugate group comprises a nucleotide sequence as shown in SEQ ID NO. 366 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 359;
158 The sense strand of the linker conjugate group comprises a nucleotide sequence as shown in SEQ ID NO. 367 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 360;
159 The sense strand of the linker conjugate group comprises the nucleotide sequence shown as SEQ ID NO. 368 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 363;
160 A sense strand of the linker conjugate group comprising a nucleotide sequence as shown in SEQ ID NO. 369 and an antisense strand comprising a nucleotide sequence as shown in SEQ ID NO. 351;
161 The sense strand of the linker conjugate group comprises the nucleotide sequence shown as SEQ ID NO. 370 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 353;
162 A sense strand of the linker conjugate group comprising a nucleotide sequence as set forth in SEQ ID NO. 371 and an antisense strand comprising a nucleotide sequence as set forth in SEQ ID NO. 356;
163 A sense strand of the linker conjugate group comprising a nucleotide sequence as set forth in SEQ ID NO. 372 and an antisense strand comprising a nucleotide sequence as set forth in SEQ ID NO. 343;
164 The sense strand of the linker conjugate group comprises the nucleotide sequence shown as SEQ ID NO. 373 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 347;
165 The sense strand of the linker conjugate group comprises the nucleotide sequence shown as SEQ ID NO. 374 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 358;
166 The sense strand of the linker conjugate group comprises the nucleotide sequence shown as SEQ ID NO. 375 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 361;
297 A sense strand of the linker conjugate group comprising a nucleotide sequence as set forth in SEQ ID NO. 364 and an antisense strand comprising a nucleotide sequence as set forth in SEQ ID NO. 517;
298 A sense strand of the linker conjugate group comprising a nucleotide sequence as set forth in SEQ ID NO. 364 and an antisense strand comprising a nucleotide sequence as set forth in SEQ ID NO. 518;
299 A sense strand of the linker conjugate group comprising a nucleotide sequence as shown in SEQ ID NO. 365 and an antisense strand comprising a nucleotide sequence as shown in SEQ ID NO. 527;
300 A sense strand of the linker conjugate group comprising a nucleotide sequence as shown in SEQ ID NO. 365 and an antisense strand comprising a nucleotide sequence as shown in SEQ ID NO. 528;
301 The sense strand of the linker conjugate group comprises a nucleotide sequence as shown in SEQ ID NO. 366 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 549;
302 The sense strand of the linker conjugate group comprises the nucleotide sequence shown as SEQ ID NO. 366 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 550;
303 The sense strand of the linker conjugate group comprises a nucleotide sequence as shown in SEQ ID NO:367 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO: 553;
304 The sense strand of the linker conjugate group comprises a nucleotide sequence as shown in SEQ ID NO. 367 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 554;
305 A sense strand of the linker conjugate group comprising the nucleotide sequence shown as SEQ ID NO. 372 and an antisense strand comprising the nucleotide sequence shown as SEQ ID NO. 487;
306 A sense strand of the linker conjugate group comprising a nucleotide sequence as set forth in SEQ ID NO. 372 and an antisense strand comprising a nucleotide sequence as set forth in SEQ ID NO. 488;
307 A sense strand of the linker conjugate group comprising a nucleotide sequence as set forth in SEQ ID NO:369 and an antisense strand comprising a nucleotide sequence as set forth in SEQ ID NO: 533;
308 A sense strand of the linker conjugate group comprising a nucleotide sequence as shown in SEQ ID NO. 369 and an antisense strand comprising a nucleotide sequence as shown in SEQ ID NO. 534;
309 The sense strand of the linker conjugate group comprises the nucleotide sequence shown as SEQ ID NO. 370 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 537;
310 A sense strand of the linker conjugate group comprising a nucleotide sequence as set forth in SEQ ID NO. 370 and an antisense strand comprising a nucleotide sequence as set forth in SEQ ID NO. 538;
311 The sense strand of the linker conjugate group comprises the nucleotide sequence shown as SEQ ID NO. 371 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 541;
312 The sense strand of the linker conjugate group comprises the nucleotide sequence shown as SEQ ID NO. 371 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 542;
313 The sense strand of the linker conjugate group comprises the nucleotide sequence shown as SEQ ID NO. 374 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 545;
314 The sense strand of the linker conjugate group comprises the nucleotide sequence shown as SEQ ID NO. 374 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 546;
315 A sense strand of the linker conjugate group comprising a nucleotide sequence as shown in SEQ ID NO:557 and an antisense strand comprising a nucleotide sequence as shown in SEQ ID NO: 472;
316 The sense strand of the linker conjugate group comprises the nucleotide sequence shown as SEQ ID NO. 558 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 475;
317 A sense strand of the linker conjugate group comprising a nucleotide sequence as shown in SEQ ID NO:559 and an antisense strand comprising a nucleotide sequence as shown in SEQ ID NO: 479;
370 A sense strand of the linker conjugate group comprising a nucleotide sequence as shown in SEQ ID NO:655 and an antisense strand comprising a nucleotide sequence as shown in SEQ ID NO: 483;
371 A sense strand of the linker conjugate group comprising a nucleotide sequence as set forth in SEQ ID NO:655 and an antisense strand comprising a nucleotide sequence as set forth in SEQ ID NO: 484;
372 The sense strand of the linker conjugate group comprises a nucleotide sequence as shown in SEQ ID NO. 656 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 491;
373 A sense strand of the linker conjugate group comprising a nucleotide sequence as shown in SEQ ID NO. 656 and an antisense strand comprising a nucleotide sequence as shown in SEQ ID NO. 492;
374 A sense strand of the linker conjugate group comprising a nucleotide sequence as shown in SEQ ID NO. 657 and an antisense strand comprising a nucleotide sequence as shown in SEQ ID NO. 497;
375 The sense strand of the linker conjugate group comprises a nucleotide sequence as shown in SEQ ID NO. 657 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 498;
376 A sense strand of the linker conjugate group comprising a nucleotide sequence as shown in SEQ ID NO. 658 and an antisense strand comprising a nucleotide sequence as shown in SEQ ID NO. 513;
377 A sense strand of the linker conjugate group comprising a nucleotide sequence as set forth in SEQ ID NO. 658 and an antisense strand comprising a nucleotide sequence as set forth in SEQ ID NO. 514;
378 The sense strand of the linker conjugate group comprises a nucleotide sequence as shown in SEQ ID NO. 659 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 515;
379 The sense strand of the linker conjugate group comprises the nucleotide sequence shown as SEQ ID NO. 659 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 516;
380 The sense strand of the linker conjugate group comprises the nucleotide sequence shown as SEQ ID NO. 660 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 521;
381 The sense strand of the linker conjugate group comprises the nucleotide sequence shown as SEQ ID NO. 660 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 522;
382 A sense strand of the linker conjugate group comprising a nucleotide sequence as set forth in SEQ ID NO:661 and an antisense strand comprising a nucleotide sequence as set forth in SEQ ID NO: 523;
383 A sense strand of the linker conjugate group comprising a nucleotide sequence as set forth in SEQ ID NO:661 and an antisense strand comprising a nucleotide sequence as set forth in SEQ ID NO: 524;
384 A sense strand of the linker conjugate group comprising a nucleotide sequence as shown in SEQ ID NO:662 and an antisense strand comprising a nucleotide sequence as shown in SEQ ID NO: 525;
385 A sense strand of the linker conjugate group comprising a nucleotide sequence as shown in SEQ ID NO:662 and an antisense strand comprising a nucleotide sequence as shown in SEQ ID NO: 526;
386 The sense strand of the linker conjugate group comprises the nucleotide sequence shown as SEQ ID NO:663 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO: 531;
387 The sense strand of the linker conjugate group comprises the nucleotide sequence shown as SEQ ID NO. 663 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 532;
388 A sense strand of the linker conjugate group comprising a nucleotide sequence as shown in SEQ ID NO:557 and an antisense strand comprising a nucleotide sequence as shown in SEQ ID NO: 473;
389 The sense strand of the linker conjugate group comprises the nucleotide sequence shown as SEQ ID NO. 558 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 476.
[37] A pharmaceutical composition, wherein the pharmaceutical composition comprises at least one of: the double-stranded ribonucleic acid according to any one of [1] to [14], a double-stranded ribonucleic acid modification according to any one of [15] to [28], a double-stranded ribonucleic acid conjugate according to any one of [29] to [36 ].
[38] The pharmaceutical composition of [37], wherein the pharmaceutical composition further comprises one or more pharmaceutically acceptable carriers.
[39] The double-stranded ribonucleic acid according to any one of [1] to [14], the double-stranded ribonucleic acid modification according to any one of [15] to [28], the double-stranded ribonucleic acid conjugate according to any one of [29] to [36], or the pharmaceutical composition according to any one of [37] to [38], for use in at least one of:
(1) Inhibiting HMGB1 gene expression, or preparing a medicament for inhibiting HMGB1 gene expression;
(2) For preventing or treating diseases related to the abnormal expression of the HMGB1 gene, or for preparing a medicament for preventing or treating diseases related to the abnormal expression of the HMGB1 gene;
(3) For use in treating a subject suffering from a disease that would benefit from reduced HMGB1 gene expression, or in the manufacture of a medicament for use in treating a subject suffering from a disease that would benefit from reduced HMGB1 gene expression.
[40] The use according to [39], wherein the disease associated with abnormal expression of HMGB1 gene is selected from the group consisting of:
non-alcoholic steatohepatitis, sepsis, arthritis, colitis, acute lung injury, colorectal cancer, gastric cancer, myelodysplastic syndrome, acute myeloid leukemia, chronic myelogenous leukemia, acute lymphoblastic leukemia, lymphoma, multiple myeloma, atherosclerosis, and other related conditions, pathologies or syndromes not yet identified.
[41] A method for inhibiting HMGB1 gene expression in a cell, wherein the method comprises contacting the cell with the double-stranded ribonucleic acid according to any one of [1] to [14], the double-stranded ribonucleic acid modification according to any one of [15] to [28], the double-stranded ribonucleic acid conjugate according to any one of [29] to [36], or the pharmaceutical composition according to any one of [37] to [38 ].
[42] The method of [41], wherein the cell is an in vivo cell or an in vitro cell.
[43] The method of [41] or [42], wherein the cell is in a subject.
[44] The method of [43], wherein the subject is a mammal, preferably a human.
[45] The method of [43] or [44], wherein the subject has at least one of the following properties:
in vivo abnormal expression of the HMGB1 gene, more specifically abnormal high expression of the HMGB1 gene;
has a disease associated with abnormal expression of the HMGB1 gene;
with diseases that would benefit from reduced HMGB1 gene expression.
ADVANTAGEOUS EFFECTS OF INVENTION
In some embodiments, the double-stranded ribonucleic acids provided by the present disclosure are capable of intracellular binding to form an RNA-induced silencing complex (RISC), cleaving mRNA transcribed from the HMGB1 gene, and highly effective and specific inhibiting expression of the HMGB1 gene for the treatment of HMGB 1-related diseases including non-alcoholic steatohepatitis, sepsis, arthritis, colitis, acute lung injury, colorectal cancer, gastric cancer, myelodysplastic syndrome, acute myeloid leukemia, chronic myelogenous leukemia, acute lymphoblastic leukemia, lymphoma, multiple myeloma, and atherosclerosis.
Furthermore, the double-stranded ribonucleic acid in the present disclosure is siRNA, which targets and binds to and degrades mRNA of a transcription product of HMGB1 gene, plays a role of RNA interference, inhibits protein expression of HMGB1 gene, and is an HMGB1 inhibitor with high inhibition rate and good specificity.
In some embodiments, the present disclosure modifies double-stranded ribonucleic acid to provide a double-stranded ribonucleic acid modification having high stability suitable for use in the treatment of in vivo diseases.
Furthermore, the double-stranded ribonucleic acid modifier is an siRNA modifier, and has high stability and good inhibition activity.
In some embodiments, the conjugate of double-stranded ribonucleic acid or double-stranded ribonucleic acid modifier is obtained by connecting a conjugate group on double-stranded ribonucleic acid or double-stranded ribonucleic acid modifier, can be used for high-efficiency targeted delivery into tissues and cells, reduces the influence of double-stranded ribonucleic acid or double-stranded ribonucleic acid modifier on non-targeted normal tissues and cells, and improves the safety of the double-stranded ribonucleic acid or double-stranded ribonucleic acid modifier in clinical disease treatment.
Furthermore, the double-stranded ribonucleic acid conjugate is an siRNA conjugate, has organ or tissue targeting property while maintaining the inhibition activity and stability of the siRNA, can reduce the influence on other tissues or organs and the use amount of siRNA molecules, and can achieve the purposes of reducing toxicity and lowering cost.
Further, the conjugate group in the present disclosure is a group (GalNAc) of the structure shown in formula I, and GalNAc can be used for targeted delivery into liver cells and tissues, and for highly inhibiting expression of HMGB1 gene in liver.
Detailed Description
Definition of the definition
Unless stated to the contrary, the terms used in the present invention have the following meanings.
In the claims and/or the specification of the present invention, the words "a" or "an" or "the" may mean "one" but may also mean "one or more", "at least one", and "one or more".
As used in the claims and specification, the words "comprise," "have," "include" or "contain" mean including or open-ended, and do not exclude additional, unrecited elements or method steps.
Throughout this application, the term "about" means: one value includes the standard deviation of the error of the device or method used to determine the value. The numerical ranges and parameters set forth herein are approximations that may vary depending upon the particular application. Any numerical value, however, inherently contains certain standard deviations found in their respective testing methods or apparatus. Accordingly, unless explicitly stated otherwise, it is to be understood that all ranges, amounts, values and percentages used in this disclosure are modified by "about". As used herein, "about" generally means that the actual value is within plus or minus 10%, 5%, 1% or 0.5% of a particular value or range.
The terms "HMGB1", "HMG-1", "HMG3", "SBP-1" as used in the context of this disclosure refer to well known genes and polypeptides. The HMGB1 gene, HMGB1 mRNA sequence is readily available, for example, using the following: gene banks (GenBank), databases (UniProt), human mendelian genetic Online (OMIM), and the like.
The term "HMGB1 gene" may be a wild-type HMGB1 gene, or a mutant HMGB1 gene having a sequence variation. Many sequence variations in the HMGB1 gene have been identified and can be found in, for example, ncbidsnp and UniProt (see, e.g., ncbi.nlm.nih.gov/snp).
The terms "polypeptide", "protein" interchangeably refer to a string of at least two amino acid residues, which may be recombinant polypeptides, natural polypeptides or synthetic polypeptides, that are linked to each other by a covalent bond (e.g., a peptide bond). The polypeptide may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non-amino acids. The term also includes amino acid polymers that have been modified (e.g., disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component).
The term "target sequence" as used in the context of the present disclosure refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during transcription of a target gene, including mRNA that is the product of RNA processing of the primary transcript.
In some embodiments of the present invention, in some embodiments, the target sequence is not less than 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, and 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 248, 249, 250, 251, 252, 253, 254, 256, 257, 258, 261, 260, 262 263. 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 370, 367, 368, 369, 370, 371, 372; 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 473, or 474 consecutive linked nucleotide sequences. In some alternative embodiments, another shorter target sequence may be included in the target sequence. In some embodiments, one or more shorter target sequences may be included in the target sequence. It is believed that more than two shorter target sequences contained in the same segment of target sequence have the same characteristics.
In some embodiments, the target gene is the HMGB1 gene. In some embodiments, the target portion of the sequence will be at least long enough to serve as a substrate for iRNA-directed cleavage at or near the nucleotide sequence portion of the mRNA molecule formed during transcription of the HMGB1 gene.
In the art, "G", "C", "a", "T" and "U" generally represent bases of guanine, cytosine, adenine, thymine, uracil, respectively, but it is also generally known in the art that "G", "C", "a", "T" and "U" each also generally represent nucleotides containing guanine, cytosine, adenine, thymine and uracil, respectively, as bases, which is a common manner in the expression of deoxyribonucleic acid sequences and/or ribonucleic acid sequences, and thus in the context of the present disclosure, the meaning of "G", "C", "a", "T", "U" includes the various possible scenarios described above. However, it is understood that the term "ribonucleotide" or "nucleotide" may also refer to a modified nucleotide (as described in further detail below) or an alternative replacement moiety. Those skilled in the art will appreciate that guanine, cytosine, adenine and uracil can be replaced with other moieties without substantially altering the base pairing properties of an oligonucleotide (including a nucleotide having such a replaced portion). For example, without limitation, a nucleotide that includes inosine as its base may base pair with a nucleotide that includes adenine, cytosine, or uracil. Thus, nucleotides containing uracil, guanine or adenine may be replaced in the nucleotide sequence of the dsRNA characterized in the present invention by nucleotides containing, for example, inosine. In another example, adenine and cytosine anywhere in the oligonucleotide may be replaced with guanine and uracil, respectively, to form G-U wobble base pairing with the target mRNA. Sequences containing such substitutions are suitable for use in the compositions and methods of the present invention.
The terms "iRNA," "RNAi agent," "iRNA agent," "RNA interfering agent," as used in the context of the present disclosure, are used interchangeably herein to refer to the term as defined herein comprising siRNA and mediating targeted cleavage of RNA transcripts through the RNA-induced silencing complex (RISC) pathway. iRNA directs sequence-specific degradation of mRNA by a process known as RNA interference (RNAi). iRNA modulates, e.g., inhibits, expression of a target gene in a cell (e.g., a cell of a subject (e.g., a mammalian subject)).
The terms "double-stranded ribonucleic acid", "double-stranded RNA (dsRNA) molecule", "dsRNA" as used in the context of the present disclosure may be used interchangeably. The term "dsRNA" refers to a complex of ribonucleic acid molecules having a double-stranded structure comprising two antiparallel and substantially complementary nucleic acid strands, referred to as having "sense" and "antisense" orientations relative to a target gene, e.g., the HMGB1 gene. In some embodiments, double-stranded ribonucleic acid (dsRNA) triggers degradation of target RNA, e.g., mRNA, by a post-transcriptional gene silencing mechanism (referred to herein as RNA interference or RNAi).
Typically, the majority of the nucleotides of each strand of a dsRNA molecule are ribonucleotides, but as detailed herein, each or both of the two strands may also include one or more non-ribonucleotides, e.g., deoxyribonucleotides and/or modified nucleotides. In addition, as used in this disclosure, "double-stranded ribonucleic acid" may include ribonucleotides with chemical modification, phosphate backbones, and the like. Such modifications may include all types of modifications disclosed herein or known in the art.
The term "oligonucleotide" as used in the context of the present disclosure refers to a compound in which the position of a base on the ribose ring in a nucleotide is changed, for example, a compound in which a base is not linked to the 1' -position of the ribose ring, but is linked to the 2' -or 3' -position of the ribose ring.
In some embodiments, the double-stranded ribonucleic acid of the present disclosure is an siRNA that interacts with a target gene transcribed mRNA sequence (e.g., a C gene transcribed mRNA sequence) to direct cleavage of the target RNA. Without wishing to be bound by theory, long double stranded RNA introduced into the cell is referred to as the cleavage of type III endonuclease(s) into siRNA (summer et al, genes Dev.) 2001, 15:485). Dicer (ribonuclease III-like enzyme) processes dsRNA into 19-23 base pair short interfering RNA with a characteristic double base 3' overhang (Bernstein et al, (2001) Nature 409:363). These siRNAs are then incorporated into an RNA-induced silencing complex (RISC), where one or more helices cleave the siRNA duplex, which makes it possible for the complementary antisense strand to direct target recognition (Nykanen et al, (2001) cells (Cell) 107:309). Once bound to the appropriate target mRNA, one or more endonucleases within the RISC cleave the target to induce silencing (balshier et al, (2001) Genes and development (Genes dev.) 15:188).
The term "protruding nucleotide" as used in the context of the present disclosure refers to one or more unpaired nucleotides protruding from the duplex structure of a double-stranded ribonucleic acid when one 3 'end of the other strand extends beyond the 5' end of the other strand, or vice versa. "blunt end" or "blunt end" means that there are no unpaired nucleotides at that end of the double-stranded ribonucleic acid, i.e., no nucleotide overhangs. A "blunt-ended" double-stranded ribonucleic acid is a dsRNA that is double-stranded throughout its length, i.e., has no nucleotide overhangs at either end of the molecule.
The term "antisense strand" refers to a strand of a region of double-stranded ribonucleic acid that is substantially complementary to a target sequence (e.g., derived from human HMGB1 mRNA). Where the region of complementarity is not fully complementary to the target sequence, mismatches are most tolerable in the terminal region, and if mismatches occur, they are typically within one or more regions of the terminal, e.g., 5, 4, 3, 2 or 1 nucleotides of the 5 'and/or 3' terminal.
The term "sense strand" refers to a nucleic acid strand in a double-stranded ribonucleic acid that contains a region that is substantially complementary to a region of the antisense strand.
The terms "complementary" or "reverse complementary" are used interchangeably and have the meaning well known to those skilled in the art that in a double stranded nucleic acid molecule, the bases of one strand pair with the bases on the other strand in a complementary manner. In DNA, the purine base adenine (a) is always paired with the pyrimidine base thymine (T) (or uracil (U) in RNA); the purine base guanine (C) is always paired with the pyrimidine base cytosine (G). Each base pair includes a purine and a pyrimidine. When adenine on one strand always pairs with thymine (or uracil) on the other strand, and guanine always pairs with cytosine, the two strands are considered complementary to each other, and the sequence of the strand can be deduced from the sequence of its complementary strand. Accordingly, "mismatch" means in the art that bases at corresponding positions do not exist in complementary pairs in a double-stranded nucleic acid.
The term "substantially reverse complementary" means that there are no more than 3 base mismatches between the two nucleotide sequences involved, i.e., there are 1, 2 or 3 base mismatches between the two nucleotide sequences involved; "perfect complementarity" means that there is no base mismatch between two nucleotide sequences.
The terms "complementary," "fully complementary," and "substantially complementary" can be used with respect to base pairing between the sense strand and the antisense strand of a dsRNA, or between the antisense strand of a dsRNA and a target sequence, as will be understood from the context of its use.
The term "inhibit" may be used interchangeably with "reduce," "silence," "down-regulate," "suppress," and other similar terms, and includes any level of inhibition.
The term "inhibiting expression of the HMGB1 gene" includes inhibiting expression of any HMGB1 gene (such as, for example, a mouse HMGB1 gene, a rat HMGB1 gene, a monkey HMGB1 gene, or a human HMGB1 gene) as well as variants (e.g., naturally occurring variants) or mutants of the HMGB1 gene. Thus, the HMGB1 gene may be a wild-type HMGB1 gene, a mutant HMGB1 gene, or a transgenic HMGB1 gene in the case of genetically manipulated cells, cell groups, or organisms.
"inhibiting HMGB1 gene expression" includes any level of inhibition of HMGB1 gene, e.g., at least partially inhibiting expression of HMGB1 gene, such as inhibiting at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.
The term "independently" means that at least two groups (or ring systems) present in the structure that are the same or similar in value range may have the same or different meanings in the particular case. For example, substituent X and substituent Y are each independently hydrogen, hydroxy, alkyl or aryl, then when substituent X is hydrogen, substituent Y may be either hydrogen or hydroxy, alkyl or aryl; similarly, when the substituent Y is hydrogen, the substituent X may be either hydrogen or hydroxy, alkyl or aryl.
The term "alkyl" includes straight, branched or cyclic saturated alkyl groups. For example, alkyl groups include, but are not limited to, methyl, ethyl, propyl, cyclopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, cyclobutyl, n-pentyl, cyclohexyl, and the like. By way of example, "C1-6" in "C1-6 alkyl" refers to a group comprising a linear, branched, or cyclic arrangement of 1, 2, 3, 4, 5, or 6 carbon atoms.
The term "alkoxy" as used herein refers to an alkyl group attached to the remainder of the molecule through an oxygen atom (-O-alkyl), wherein the alkyl is as defined herein. Non-limiting examples of alkoxy groups include methoxy, ethoxy, trifluoromethoxy, difluoromethoxy, n-propoxy, isopropoxy, n-butoxy, tert-butoxy, n-pentoxy, and the like.
The term "treatment" refers to: after suffering from the disease, the subject is exposed (e.g., administered) to double-stranded ribonucleic acid, double-stranded ribonucleic acid modifications, double-stranded ribonucleic acid conjugates, pharmaceutical compositions, thereby alleviating the symptoms of the disease compared to when not exposed, and does not mean that the symptoms of the disease must be completely inhibited. The suffering from the disease is: the body develops symptoms of the disease.
The term "preventing" refers to: by contacting (e.g., administering) a subject with a double-stranded ribonucleic acid, double-stranded ribonucleic acid modification, double-stranded ribonucleic acid conjugate, pharmaceutical composition of the present disclosure prior to the onset of a disease, thereby alleviating the symptoms after the onset of a disease as compared to when not contacted, is not meant to necessarily completely inhibit the disease.
The term "effective amount" refers to an amount or dose of a double-stranded ribonucleic acid, double-stranded ribonucleic acid modification, double-stranded ribonucleic acid conjugate, or pharmaceutical composition of the present invention that, upon administration to a patient in single or multiple doses, produces a desired effect in a patient in need of treatment or prevention. The effective amount can be readily determined by the attending physician as a person skilled in the art by considering a number of factors: species such as mammals; its size, age and general health; specific diseases involved; the extent or severity of the disease; response of individual patients; specific antibodies administered; mode of administration; the bioavailability characteristics of the administration formulation; a selected dosing regimen; and the use of any concomitant therapy.
The term "disease associated with abnormal expression of the HMGB1 gene" is a disease or disorder associated with an inflammatory response, tumor cell migration. The term "disease associated with aberrant expression of the HMGB1 gene" includes a disease, disorder or condition that would benefit from reduced expression of HMGB1 (i.e., "HMGB 1-related disease"). Such diseases are typically closely related to the signaling pathway in which inflammatory factors are involved. Non-limiting examples of diseases associated with aberrant expression of the HMGB1 gene include: non-alcoholic steatohepatitis, sepsis, arthritis, colitis, acute lung injury, colorectal cancer, gastric cancer, myelodysplastic syndrome, acute myeloid leukemia, chronic myelogenous leukemia, acute lymphoblastic leukemia, lymphoma, multiple myeloma, atherosclerosis, and the like (Harriet Gaskell et al, high-Mobility Group Box-1and Liver Disease,Hepatol Commun.2018Sep;2 (9): 1005-1020; lihua Qu et al, high-Mobility Group Box (HMGB 1) and Autophagy in Acute Lung Injury (ALI) A Review, med Sci Monit et al, 25:1828-1837, vitali R et al, fecal HMGB1 is a novel marker of intestinal mucosal inflammation in pediatric inflammatory bowel break.Am J gateway entol.2011, 106 (11) 2029-40, dinc Suren et al, high Mobility Group Box (HMGB 1) expression in gastric adenocarcinomas, journal of BUON.2018Mar-Apr, 23 (2) 422-427, meihong Den et al, the Endotoxin Delivery Protein HMGB1 Mediates Caspase-11-Dependent Lethality in Sepsis, immunity.2018Oct16, 49 (4) 740-753, HMGB proteins and arthritis, hum cell 2018Jan, 31 (1) 1-9, dromir AC et al, 23-injured hepatocytes, potential role of HMGB, J37-3936, J37, etc., HMGB1enhances chemotherapy resistance in multiple myeloma cells by activating the nuclear factor- κB path, exp Ther Med.2021Jul;22 (1) 705; angel Y F Kam et al Targeting High Mobility Group Box-1 (HMGB 1) Promotes Cell Death in Myelodysplastic Syndrome, clin Cancer Res.2019Jul 1;25 (13) 4155-4167.Doi:10.1158/1078-0432.CCR-18-3517.Epub 2019Apr 5; l Liu et al, HMGB1: an important regulator of myeloid differentiation and acute myeloid leukemia as well as a promising therapeutic target, J Mol Med (Berl). 2021Jan;99 (1) 107-118; xing-Jiang Mao et al Expression of HMGB 1and its clinical significance in T-cell lymphoma, asian Pac J Cancer prev.2012;13 (11) 5569-71; lulu Liu et al, HMGB1: an important regulator of myeloid differentiation and acute myeloid leukemia as well as a promising therapeutic target, J Mol Med (Berl). 2021;99 (1) 107-118; rogowski et al, role of high mobility group protein B1 in atherosclerosis and research progress of mechanism thereof, international journal of inspection medicine, volume 41, 20, p.2518-2521; ).
The term "pharmaceutically acceptable excipients" or "pharmaceutically acceptable carriers" refers to auxiliary materials widely used in the field of pharmaceutical production. The main purpose of the use of auxiliary substances is to provide a pharmaceutical composition which is safe to use, stable in nature and/or has specific functionalities, and to provide a method so that the active ingredient can be dissolved at a desired rate after administration of the drug to a subject, or so that the active ingredient is effectively absorbed in the subject to whom it is administered. Pharmaceutically acceptable excipients may be inert fillers or may be functional ingredients that provide some function to the pharmaceutical composition (e.g., to stabilize the overall pH of the composition or to prevent degradation of the active ingredients in the composition). Non-limiting examples of pharmaceutically acceptable excipients include, but are not limited to, binders, suspending agents, emulsifiers, diluents (or fillers), granulating agents, binders, disintegrants, lubricants, anti-adherent agents, glidants, wetting agents, gelling agents, absorption delaying agents, dissolution inhibitors, reinforcing agents, adsorbents, buffers, chelating agents, preservatives, coloring agents, flavoring agents, sweetening agents, and the like.
The pharmaceutical compositions of the present disclosure may be prepared using any method known to those of skill in the art. For example, conventional mixing, dissolving, granulating, emulsifying, milling, encapsulating, entrapping and/or lyophilizing processes.
In the present disclosure, the route of administration can be varied or adjusted in any suitable manner to meet the needs of the nature of the drug, the convenience of the patient and medical personnel, and other relevant factors.
The term "individual," "patient," or "subject" as used in the context of the present disclosure includes mammals. Mammals include, but are not limited to, domesticated animals (e.g., cattle, sheep, cats, dogs, and horses), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats).
Unless defined otherwise or clearly indicated by context, all technical and scientific terms in this disclosure have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.
Double-stranded ribonucleic acid
A first aspect of the present disclosure provides a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of the HMGB1 gene. One strand of the double-stranded ribonucleic acid is an antisense strand, which is complementarily paired with an mRNA sequence formed during expression of a target gene (i.e., HMGB1 gene) for directing cleavage of the target mRNA (i.e., transcription product of HMGB1 gene). The other sense strand of the double-stranded ribonucleic acid includes a double-stranded region that is partially complementary and fully complementary to the antisense strand to form the double-stranded ribonucleic acid.
In some embodiments, double-stranded ribonucleic acid acts as a substrate for an endonuclease (Dicer) and is cleaved into small fragments of dsRNA, i.e., siRNA. In some embodiments, the double-stranded ribonucleic acid is an siRNA. siRNA inhibits HMGB1 gene expression by assembling to form RNA-induced silencing complex (RNA-induced silencing complex, RISC) RISC complex, cleaving target mRNA.
Based on the target sequence in the human HMGB1 mRNA (nm_ 002128.7), siRNA that binds to the target mRNA was designed. In some embodiments, the target sequence is selected from the nucleotide sequences set forth in any one of SEQ ID NOs 1-16, SEQ ID NOs 560-567. In some more specific embodiments, the target sequence is selected from the nucleotide sequences set forth in any one of SEQ ID NOS.17-68, SEQ ID NO 560, SEQ ID NO 562-569.
In some specific embodiments, the nucleotide sequence set forth in SEQ ID NO. 1 comprises the nucleotide sequences set forth in SEQ ID NO. 17-19.
In some specific embodiments, the nucleotide sequence shown as SEQ ID NO. 2 comprises the nucleotide sequences shown as SEQ ID NO. 20-24.
In some specific embodiments, the nucleotide sequence shown as SEQ ID NO. 3 comprises the nucleotide sequences shown as SEQ ID NO. 25-27.
In some specific embodiments, the nucleotide sequence shown as SEQ ID NO. 4 comprises the nucleotide sequences shown as SEQ ID NO. 28-30.
In some specific embodiments, the nucleotide sequence set forth in SEQ ID NO. 5 comprises the nucleotide sequences set forth in SEQ ID NO. 31-36.
In some specific embodiments, the nucleotide sequence shown as SEQ ID NO. 6 comprises the nucleotide sequences shown as SEQ ID NO. 37-40.
In some specific embodiments, the nucleotide sequence set forth in SEQ ID NO. 7 comprises the nucleotide sequences set forth in SEQ ID NO. 41-42.
In some specific embodiments, the nucleotide sequence set forth in SEQ ID NO. 8 comprises the nucleotide sequences set forth in SEQ ID NO. 43-45.
In some specific embodiments, the nucleotide sequence set forth in SEQ ID NO. 9 comprises the nucleotide sequences set forth in SEQ ID NO. 46-47.
In some specific embodiments, the nucleotide sequence set forth in SEQ ID NO. 10 comprises the nucleotide sequences set forth in SEQ ID NO. 48-49.
In some specific embodiments, the nucleotide sequence shown as SEQ ID NO. 11 comprises the nucleotide sequences shown as SEQ ID NO. 50-51.
In some specific embodiments, the nucleotide sequence shown as SEQ ID NO. 12 comprises the nucleotide sequences shown as SEQ ID NO. 52-54.
In some specific embodiments, the nucleotide sequence set forth in SEQ ID NO. 13 comprises the nucleotide sequences set forth in SEQ ID NO. 55-58.
In some specific embodiments, the nucleotide sequence shown as SEQ ID NO. 14 comprises the nucleotide sequences shown as SEQ ID NO. 59-61.
In some specific embodiments, the nucleotide sequence set forth in SEQ ID NO. 15 comprises the nucleotide sequences set forth in SEQ ID NO. 62-66.
In some specific embodiments, the nucleotide sequence set forth in SEQ ID NO. 16 comprises the nucleotide sequences set forth in SEQ ID NO. 67-68.
In some specific embodiments, the nucleotide sequence shown as SEQ ID NO:561 comprises the nucleotide sequences shown as SEQ ID NO: 568-569.
In some embodiments, the antisense strand comprises sequence B that differs by no more than 3 nucleotides from the reverse complement of at least 15 consecutive nucleotides in the target sequence. Specifically, a starting nucleotide is selected in the target sequence in the direction from the 5' -end to the 3' -end, with at least 15 nucleotides extending in the 3' -direction, including the starting nucleotide, as the binding region of the siRNA. The antisense strand comprises the reverse complement of the nucleotide sequence corresponding to the binding region. The starting nucleotide may be a nucleotide at any position of the target sequence, and at least 15 consecutive nucleotides (including a nucleotide at the starting position) may be obtained as long as the nucleotide extends 3' to the target sequence based on the starting nucleotide.
In the present disclosure, the nucleotide sequence of the antisense strand and the target sequence may be fully complementary or substantially complementary. When the nucleotide sequence of the antisense strand is substantially complementary to the target sequence, there are no more than 3 mismatched bases in the nucleotide sequence of the antisense strand that exist with the target sequence. For example, the mismatched bases are 1, 2, or 3. When the nucleotide sequence of the antisense strand is fully complementary to the target sequence, there are no mismatched bases of the nucleotide sequence of the antisense strand to the target sequence.
Further, the antisense strand consists of at least 15 nucleotides. In some embodiments, the antisense strand consists of 15-28 nucleotides. For example, the antisense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides in length.
Preferably, the antisense strand consists of 19-25 nucleotides, more preferably 19-23 nucleotides, most preferably 19, 21 or 23 nucleotides.
In some alternative embodiments, the antisense strand comprises sequence B that is identical to the reverse complement of a sequence consisting of at least 15 contiguous nucleotides on the target sequence.
In some specific embodiments, the antisense strand comprises sequence B that is identical to the reverse complement of a sequence consisting of 15-28 consecutive nucleotides on the target sequence. Preferably 19-25 contiguous nucleotides on the target sequence, more preferably 19-23 contiguous nucleotides on the target sequence, most preferably 19, 21 or 23 contiguous nucleotides.
In some alternative embodiments, the antisense strand comprises a sequence B that differs by 1 nucleotide from the reverse complement of a sequence consisting of at least 15 consecutive nucleotides on the target sequence.
In some specific embodiments, the antisense strand comprises a sequence B that differs by 1 nucleotide from the reverse complement of a sequence consisting of 15-28 nucleotides on the target sequence. Preferably 19-25 contiguous nucleotides on the target sequence, more preferably 19-23 contiguous nucleotides on the target sequence, most preferably 19, 21 or 23 contiguous nucleotides.
In some specific embodiments, the differential nucleotide is located at the 3' end of sequence B.
In some embodiments, the sense strand comprises sequence a that differs from at least 15 consecutive nucleotides in the target sequence by no more than 3 nucleotides. The sense strand includes a region complementary to the antisense strand, and the nucleotide sequence of the sense strand is identical or substantially identical to the sequence of the antisense strand binding region on the target sequence. Thus, the nucleotide sequence of the sense strand is at least 15 consecutive nucleotides of the target sequence that bind to the antisense strand; alternatively, the nucleotide sequence of the sense strand may have 1, 2 or 3 base different difference nucleotides compared to at least 15 consecutive nucleotides in the target sequence that bind to the antisense strand.
Further, the sense strand consists of at least 15 nucleotides. In some embodiments, the sense strand consists of 15-28 nucleotides. For example, the sense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides in length.
Preferably, the sense strand consists of 19-25 nucleotides, more preferably 19-23 nucleotides, most preferably 19, 21 or 23 nucleotides.
In some alternative embodiments, the sense strand comprises a sequence a that is identical to a sequence consisting of at least 15 contiguous nucleotides on the target sequence.
In some specific embodiments, the sense strand comprises a sequence a that is identical to a sequence consisting of 15-28 consecutive nucleotides on the target sequence. Preferably 19-25 contiguous nucleotides of the target sequence, more preferably 19-23 contiguous nucleotides of the target sequence, and most preferably 19, 21 or 23 contiguous nucleotides of the target sequence.
In some alternative embodiments, the sense strand comprises a sequence a that differs by 1 nucleotide from a sequence consisting of at least 15 consecutive nucleotides on the target sequence.
In some specific embodiments, the sense strand comprises a sequence a that differs by 1 nucleotide from a sequence consisting of 15-28 consecutive nucleotides on the target sequence. Preferably 19-25 contiguous nucleotides of the target sequence, more preferably 19-23 contiguous nucleotides of the target sequence, and most preferably 19, 21 or 23 contiguous nucleotides of the target sequence.
In some specific embodiments, the differential nucleotide is located at the 3' end of sequence a.
In the present disclosure, the length of the sense strand and the antisense strand may be the same or different.
In some embodiments, the sense strand is the same length as the antisense strand, specifically, the sense strand/antisense strand length ratio is 15/15, 16/16, 17/17, 18/18, 19/19, 20/20, 21/21, 22/22, 23/23, 24/24, 25/25, 26/26, 27/27, or 28/28. Preferably, the length ratio of sense strand/antisense strand is 19/19, 20/20, 21/21, 22/22, 23/23, 24/24 or 25/25, more preferably 19/19, 20/20, 21/21, 22/22 or 23/23, most preferably 19/19, 21/21 or 23/23; in some preferred embodiments, the sense strand/antisense strand length ratio is 19/21 or 21/23.
In some embodiments, the sense strand is of a different length than the antisense strand. For example, the length ratio of sense strand/antisense strand is 19/20, 19/21, 19/22, 19/23, 19/24, 19/25, 19/26, 20/19, 20/21, 20/22, 20/23, 20/24, 20/25, 20/26, 21/19, 21/20, 21/22, 21/23, 21/24, 21/25, 21/26, 22/19, 22/20, 22/21, 22/23, 22/24, 22/25, 22/26, 23/19, 23/20, 23/21, 23/22, 23/24, 23/25, or 23/26, etc.
In the present disclosure, the sense strand and the antisense strand may be fully complementary or substantially complementary, and when the two are substantially complementary, no more than 3 mismatched bases exist within the double-stranded region formed by the sense strand and the antisense strand.
In some embodiments, after the sense strand and the antisense strand are complementary to form a double-stranded region, the sense strand, the antisense strand, or a combination thereof has protruding nucleotides extending out of the double-stranded region. The number of protruding nucleotides may be 1 or more, for example, 1 or 2. In addition, the 1-2 nucleotides may be located at the 5 'end, the 3' end, or both ends of any antisense strand or sense strand, and each of the nucleotides may be any type of nucleotide.
In some embodiments, the sense strand is complementary to the antisense strand to form the double-stranded region, and the 3 'end of the sense strand has 1-2 protruding nucleotides extending out of the double-stranded region, the 3' end of the antisense strand forming a blunt end.
In some embodiments, the sense strand is complementary to the antisense strand to form the double-stranded region, and the 3 'end of the antisense strand has 1-2 protruding nucleotides extending out of the double-stranded region, the 3' end of the sense strand forming a blunt end.
In some embodiments, the sense strand and the antisense strand are complementary to form the double-stranded region, and the 3' ends of the sense strand and the antisense strand each have 1-2 protruding nucleotides extending out of the double-stranded region.
In some embodiments, the sense strand and the antisense strand are complementary to form the double-stranded region, and the sense strand and the 3' -end of the antisense strand both form blunt ends.
In the present disclosure, as described above, the nucleotide sequence of the antisense strand and the target sequence may be fully complementary or substantially complementary; the sense strand and the antisense strand may be fully complementary or substantially complementary. Thus, the following descriptions of target sequences SEQ ID NO 17-SEQ ID NO 68, SEQ ID NO 560, SEQ ID NO 562-SEQ ID NO 567, SEQ ID NO 568-SEQ ID NO 569, and siRNAs that are complementary to these target sequences, for each antisense strand of the siRNA, include cases where the target sequences that are complementary thereto (e.g., any one of SEQ ID NO 17-SEQ ID NO 68, SEQ ID NO 560, SEQ ID NO 562-SEQ ID NO 567, SEQ ID NO 568-SEQ ID NO 569) are substantially complementary, i.e., there may be a base mismatch in the nucleotide sequence of the antisense strand of each siRNA to the corresponding target sequence. The sense strand of each siRNA includes a case where it is substantially identical to its target sequence (e.g., any one of SEQ ID NO: 17-68, SEQ ID NO:560, SEQ ID NO: 562-567, and SEQ ID NO: 568-569), i.e., there may be a base difference in the nucleotide sequence of the sense strand of each siRNA from the corresponding target sequence. In some embodiments, the base mismatch or base difference may be a mismatch or difference of no more than 3 bases from the target sequence, e.g., 1, 2, or 3 mismatched or differential bases. It should be noted that, for any one of the target sequences SEQ ID NO:1 to SEQ ID NO:7, 561, it is also applicable to the above description of the cases of base mismatches for the target sequences SEQ ID NO:17 to SEQ ID NO:68, SEQ ID NO:560, SEQ ID NO:562 to SEQ ID NO:567, SEQ ID NO:568 to SEQ ID NO:569 and siRNAs complementary thereto; that is, there may be a case where there is a base mismatch with the corresponding target sequence in the nucleotide sequence of the antisense strand of each siRNA, and there may be a case where there is a base difference with the corresponding target sequence in the nucleotide sequence of the sense strand of each siRNA. In some embodiments, the base mismatch or base difference may be a mismatch or difference of no more than 3 bases from the target sequence, e.g., 1, 2, or 3 mismatched or differential bases.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 17 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 17. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA1 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 18 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 18. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 21 consecutive nucleotides of the sequence shown in SEQ ID NO. 18 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 21 consecutive nucleotides of the sequence shown in SEQ ID NO. 18. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 18 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 18. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 2 to 9 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 19, and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 19. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 21 consecutive nucleotides of the sequence shown in SEQ ID NO. 19 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 21 consecutive nucleotides of the sequence shown in SEQ ID NO. 19. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 19 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 19. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 10 to 15 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 20 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 20. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA111 shown in Table 1-1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 21 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 21. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA16 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 22 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 22. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA17 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 23 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 23. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA18 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 24 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 24. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 21 consecutive nucleotides of the sequence shown in SEQ ID NO. 24 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 21 consecutive nucleotides of the sequence shown in SEQ ID NO. 24. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 24 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 24. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 19 to 24 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 25 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 25. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 21 consecutive nucleotides of the sequence shown in SEQ ID NO. 25 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 21 consecutive nucleotides of the sequence shown in SEQ ID NO. 25. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 25 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 25. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 25 to 28, 112 to 114, 167, 199, and 201 shown in Table 1 or Table 1-1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 26 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 26. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 21 consecutive nucleotides of the sequence shown in SEQ ID NO. 26 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 21 consecutive nucleotides of the sequence shown in SEQ ID NO. 26. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 26 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 26. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 29 to 34, 115 to 116 shown in Table 1 or Table 1-1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 27 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 27. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA35 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 28 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 28. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 21 consecutive nucleotides of the sequence shown in SEQ ID NO. 28 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 21 consecutive nucleotides of the sequence shown in SEQ ID NO. 28. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 28 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 28. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 36 to 41 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 29 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 29. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 21 consecutive nucleotides of the sequence shown in SEQ ID NO. 29 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 21 consecutive nucleotides of the sequence shown in SEQ ID NO. 29. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 29 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 29. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 42 to 56, and 117 shown in Table 1 or Table 1-1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 30 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 30. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 21 consecutive nucleotides of the sequence shown in SEQ ID NO. 30 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 21 consecutive nucleotides of the sequence shown in SEQ ID NO. 30. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 30 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 30. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 57 to 70, 118 to 119 shown in Table 1 or Table 1-1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 31 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 31. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA71 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 32 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 32. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is an siRNA72 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 33 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 33. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA73 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 34 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 34. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is an siRNA74 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 35 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 35. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is an siRNA75 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 36 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 36. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA76 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 37 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 37. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA77 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 38 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 38. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is an siRNA78 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 39, and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 39. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, double-stranded ribonucleic acid is siRNA79 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 40 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 40. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA80 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 41 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 41. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA120 as shown in Table 1-1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 42 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 42. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA81 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 43 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 43. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is an siRNA82 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 44 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 44. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA83 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 45 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 45. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 84 to 86 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 46 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 46. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA87 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 47 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 47. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA88 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 48 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 48. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA89 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 49 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 49. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is an siRNA90 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown as SEQ ID NO. 50 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown as SEQ ID NO. 50. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA91 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 51 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 51. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA92 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 52 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 52. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is an siRNA93 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 53 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 53. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is an siRNA94 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 54 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 54. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA95 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 55 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 55. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acids are siRNA96 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 56 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 56. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, double-stranded ribonucleic acids are siRNA97 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 57 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 57. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is an siRNA98 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 58 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 58. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is an siRNA99 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown as SEQ ID NO. 59, and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown as SEQ ID NO. 59. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA100 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 60 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 60. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA101 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 61 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 61. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA102 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 62 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 62. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA103 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 63 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 63. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA104 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 64 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 64. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is an siRNA105 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 65 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 65. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA106 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown as SEQ ID NO. 66, and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown as SEQ ID NO. 66. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, double-stranded ribonucleic acid is siRNA107 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 67 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 67. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is siRNA108 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 68 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 68. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 109 to 110 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown as SEQ ID NO. 560 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown as SEQ ID NO. 560. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 21 consecutive nucleotides of the sequence shown as SEQ ID NO. 560 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 21 consecutive nucleotides of the sequence shown as SEQ ID NO. 560. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 23 consecutive nucleotides of the sequence shown as SEQ ID NO. 560 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 23 consecutive nucleotides of the sequence shown as SEQ ID NO. 560. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 171 to 179 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 568 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 568. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 21 consecutive nucleotides of the sequence shown in SEQ ID NO. 568 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 21 consecutive nucleotides of the sequence shown in SEQ ID NO. 568. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 568 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 23 consecutive nucleotides of the sequence shown in SEQ ID NO. 568. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 180 to 182 and 318 to 325 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is SEQ ID NO:569 as set forth in sequence A of 19 consecutive nucleotides and the nucleotide sequence of the antisense strand is SEQ ID NO:569 as set forth in sequence B of 19 consecutive nucleotides in reverse complement. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is an siRNA183 shown in table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 562, and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 562. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 184 to 188 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is SEQ ID NO. 563 as set forth in sequence A of 19 consecutive nucleotides and the nucleotide sequence of the antisense strand is SEQ ID NO. 563 as set forth in sequence B of 19 consecutive nucleotides in reverse complement. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
In some embodiments, the nucleotide sequence of the sense strand is sequence A consisting of 21 consecutive nucleotides of the sequence shown as SEQ ID NO. 563 and the nucleotide sequence of the antisense strand is sequence B which is reverse complement of the sequence consisting of 21 consecutive nucleotides of the sequence shown as SEQ ID NO. 563. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
In some embodiments, the nucleotide sequence of the sense strand is sequence A consisting of 23 consecutive nucleotides of the sequence shown as SEQ ID NO. 563 and the nucleotide sequence of the antisense strand is sequence B which is reverse complement of the sequence consisting of 23 consecutive nucleotides of the sequence shown as SEQ ID NO. 563. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 189, 326-334 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown as SEQ ID NO. 564 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown as SEQ ID NO. 564. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 21 consecutive nucleotides of the sequence shown as SEQ ID NO. 564 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 21 consecutive nucleotides of the sequence shown as SEQ ID NO. 564. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 190 to 197 and 335 to 338 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown as SEQ ID NO. 565 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown as SEQ ID NO. 565. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 23 consecutive nucleotides of the sequence shown as SEQ ID NO. 565 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 23 consecutive nucleotides of the sequence shown as SEQ ID NO. 565. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 198, 339-343 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 566 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 19 consecutive nucleotides of the sequence shown in SEQ ID NO. 566. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
In some embodiments, the nucleotide sequence of the sense strand is a sequence A consisting of 21 consecutive nucleotides of the sequence shown in SEQ ID NO. 566 and the nucleotide sequence of the antisense strand is a sequence B that is reverse complement of the sequence consisting of 21 consecutive nucleotides of the sequence shown in SEQ ID NO. 566. And, the 3' ends of the sense strand and the antisense strand each have 2 protruding nucleotides extending out of the double-stranded region.
Illustratively, the double-stranded ribonucleic acid is any one of the siRNAs 168-169, 200, 202, 344-350 shown in Table 1.
In some embodiments, the nucleotide sequence of the sense strand is SEQ ID NO:567 as set forth in sequence A of 19 consecutive nucleotides and the nucleotide sequence of the antisense strand is SEQ ID NO:567 as set forth in sequence B of 19 consecutive nucleotides in reverse complement. And, both the sense strand and the 3' -end of the antisense strand form blunt ends.
Illustratively, the double-stranded ribonucleic acid is an siRNA170 shown in table 1.
In some specific embodiments, the sense strand comprises a nucleotide sequence set forth in any one of SEQ ID NOs 69-178, 376-411, 570-602, and the antisense strand comprises a nucleotide sequence set forth in any one of SEQ ID NOs 179-288, 412-447, 603-635.
In some specific embodiments, the sense strand comprises the nucleotide sequence set forth in any one of SEQ ID NOs 289-298 and the antisense strand comprises the nucleotide sequence set forth in any one of SEQ ID NOs 299-308.
In some specific embodiments, the double-stranded ribonucleic acid is selected from any one of the siRNAs as shown in Table 1 or Table 1-1. The siRNA provided by the disclosure has high specificity of combining with target mRNA (HMGB 1 mRNA), has better silencing activity of the target mRNA, can obviously inhibit HMGB1 gene expression, and is used for treating HMGB 1-related diseases including nonalcoholic steatohepatitis, sepsis, arthritis, colitis, acute lung injury, colorectal cancer, gastric cancer, myelodysplastic syndrome, acute myeloid leukemia, chronic granulocytic leukemia, acute lymphoblastic leukemia, lymphoma, multiple myeloma, atherosclerosis and the like.
In some embodiments, the present disclosure provides an siRNA composition comprising any one or a combination of two or more of the sirnas shown in table 1 or table 1-1.
In some embodiments, each nucleotide of the sense strand is a modified nucleotide or an unmodified nucleotide, independently of the other. In some embodiments, each nucleotide of the antisense strand is a modified nucleotide or an unmodified nucleotide independently of the other.
In some embodiments, any two nucleotides linked in the sense strand are linked by a phosphodiester linkage or a phosphorothioate linkage. In some embodiments, any two nucleotides linked in the antisense strand are linked by a phosphodiester linkage or a phosphorothioate linkage.
In some embodiments, the 5' terminal nucleotide of the sense strand is linked to a 5' phosphate group or a 5' phosphate derivative group. In some embodiments, the 5' terminal nucleotide of the antisense strand is linked to a 5' phosphate group or a 5' phosphate derivative group.
Exemplary, the structure of the 5' phosphate group is:the structure of the 5' phosphate derivative group includes, but is not limited to:etc.
The nucleotide at the 5' end of the sense or antisense strand is linked to a 5' phosphate group or 5' phosphate derivative group to form the structure shown below:
wherein Base represents a Base, such as A, U, G, C or T. R ' is hydroxy or substituted with various groups known to those skilled in the art, e.g., 2' -fluoro (2 ' -F) modified nucleotides, 2' -alkoxy modified nucleotides, 2'-substituted alkoxy modified nucleotide, 2' -alkyl modified nucleotide, 2' -substituted alkyl modified nucleotide, 2' -deoxyribonucleotide.
Double-stranded ribonucleic acid modifier
A second aspect of the present disclosure provides a double-stranded ribonucleic acid modification. Further, the double-stranded ribonucleic acid modification is an siRNA modification. The siRNA modifier can improve the stability of siRNA while keeping higher HMGB1 mRNA inhibition activity.
In some embodiments, the double-stranded ribonucleic acid modification comprises a modification of at least one nucleotide. The modification of the nucleotide is at least one selected from the group consisting of modification of a ribose group and modification of a base. In some embodiments, "modification of a nucleotide" refers to a nucleotide or nucleotide derivative in which the hydroxyl group at the 2' -position of the ribose group of the nucleotide is replaced with another group, or a nucleotide in which the base on the nucleotide is a modified base. The nucleotide modification does not result in a significant impairment or loss of the function of the siRNA to inhibit gene expression. For example, modified nucleotides disclosed in J.K.Watts, G.F.Deleavey, and M.J.damha, chemically modified siRNA: tools and applications. Drug discovery Today,2008,13 (19-20): 842-55 may be selected. The stability of siRNA can be improved through the modification of nucleotide, and the high inhibition efficiency of the siRNA to HMGB1 gene can be maintained.
Illustratively, the modified nucleotide has the structure shown below:
Wherein Base represents a Base, such as A, U, G, C or T. The hydroxyl group at the 2' -position of the ribose group is substituted by R. The hydroxyl group at the 2 '-position of these ribosyl groups may be substituted with various groups known to those skilled in the art, for example, 2' -fluoro (2 '-F) modified nucleotides, 2' -alkoxy modified nucleotides, 2 '-substituted alkoxy modified nucleotides, 2' -alkyl modified nucleotides, 2 '-substituted alkyl modified nucleotides, 2' -deoxyribonucleotides.
In some embodimentsIn which the 2 '-alkoxy-modified nucleotide is 2' -methoxy (2 '-OMe,2' -O-CH) 3 ) Modified nucleotides, and the like.
In some embodiments, the 2' -substituted alkoxy-modified nucleotide is 2' -methoxyethoxy (2 ' -O-CH) 2 -CH 2 -O-CH 3 ) Modified nucleotides, 2' -O-CH 2 -CH＝CH 2 Modified nucleotides, and the like.
In some embodiments, the 2 '-substituted alkyl modified nucleotide is 2' -CH 2 -CH 2 -CH＝CH 2 Modified nucleotides, and the like.
In some embodiments, the modification of a nucleotide is a modification of a base. The modification of the base may be of various types known to those skilled in the art. Exemplary modifications of bases include, but are not limited to, m 6 A、Ψ、m 1 A、m 5 A、ms 2 i 6 A、i 6 A、m 3 C、m 5 C、ac 4 C、m 7 G、m 2,2 G、m 2 G、m 1 G、Q、m 5 U、mcm 5 U、ncm 5 U、ncm 5 Um、D、mcm 5 s 2 U、Inosine(I)、hm 5 C、s 4 U、s 2 U, azobenzene, cm, um, gm, t 6 A、yW、ms 2 t 6 A or a derivative thereof.
In some embodiments, a nucleotide derivative refers to a compound that is capable of replacing a nucleotide in a nucleic acid, but that differs in structure from an adenine ribonucleotide, a guanine ribonucleotide, a cytosine ribonucleotide, a uracil ribonucleotide, or a thymine deoxyribonucleotide. In some embodiments, the nucleotide derivative may be an iso-nucleotide, a bridged nucleotide (bridged nucleic acid, abbreviated BNA), or an acyclic nucleotide. BNA refers to a constrained or inaccessible nucleotide. BNA may contain a five-, six-, or seven-membered ring bridging structure with "fixed" C3' -endo-saccharides tucked. The bridge is typically incorporated at the 2'-, 4' -position of the ribose to provide a 2',4' -BNA nucleotide, such as LNA, ENA, cET, and the like.
LNA is shown in formula (1), ENA is shown in formula (2), and cET is shown in formula (3):
acyclic nucleotides are a class of nucleotides in which the sugar ring of the nucleotide is opened, such as an Unlocking Nucleic Acid (UNA) or a Glycerolipid Nucleic Acid (GNA), wherein UNA is represented by formula (4), and GNA is represented by formula (5):
/>
in the above formula (4) and formula (5), R is selected from H, OH or alkoxy (O-alkyl).
In some embodiments, nucleotide derivative modifications refer to the substitution of a nucleotide in a nucleic acid for a nucleotide derivative. Illustratively, the nucleotide derivative is selected from the group consisting of an isopucleotide, LNA, ENA, cET, UNA or GNA.
In some embodiments, the nucleotides in the nucleic acid are replaced with an isonucleotide, also referred to as an isonucleoside modification in the context of the present disclosure. In some embodiments, the modification of the isonucleoside comprises incorporating the isonucleoside at one or more sites in the sense strand and/or the antisense strand of the siRNA to be modified in place of the natural nucleoside for coupling at the corresponding position.
In some embodiments, the modification of the isonucleoside uses a D-isonucleoside modification. In other embodiments, the modification of the isonucleoside is an L-isonucleoside modification. In still other embodiments, the modification of the isonucleoside uses a D-modification of the isonucleoside and a L-modification of the isonucleoside.
In some embodiments, the double-stranded ribonucleic acid modification comprises a modification of a phosphodiester bond at least one position. In some embodiments, modification of the phosphodiester linkage refers to substitution of at least one oxygen atom in the phosphodiester linkage with a sulfur atom to form a phosphorothioate linkage. Phosphorothioate linkages stabilize the double-stranded structure of the siRNA, preserving base pairing specificity. Exemplary phosphorothioate diester linkages are shown below:
in some embodiments, the double-stranded ribonucleic acid modification comprises a chemical modification of at least one of:
(1) Modification of at least one nucleotide in the sense strand,
(2) Modification of the phosphodiester bond in at least one position in the sense strand,
(3) Modification of at least one nucleotide in the antisense strand,
(4) Modification of the phosphodiester bond in at least one position in the antisense strand.
Further, the double-stranded ribonucleic acid modification is an siRNA modification comprising at least one of the chemical modifications of (1) to (4).
In the present disclosure, after sequence a in the sense strand is complementary to sequence B in the antisense strand to form a double-stranded region, the 3' ends of sequence a and sequence B may be any of the following:
(1) The 3' -ends of the sequence A and the sequence B form blunt ends;
(2) The 3 'end of sequence a has 1-2 protruding nucleotides extending out of the double-stranded region, and the 3' end of sequence B forms a blunt end;
(3) The 3 'end of sequence B has 1-2 protruding nucleotides extending out of the double-stranded region, and the 3' end of sequence a forms a blunt end;
(4) The 3 'end of sequence A has 1-2 protruding nucleotides extending out of the double-stranded region, and the 3' end of sequence B has 1-2 protruding nucleotides extending out of the double-stranded region.
In some embodiments, the nucleotide sequence of the sense strand is the sequence shown in sequence a and the nucleotide sequence of the antisense strand is the sequence shown in sequence B.
In some embodiments, when there are no protruding nucleotides at the 3 'ends of the sense strand and the antisense strand after the nucleotide sequences of the sense strand and the antisense strand are complementary to form a double-stranded region, 1-2 nucleotides are added as protruding nucleotides at the 3' end of at least one of the sense strand and the antisense strand. Wherein 1-2 nucleotides linked to the 3 '-end of the sense strand constitute the sequence D and 1-2 nucleotides linked to the 3' -end of the antisense strand constitute the sequence E. Correspondingly, the nucleotide sequence of the sense strand is the sequence shown in the sequence A and the connection sequence D, and the nucleotide sequence of the antisense strand is the sequence shown in the sequence B and the connection sequence E. Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B and sequence E. Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A and the sequence shown in sequence D, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B.
Illustratively, 2 deoxyribonucleotides (TT) are added as sequence D at the 3 'end of the sense strand and 2 deoxyribonucleotides (TT) are added as sequence E at the 3' end of the antisense strand. Alternatively, 2 deoxyribonucleotides (TT) were added as sequence E only at the 3' -end of the antisense strand. Alternatively, 2 deoxyribonucleotides (TT) were added as sequence D only at the 3' -end of the sense strand.
In some embodiments, when there are no protruding nucleotides at the 3 'end of the sense strand after the sense strand is complementary to the nucleotide sequence of the antisense strand to form a double-stranded region, a sequence D consisting of 1-2 nucleotides is added at the 3' end of the sense strand as the protruding nucleotide. Then, when the nucleotide sequence formed by ligating the sequence A to the sequence D is subjected to chemical modification, the sequence D consisting of 1 to 2 nucleotides is excluded. Correspondingly, in the double-stranded ribonucleic acid modification, the nucleotide sequence of the sense strand is the sequence shown in the sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in the sequence B. Alternatively, in the double-stranded ribonucleic acid modification, the nucleotide sequence of the sense strand is the sequence shown in sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B and the connecting sequence E.
In some embodiments, when sequence a has 1-2 nucleotides protruding from the 3 'end of sequence a beyond the double-stranded region after complementary formation of the double-stranded region with sequence B, the protruding nucleotide at the 3' end of sequence a is excluded as the nucleotide sequence of the sense strand. The sequence of the nucleotide excluding the 3 '-end overhang is called sequence A'. Correspondingly, the nucleotide sequence of the sense strand of the double-stranded ribonucleic acid modification is the sequence shown in the sequence A', and the nucleotide sequence of the antisense strand of the double-stranded ribonucleic acid modification is the sequence shown in the sequence B. Alternatively, the nucleotide sequence of the sense strand of the double-stranded ribonucleic acid modification is the sequence shown in sequence A', and the nucleotide sequence of the antisense strand of the double-stranded ribonucleic acid modification is the sequence shown in sequence B-linked sequence E.
In some embodiments, the sense strand of the siRNA modification comprises the following modifications in the 5 'to 3' terminal direction: ribonucleotides at positions 7, 9, 10 and 11 in the sense strand are 2' -fluoro modified ribonucleotides; the ribonucleotides at other positions in the sense strand are 2' -methoxy modified ribonucleotides.
In some embodiments, the sense strand of the siRNA modification comprises phosphorothioate linkages at the positions shown below, in the direction of the 5 'end towards the 3' end: between nucleotide 1 and nucleotide 2, between nucleotide 2 and nucleotide 3, between nucleotide 1 and nucleotide 2, and between nucleotide 2 and nucleotide 3.
In some embodiments, the sense strand of the siRNA modification comprises phosphorothioate linkages at the positions shown below, in the direction of the 5 'end towards the 3' end: between nucleotide 1 and nucleotide 2 from the 5 'end, and between nucleotide 2 and nucleotide 3 from the 5' end.
In some specific embodiments, the sense strand of the siRNA modification has a sequence as set forth in (a 1 )-(a 3 ) The structure shown in any one of:
(a 1 )5’-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’，
(a 2 )5’-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’，
(a 3 )5’-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’；
wherein N is 1 -N 23 Independently of one another, from ribonucleotides of base A, U, C or G, the capital letter T representing the deoxyribonucleotide of base thymine and the lowercase letter m representing the adjacent ribonucleotide to the right of the letter m being 2' -O-CH 3 Modified ribonucleotide, lowercase letter F indicates that one ribonucleotide adjacent to the left side of the letter F is a 2' -F modified ribonucleotide, -(s) -indicates that two nucleotides adjacent to one another are linked by a phosphorothioate linkage.
In other specific embodiments, the sense strand of the siRNA modification has a sequence as set forth in (a 4 )-(a 5 ) The structure shown in any one of:
(a 4 )5’-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3’，
(a 5 )5’-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -3’；
wherein N is 1 -N 23 Independently of one another, from ribonucleotides of base A, U, C or G, the capital letter T representing the deoxyribonucleotide of base thymine and the lowercase letter m representing the adjacent ribonucleotide to the right of the letter m being 2' -O-CH 3 Modified ribonucleotide, lowercase letter F indicates that one ribonucleotide adjacent to the left side of the letter F is a 2' -F modified ribonucleotide, -(s) -indicates that two nucleotides adjacent to one another are linked by a phosphorothioate linkage.
In some embodiments, the antisense strand of the siRNA modification comprises modifications in the 5 'to 3' terminal direction as follows: the ribonucleotide at any odd number position in the antisense strand is a 2 '-methoxy modified ribonucleotide, and the ribonucleotide at any even number position in the antisense strand is a 2' -fluoro modified ribonucleotide.
In some embodiments, the antisense strand of the siRNA modification comprises modifications in the 5 'to 3' terminal direction as follows: the ribonucleotides at positions 2, 6, 14 and 16 in the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the rest positions in the antisense strand are 2' -O-CH 3 Modified ribonucleotides.
In some embodiments, the antisense strand of the siRNA modification comprises modifications in the 5 'to 3' terminal direction as follows: the ribonucleotides at positions 2, 6, 8, 9, 14 and 16 in the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the rest positions in the antisense strand are 2' -O-CH 3 Modified ribonucleotides.
In some embodiments, the ribonucleotides at positions 2, 14 and 16 in the antisense strand are 2' -F modified ribonucleotides in the direction of the 5' terminus to the 3' terminus, and the ribonucleotide at position 6 in the antisense strand is a nucleotide derivativeGNA-modified ribonucleotides, the ribonucleotides in the rest of the antisense strand being 2' -O-CH 3 Modified ribonucleotides.
In some embodiments, the antisense strand of the siRNA modification comprises modifications in the 5 'to 3' terminal direction as follows: the ribonucleotides at the 2 nd, 6 th, 14 th and 16 th positions in the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at the 7 th position in the antisense strand is a nucleotide derivative GNA modified ribonucleotide, and the ribonucleotides at the rest positions in the antisense strand are 2' -O-CH 3 Modified ribonucleotides.
In some embodiments, the antisense strand of the siRNA modification comprises phosphorothioate linkages at the positions shown below, in the direction of the 5 'end toward the 3' end: between nucleotide 1 and nucleotide 2, between nucleotide 2 and nucleotide 3, between nucleotide 1 and nucleotide 2, and between nucleotide 2 and nucleotide 3.
In some embodiments, the nucleotide at the 5' end of the antisense strand is linked to a 5' phosphate group or a 5' phosphate derivative group in a direction from the 5' end to the 3' end. Exemplary, the structure of the 5' phosphate group is:the structure of the 5' phosphate derivative group includes, but is not limited to: />(EVP)，/>Etc.
In some specific embodiments, the siRNA modifier antisense strand has the following (b 1 )-(b 15 ) The structure shown in any one of:
(b 1 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -N 4 f-mN 5 -N 6 f-mN 7 -N 8 f-mN 9 -N 10 f-mN 11 -N 12 f-mN 13 -N 14 f-m N 15 -N 16 f-mN 17 -N 18 f-mN 19 -(s)-T-(s)-T-3’，
(b 2 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -N 4 f-mN 5 -N 6 f-mN 7 -N 8 f-mN 9 -N 10 f-mN 11 -N 12 f-mN 13 -N 14 f-m N 15 -N 16 f-mN 17 -N 18 f-mN 19 -(s)-N 20 f-(s)-mN 21 -3’，
(b 3 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -N 4 f-mN 5 -N 6 f-mN 7 -N 8 f-mN 9 -N 10 f-mN 11 -N 12 f-mN 13 -N 14 f-m N 15 -N 16 f-mN 17 -N 18 f-mN 19 -N 20 f-mN 21 -(s)-N 22 f-(s)-mN 23 -3’，
(b 4 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’，
(b 5 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’，
(b 6 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’，
(b 7 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -N 8 f-N 9 f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’，
(b 8 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -N 8 f-N 9 f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’，
(b 9 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -N 8 f-N 9 f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’，
(b 10 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -[GNA]N 6 -mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’，
(b 11 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -[GNA]N 6 -mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’，
(b 12 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -[GNA]N 6 -mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’，
(b 13 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-[GNA]N 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’，
(b 14 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-[GNA]N 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’，
(b 15 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-[GNA]N 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’；
wherein N is 1 -N 23 Independently of each other, from ribonucleotides of base A, U, C or GThe capital letter T indicates a deoxyribonucleotide with a thymine base, and the lowercase letter m indicates that one ribonucleotide adjacent to the right side of the letter m is 2' -O-CH 3 Modified ribonucleotide, lowercase letter F indicates that one ribonucleotide adjacent to the left side of the letter F is a 2'-F modified ribonucleotide, P1 indicates that one nucleotide adjacent to the right side of the letter is a 5' -phosphonucleotide, -(s) -indicates that two nucleotides adjacent to the front and rear are linked by a phosphorothioate diester linkage, [ GNA ] ]Indicating that the adjacent ribonucleotide on the right hand side is the ribonucleotide with the GNA modification.
In some alternative embodiments, the sense strand comprises a nucleotide sequence set forth in any one of SEQ ID NOS 309-342, 448-470, and the antisense strand comprises a nucleotide sequence set forth in any one of SEQ ID NOS 343-363, 471-556, 636-654.
In some embodiments, double stranded ribonucleic acid modifications include, but are not limited to, siRNA modifications as shown in table 2.
Double-stranded ribonucleic acid conjugate
A third aspect of the present disclosure provides a double-stranded ribonucleic acid conjugate, which is obtained by conjugation of the double-stranded ribonucleic acid provided in the first aspect of the present disclosure or the double-stranded ribonucleic acid modified provided in the second aspect with a conjugation group.
In the present disclosure, the sense strand and the antisense strand of the double-stranded ribonucleic acid conjugate form a double-stranded region of the double-stranded ribonucleic acid conjugate, and a blunt end is formed at the 3' -end of the sense strand of the double-stranded ribonucleic acid conjugate. In some embodiments, the 3 'end of the sense strand of the double-stranded ribonucleic acid conjugate forms a blunt end, and the 3' end of the antisense strand of the double-stranded ribonucleic acid conjugate has 1-2 protruding nucleotides extending out of the double-stranded region. In other embodiments, the 3 'end of the sense strand of the double-stranded ribonucleic acid conjugate forms a blunt end and the 3' end of the antisense strand of the double-stranded ribonucleic acid conjugate forms a blunt end.
In some preferred embodiments, the double-stranded ribonucleic acid conjugate is obtained by a conjugated linkage of a double-stranded ribonucleic acid modification to a conjugate group. Wherein the sense strand and the antisense strand of the double-stranded ribonucleic acid modification are complementary to form a double-stranded region of the double-stranded ribonucleic acid modification, and the 3 '-end of the sense strand of the double-stranded ribonucleic acid modification forms a blunt end, and the conjugate group is conjugated to the 3' -end of the sense strand having the blunt end to form a double-stranded ribonucleic acid conjugate.
Illustratively, the sense strand of the double-stranded ribonucleic acid modification is the sequence shown in sequence a, and the antisense strand is the sequence shown in sequence B linked to sequence E. And, the 3 '-end of the sense strand of the double-stranded ribonucleic acid modification forms a blunt end, and the 3' -end of the sense strand of the double-stranded ribonucleic acid modification is linked to a conjugate group, forming a double-stranded ribonucleic acid conjugate.
Illustratively, the sense strand of the double-stranded ribonucleic acid modification is the sequence shown in sequence a and the antisense strand is the sequence shown in sequence B. And, the 3 '-end of the sense strand of the double-stranded ribonucleic acid modification forms a blunt end, and the 3' -end of the sense strand of the double-stranded ribonucleic acid modification is connected with a conjugate group to form a double-stranded ribonucleic acid conjugate.
Illustratively, the sense strand of the double-stranded ribonucleic acid modification is the sequence shown by sequence a linked to sequence D and the antisense strand is the sequence shown by sequence B linked to sequence E. The 3' -end of the sense strand of the double-stranded ribonucleic acid modification has a sequence D consisting of 1-2 protruding nucleotides, and the 3' -end of the sense strand of the double-stranded ribonucleic acid modification is removed from the sequence D, and then a conjugate group is attached to the 3' -end of the sequence A to form a double-stranded ribonucleic acid conjugate.
Illustratively, the sense strand of the double-stranded ribonucleic acid modification is the sequence shown in sequence a linked to sequence D and the antisense strand is the sequence shown in sequence B. The 3' -end of the sense strand of the double-stranded ribonucleic acid modification has a sequence D consisting of 1-2 protruding nucleotides, and the 3' -end of the sense strand of the double-stranded ribonucleic acid modification is removed from the sequence D, and then a conjugate group is attached to the 3' -end of the sequence A to form a double-stranded ribonucleic acid conjugate.
Illustratively, the sense strand of the double-stranded ribonucleic acid modification is the sequence shown in sequence a, and the antisense strand is the sequence shown in sequence B linked to sequence E. Wherein the 3' -end of the sequence A has a protruding nucleotide extending out of the double-stranded region, and the sequence (also called sequence A ') from which the protruding nucleotide located at the 3' -end in the sequence A is excluded is used as the nucleotide sequence for the linking conjugate group. Thus, the nucleotide sequence of the sense strand of the double-stranded ribonucleic acid conjugate is the sequence shown as sequence A', and the nucleotide sequence of the antisense strand is the sequence shown as sequence B linked to sequence E.
Illustratively, the sense strand of the double-stranded ribonucleic acid modification is the sequence shown in sequence a and the antisense strand is the sequence shown in sequence B. Wherein the 3' -end of the sequence A has a protruding nucleotide extending out of the double-stranded region, and the sequence (also called sequence A ') from which the protruding nucleotide located at the 3' -end in the sequence A is excluded is used as the nucleotide sequence for the linking conjugate group. Thus, the nucleotide sequence of the sense strand of the double-stranded ribonucleic acid conjugate is the sequence shown as sequence a', and the nucleotide sequence of the antisense strand is the sequence shown as sequence B.
In some alternative embodiments, the sense strand of the double-stranded ribonucleic acid conjugate has a sequence as shown in (d 1 )-(d 2 ) The structure shown in any one of:
(d 1 )5’-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -L96-3’，
(d 2 )5’-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -L96-3’；
wherein N is 1 -N 23 Independently of one another, from ribonucleotides of base A, U, C or G, the capital letter T representing the baseThe deoxyribonucleotide being thymine, the lower case letter m indicates that one ribonucleotide adjacent to the right of the letter m is 2' -O-CH 3 Modified ribonucleotide, lowercase letter F indicates that one ribonucleotide adjacent to the left side of the letter F is a 2' -F modified ribonucleotide, -(s) -indicates that two nucleotides adjacent to one another are linked by a phosphorothioate linkage. L96 is also the conjugate group GalNAc of formula I.
In some alternative embodiments, the antisense strand of the double-stranded ribonucleic acid conjugate has a sequence as shown in (b 1 )-(b 15 ) The structure shown in any one of:
(b 1 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -N 4 f-mN 5 -N 6 f-mN 7 -N 8 f-mN 9 -N 10 f-mN 11 -N 12 f-mN 13 -N 14 f-m N 15 -N 16 f-mN 17 -N 18 f-mN 19 -(s)-T-(s)-T-3’，
(b 2 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -N 4 f-mN 5 -N 6 f-mN 7 -N 8 f-mN 9 -N 10 f-mN 11 -N 12 f-mN 13 -N 14 f-m N 15 -N 16 f-mN 17 -N 18 f-mN 19 -(s)-N 20 f-(s)-mN 21 -3’，
(b 3 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -N 4 f-mN 5 -N 6 f-mN 7 -N 8 f-mN 9 -N 10 f-mN 11 -N 12 f-mN 13 -N 14 f-m N 15 -N 16 f-mN 17 -N 18 f-mN 19 -N 20 f-mN 21 -(s)-N 22 f-(s)-mN 23 -3’，
(b 4 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’，
(b 5 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’，
(b 6 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’，
(b 7 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -N 8 f-N 9 f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’，
(b 8 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -N 8 f-N 9 f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’，
(b 9 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -N 8 f-N 9 f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’，
(b 10 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -[GNA]N 6 -mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’，
(b 11 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -[GNA]N 6 -mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’，
(b 12 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -[GNA]N 6 -mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’，
(b 13 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-[GNA]N 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -m N 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’，
(b 14 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-[GNA]N 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -m N 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’，
(b 15 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-[GNA]N 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -m N 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’；
wherein N is 1 -N 23 Independently of one another, from ribonucleotides of base A, U, C or G, the capital letter T representing the deoxyribonucleotide of base thymine and the lowercase letter m representing the adjacent ribonucleotide to the right of the letter m being 2' -O-CH 3 Modified ribonucleotide, lowercase letter F indicates that one ribonucleotide adjacent to the left side of the letter F is a 2'-F modified ribonucleotide, P1 indicates that one nucleotide adjacent to the right side of the letter is a 5' -phosphonucleotide, -(s) -indicates that two nucleotides adjacent to the front and rear are linked by a phosphorothioate diester linkage, [ GNA ]]Indicating that the adjacent ribonucleotide on the right hand side is the ribonucleotide with the GNA modification.
Further, the double-stranded ribonucleic acid conjugate is an siRNA conjugate, wherein the siRNA molecule of the siRNA conjugate attached to the conjugate group may be an unmodified siRNA, or an siRNA modification. The siRNA molecule modified by the conjugate group has better tissue and organ targeting and capability of promoting endocytosis while maintaining higher inhibition activity and stability, can reduce the influence on other tissues or organs and the use amount of the siRNA molecule, and can achieve the aims of reducing toxicity and cost. Alternatively, any one of the siRNA molecules shown in Table 1 or Table 1-1 or Table 2 is selected to be linked to a conjugate group to obtain a double-stranded ribonucleic acid conjugate.
The conjugation site of the siRNA to the conjugation group may be at the 3' end or the 5' end of the sense strand of the siRNA, or at the 5' end of the antisense strand, or in the internal sequence of the siRNA. In some embodiments, the conjugation site of the siRNA to the conjugation group is at the 3' end of the sense strand of the siRNA.
In some embodiments, the conjugate group may be attached to the phosphate group, the 2' -hydroxyl group, or the base of the nucleotide. In some embodiments, the conjugate group may also be attached to the 3' -hydroxyl group, in which case the nucleotides are linked using a 2',5' -phosphodiester linkage. When a conjugate group is attached to the end of the siRNA strand, the conjugate group is typically attached to the phosphate group of the nucleotide; when a conjugate group is attached to the internal sequence of the siRNA, the conjugate group is typically attached to a ribose sugar ring or base. Various connection means can be referred to as: muthiah Manoharan et al, siRNA conjugates carrying sequentially assembled trivalent N-acetylgalactosamine linked through nucleosides elicit robust gene silencing in vivo in hepatocytocytocytosis, ACS Chemical biology,2015,10 (5): 1181-7.
In the present disclosure, the conjugate group may be a ligand conventionally used in the field of siRNA administration. In some embodiments, the conjugate group may be selected from one or more of the following ligands formed by the targeting molecule or derivative thereof: lipophilic molecules, such as cholesterol, bile acids, vitamins (e.g. vitamin E), lipid molecules of different chain lengths; polymers, such as polyethylene glycol; polypeptides, such as permeabilizing peptides; an aptamer; an antibody; a quantum dot; sugars, such as lactose, mannose, galactose, N-acetylgalactosamine (GalNAc); folic acid (folate); receptor ligands expressed by hepatic parenchymal cells, such as asialoglycoproteins, asialoglycoresidues, lipoproteins (e.g., high density lipoproteins, low density lipoproteins, etc.), glucagon, neurotransmitters (e.g., epinephrine), growth factors, transferrin, etc.
In some specific embodiments, the conjugate group has the structure shown below:
the conjugate group shown in the formula I is GalNAc, the GalNAc has liver targeting property, siRNA molecules can be delivered into liver tissues with high specificity, and high expression of HMGB1 genes in the liver can be specifically inhibited.
In some specific embodiments, galNAc is conjugated to the 3' end of the sense strand via a phosphodiester linkage to provide an siRNA conjugate of the structure shown below:
wherein the double helix structure is unmodified siRNA or siRNA modifier.
In some embodiments, double-stranded ribonucleic acid conjugates include, but are not limited to, siRNA conjugates as shown in table 3.
Pharmaceutical composition
A fourth aspect of the present disclosure provides a pharmaceutical composition comprising one or more of the double-stranded ribonucleic acid of the first aspect, the double-stranded ribonucleic acid modification of the second aspect, and the double-stranded ribonucleic acid conjugate of the third aspect.
In some embodiments, the pharmaceutical composition contains an siRNA as described above as an active ingredient and a pharmaceutically acceptable carrier. In the present disclosure, the purpose of using a pharmaceutical composition is to promote administration to a living body, facilitate absorption of an active ingredient, and further exert biological activity. The pharmaceutical compositions of the present disclosure may be administered by any form, including injection (intra-arterial, intravenous, intramuscular, intraperitoneal, subcutaneous), mucosal, oral (oral solid, oral liquid), rectal, inhalation, implant, topical (e.g., ocular) administration, and the like. Non-limiting examples of oral solid formulations include, but are not limited to, powders, capsules, lozenges, granules, tablets, and the like. Non-limiting examples of liquid formulations for oral or mucosal administration include, but are not limited to, suspensions, tinctures, elixirs, solutions, and the like. Non-limiting examples of topical formulations include, but are not limited to, emulsions, gels, ointments, creams, patches, pastes, foams, lotions, drops or serum formulations. Non-limiting examples of parenteral formulations include, but are not limited to, solutions for injection, dry powders for injection, suspensions for injection, emulsions for injection, and the like. The pharmaceutical compositions of the present disclosure may also be formulated in controlled-release or delayed-release dosage forms (e.g., liposomes or microspheres).
In the present disclosure, the route of administration can be varied or adjusted in any suitable manner to meet the needs of the nature of the drug, the convenience of the patient and medical personnel, and other relevant factors.
Medical application
A fifth aspect of the present disclosure provides for at least one of the following uses of a double-stranded ribonucleic acid, a double-stranded ribonucleic acid modification, or a double-stranded ribonucleic acid conjugate:
(1) Inhibiting HMGB1 gene expression, or preparing a medicament for inhibiting HMGB1 gene expression;
(2) For preventing or treating diseases related to the abnormal expression of the HMGB1 gene, or for preparing a medicament for preventing or treating diseases related to the abnormal expression of the HMGB1 gene;
(3) For use in treating a subject suffering from a disease that would benefit from reduced HMGB1 gene expression, or in the manufacture of a medicament for use in treating a subject suffering from a disease that would benefit from reduced HMGB1 gene expression.
The present disclosure further provides the use of an siRNA molecule (including unmodified siRNA, siRNA modification, siRNA conjugate) or a pharmaceutical composition in at least one of (1) - (3) above.
In the present disclosure, HMGB1 gene is aberrantly expressed, causing one or more of the following HMGB1 gene-aberrantly expressed related diseases: nonalcoholic steatohepatitis, sepsis, arthritis, colitis, acute lung injury, colorectal cancer, gastric cancer, myelodysplastic syndrome, acute myeloid leukemia, chronic myelogenous leukemia, acute lymphoblastic leukemia, lymphoma, multiple myeloma, atherosclerosis, and the like.
The siRNA molecule causes the expression of the HMGB1 gene to be inhibited by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, effecting treatment of a disease associated with aberrant expression of the HMGB1 gene.
In some embodiments, the present disclosure provides a method of inhibiting HMGB1 gene expression in a cell comprising contacting a double-stranded ribonucleic acid, a double-stranded ribonucleic acid modification, a double-stranded ribonucleic acid conjugate, or a pharmaceutical composition with the cell.
Further, a method for inhibiting the expression of HMGB1 gene in a cell is to introduce an siRNA molecule (including unmodified siRNA, siRNA modification, siRNA conjugate) or a pharmaceutical composition into the cell.
In some embodiments, the cell is an in vivo cell or an in vitro cell. In some specific embodiments, the cell is in a subject.
In some embodiments, the present disclosure provides methods of preventing or treating a disease comprising administering to a subject double-stranded ribonucleic acid, a double-stranded ribonucleic acid modification, a double-stranded ribonucleic acid conjugate, or a pharmaceutical composition.
Further, the method of preventing or treating a disease is to administer an siRNA molecule (including unmodified siRNA, siRNA modification, siRNA conjugate) or a pharmaceutical composition to a subject.
In the present disclosure, "subject" includes either human or non-human animals, preferably vertebrates, and more preferably mammals. The subject may comprise a transgenic organism. Most preferably, the subject is a human. Further, the subject has at least one of the following characteristics:
(1) In vivo abnormal expression of the HMGB1 gene, more specifically abnormal high expression of the HMGB1 gene;
(2) Has a disease associated with abnormal expression of the HMGB1 gene;
(3) With diseases that would benefit from reduced HMGB1 gene expression. Such as a person suffering from or predisposed to a disease associated with aberrant expression of the HMGB1 gene.
TABLE 1siRNA sequence information
/>
/>
/>
/>
/>
/>
/>
/>
TABLE 1-1siRNA sequence information
TABLE 2siRNA modifier
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
The capital letters "G", "C", "A", "T" and "U" in the above tables each generally represent nucleotides containing guanine, cytosine, adenine, thymine and uracil, respectively, as bases; mA, mU, mC, mG: a 2-methoxy modified nucleotide; af. Gf, cf, uf: a 2' -fluoro modified nucleotide; the lower case letter s indicates that phosphorothioate linkages are between two nucleotides adjacent to the letter s; p1: the adjacent nucleotide on the right side of P1 is 5' -phosphonucleotide, [ GNA ] means that the adjacent ribonucleotide on the right side is the ribonucleotide with GNA modification.
TABLE 3siRNA conjugates
/>
/>
/>
/>
/>
The capital letters "G", "C", "A", "T" and "U" in the above tables each generally represent nucleotides "containing guanine, cytosine, adenine, thymine and uracil, respectively, as bases; mA, mU, mC, mG: a nucleotide representing 2' -methoxy modification; af. Gf, cf, uf: a 2' -fluoro modified nucleotide; the lower case letter s indicates that phosphorothioate linkages are between two nucleotides adjacent to the letter s; p1: indicating that the adjacent nucleotide to the right of P1 is a nucleotide 5' -phosphate, [ GNA ] indicates that the adjacent nucleotide to the right is a ribonucleotide with GNA modification; l96 is also the conjugate group GalNAc of formula I.
Examples
Other objects, features and advantages of the present disclosure will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating specific embodiments of the disclosure, are given by way of illustration only, since various changes and modifications within the spirit and scope of the disclosure will become apparent to those skilled in the art from this detailed description.
The experimental techniques and methods used in this example are conventional techniques unless otherwise specified, such as those not specified in the following examples, and are generally performed under conventional conditions such as Sambrook et al, molecular cloning: conditions described in the laboratory Manual (New York: cold Spring Harbor Laboratory Press, 1989) or as recommended by the manufacturer. Materials, reagents and the like used in the examples are all available from a regular commercial source unless otherwise specified.
The following examples relate to siRNA, siRNA modifications, and siRNA conjugates synthesized by Town Biotechnology (Shanghai), and the cells and reagents used in the examples are shown in Table 4:
TABLE 4 Table 4
/>
Example 1: synthesis of siRNA
1.1siRNA sequence design
According to the mRNA sequence of the human HMGB1 gene, multiple pairs of HMGB1 siRNAs are designed at different sites, all single siRNAs can target all transcripts of target genes (as shown in table 5), and the multiple pairs of siRNAs have the lowest homology with all other non-target gene sequences through sequence similarity software comparison.
TABLE 5
Target gene Species of species Gene ID NM_ID
HMGB1 Homo sapiens 3146 NM_002128.7
Target sequences for designing siRNA are shown below, the target sequences are derived from the gene mRNA sequence of HMGB1 (see nm_ 002128.7).
Target sequence I:
GCAGTACATTGAGCTCCATAGAGACAGCACCGGGGCAAGTGAGAGCCGGACGGGCACTGGGCGACTCTGTGCCTCGCTGAGGAAAAATAACTAAACATGGGCAAAGGAGATCCTAAGAAGCCGAGAGGCAAAATGTCATCATATGCATTTTTTGTGCAAACTTGTCGGGAGGAGCATAAGAAGA(SEQ ID NO:1)
target sequence I-1:
GCAGTACATTGAGCTCCAT(SEQ ID NO:17)
target sequence I-2:
GCAAAGGAGATCCTAAGAAGCCGAGAGGCAAAATGTCATCA (SEQ ID NO: 18) target sequence I-3:
AACTTGTCGGGAGGAGCATAAGAAGA(SEQ ID NO:19)
target sequence II:
CAAGGCCCGTTATGAAAGAGAAATGAAAACCTATATCCCTCCCAAAGGGGAGACAAAAAAGAAGTTCAAGGATCCCAATGCACCCAAGAGGCCTCCTTCGGCCTTCTTCCTCTTCTGCTCTGAGTATCGCCCAAAAATCAAAGGAGAACATCCTGGCCTGTCCATTGGTGATGTTGCGAAGAAACTGGGAGAGATGTGGAATAACACTGCTGCAGATGACAAGCAGCCTTATGAAAAGAAGGCTGCGAAGCTGAAGGAAAAATATGAAAAGGATATTGCTGCATATCGAGCTAAAGGAAAGCCTGATGCAGCAAAAAAGGGAGTTGTCAAGGCTGAAAAAAGCAAGAAAAAGAAGGAAGAGGAGGAAGATGAGGAAGATGAAGAGGATGAGGAGGAGGAGGAAGATGAAGAAGATGAAGATGAAGAAGAAGATGATGATGATGAATAAGTTGGTTCTAGCGCAGTTTTTTTTTT (SEQ ID NO: 2) target sequence II-1:
CAAGGCCCGTTATGAAAGA(SEQ ID NO:20)
target sequence II-2:
TCTGAGTATCGCCCAAAAA(SEQ ID NO:21)
target sequence II-3:
GACAAGCAGCCTTATGAAA(SEQ ID NO:22)
target sequence II-4:
AGCCTGATGCAGCAAAAAA(SEQ ID NO:23)
target sequence II-5:
AAGTTGGTTCTAGCGCAGTTTTTTTTTT(SEQ ID NO:24)
target sequence III:
TGCAGCTTATACGAAATAATTGTTGTTCTGTTAACTGAATACCACTCTGTAATTGCAAAAAAAAAAAAAAAGTTGCAGCTGTTTTGTTGACATTCTGAATGCTTCTAAGTAAATACAATTTTTTTTATTAGTATTGTTGTCCTTTTCATAGGTCTGAAATTTTTCTTCTTGAGGGGAAGCTAGTCTTTTGCTTTTGCCCATTTTGAATCACATGAATTATTACAGTGTTTATCCTTTCATATAGTTAGCTA(SEQ ID NO:3)
target sequence III-1:
TGCAGCTTATACGAAATAATTGTTGTTCTGTTAACTGAATACCACTCTGTAAT T(SEQ ID NO:25)
target sequence III-2:
TTGAGGGGAAGCTAGTCTTTTGCTTTTGC(SEQ ID NO:26)
target sequence III-3:
CCTTTCATATAGTTAGCTA(SEQ ID NO:27)
target sequence IV:
AACATCCAAAATCTTGATCAGTTAAGAAATTTCACATAGCCCACTTACATTTACAAACTGAAGAGTAATCAATCTACTCAAAGCATGGGATTATTAGAATCAAACATTTTGAAAGTCTGTCCTTGAAGGACTAATAGAAAAGTATGTTCTAACCTTTACATGAGGACTCTATTCT(SEQ ID NO:4)
target sequence IV-1:
AACATCCAAAATCTTGATCAGTTAAG(SEQ ID NO:28)
target sequence IV-2:
ACATAGCCCACTTACATTTACAAACTGAAGAGTAATCAATCTACTCAAAGC(SEQ ID NO:29)
target sequence IV-3:
TCTGTCCTTGAAGGACTAATAGAAAAGTATGTTCTAACCTTTACATGAGGACT CTATTCT(SEQ ID NO:30)
target sequence V:
CCAAAAGCGTGAGCTTAAAATACAAGACTGCCATATTAAATTTTTTGTTGACATTAGTCTCAGTGAAGACTATGAAAATGCTGGCTATAGATGTCTTTTCCCATTTATCTAAATATGGACTGCTCAGGAAACGAGACTTTCCATTACAAGTATTTTTAATTAATTGGGCCAGCTTTTCAAACAAAGATGCCACATTCAAAATAGGGTATATTTTCCTATATTACGGTTTGCCCCTTTATAAATCCAAGTAGATAGGAAGAAA (SEQ ID NO: 5) target sequence V-1:
CCAAAAGCGTGAGCTTAAA(SEQ ID NO:31)
Target sequence V-2:
CAAGACTGCCATATTAAAT(SEQ ID NO:32)
target sequence V-3:
GTCTCAGTGAAGACTATGA(SEQ ID NO:33)
target sequence V-4:
GCTCAGGAAACGAGACTTT(SEQ ID NO:34)
target sequence V-5:
CAAAGATGCCACATTCAAA(SEQ ID NO:35)
target sequence V-6:
CCAAGTAGATAGGAAGAAA(SEQ ID NO:36)
target sequence VI:
GGAGTTTAGGGAACAATTTGGCAATTTTGTGGTTTTCGAGATTATCGTTTTCT TAAAGTGCCAGTATTTTAAAATAGCGTTCTTGTAATTTTACACGCTTTTGTGATGGA GTGCTGTTTTGTTATAT(SEQ ID NO:6)
target sequence VI-1:
GGAGTTTAGGGAACAATTT(SEQ ID NO:37)
target sequence VI-2:
CGAGATTATCGTTTTCTTA(SEQ ID NO:38)
target sequence VI-3:
GCGTTCTTGTAATTTTACA(SEQ ID NO:39)
target sequence VI-4:
GAGTGCTGTTTTGTTATAT(SEQ ID NO:40)
target sequence VII:
GTCCTGGATGATACTAATAAACTAATAATTGCAGAGGTTTTAAATACTAGTT AAATGGCTTTCACTTAAGAACTTA(SEQ ID NO:7)
target sequence VII-1:
GTCCTGGATGATACTAATA(SEQ ID NO:41)
target sequence VII-2:
GCTTTCACTTAAGAACTTA(SEQ ID NO:42)
target sequence VIII:
AGGTTAATGGGCTGATAAAAGGTTTTGTCAAACATTGCAAGTATTCGGTGCTATATATAAAGGAGGAAAAACTAGTTTTACTTTCAGAATGATTTAAACAAGATTTTTAAAAACAAGATACATGCAAGCGAACAGCAGGGTTAGTGATAGGCTGCAATTGTGTCGAACA(SEQ ID NO:8)
target sequence VIII-1:
AGGTTAATGGGCTGATAAA(SEQ ID NO:43)
target sequence VIII-2:
GCTATATATAAAGGAGGAA(SEQ ID NO:44)
target sequence VIII-3:
CAAGCGAACAGCAGGGTTAGTGATAGGCTGCAATTGTGTCGAACA(SEQ ID NO:45)
target sequence IX:
CCATTAATCACCAACATTAATAATTCTGATCCATTTAAAATGAATTCTGGCTC AAGGAGAATTTGTAACTTTAGTAGGTACGTCATGACAACTA (SEQ ID NO: 9) target sequence IX-1:
CCATTAATCACCAACATTA(SEQ ID NO:46)
target sequence IX-2:
AGGTACGTCATGACAACTA(SEQ ID NO:47)
target sequence X:
GTATGGTTTGGTGTTCTAACAGTATCCCCTAGAAGTTGGATGTCTAAAACTCA AGTA(SEQ ID NO:10)
target sequence X-1:
GTATGGTTTGGTGTTCTAA(SEQ ID NO:48)
target sequence X-2:
GATGTCTAAAACTCAAGTA(SEQ ID NO:49)
target sequence XI:
CAGTGCTGTGGGGTTTAAAGACTTTGTTGACATCAAGAAAAGACTAAATCTA TAATTAATTGGGCCAACTTTTAAAATGA(SEQ ID NO:11)
target sequence XI-1:
CAGTGCTGTGGGGTTTAAA(SEQ ID NO:50)
target sequence XI-2:
GGGCCAACTTTTAAAATGA(SEQ ID NO:51)
target sequence XII:
GGCATATGGCATATTGATTAACGAGTCAAATTTCCTAACTTTGCTGTGCAAAG GTTGAGAGCTATTGCTGATTAGTTACCACAGTTCTGATGATCGTCCCATCACAGTG TTGTTAATGTTT(SEQ ID NO:12)
target sequence XII-1:
GGCATATGGCATATTGATT(SEQ ID NO:52)
target sequence XII-2:
GAGCTATTGCTGATTAGTT(SEQ ID NO:53)
target sequence XII-3:
CACAGTGTTGTTAATGTTT(SEQ ID NO:54)
target sequence XIII:
CCGAGGGGTAATGATTAAATGATAAAGATAAGAAAAGCGCCCATGTAACAC AAACTGCCATTCAACAGGTATTTCCCTTACTACCTAAGGAATTGTAACCATTGCTC AGACATTGTAGGATT(SEQ ID NO:13)
target sequence XIII-1:
CCGAGGGGTAATGATTAAA(SEQ ID NO:55)
target sequence XIII-2:
AGCGCCCATGTAACACAAA(SEQ ID NO:56)
target sequence XIII-3:
CCTAAGGAATTGTAACCAT(SEQ ID NO:57)
target sequence XIII-4:
GCTCAGACATTGTAGGATT(SEQ ID NO:58)
target sequence XIV:
AGGAGAGACAACTGGTTTTTGAATGAAATACATGGGTACTGCCTTGCTTGAC ATCACATAGTCCTTGATGAAAGTTCACATTTAGGTCTGCTTGGTACAATACGCCTC CTAAA(SEQ ID NO:14)
target sequence XIV-1:
AGGAGAGACAACTGGTTTT(SEQ ID NO:59)
target sequence XIV-2:
CCTTGCTTGACATCACATA(SEQ ID NO:60)
target sequence XIV-3:
GTACAATACGCCTCCTAAA(SEQ ID NO:61)
target sequence XV:
GATGGTAAGGTATCTGCAAATTTGCACACACCGTACACAGCTTAAGTCTTAGAATTAACTTGCTAAAATGTGAGCCTTTGGTAATTAGGCTGTTTTATTAGGGAGTGTGATAATATTTGAATTTCTTTTCATATTTGTGCTTTGTGTCATTTTCAAATGACCCTTGAAATGTATTTTAAAAGTAGATAAAAGCCAGAAAGTGATTTGATTGTCTATCCAGCAAAAGATGGTGGTT(SEQ ID NO:15)
target sequence XV-1:
GATGGTAAGGTATCTGCAA(SEQ ID NO:62)
target sequence XV-2:
CACAGCTTAAGTCTTAGAA(SEQ ID NO:63)
target sequence XV-3:
GGAGTGTGATAATATTTGA(SEQ ID NO:64)
target sequence XV-4:
GCCAGAAAGTGATTTGATT(SEQ ID NO:65)
target sequence XV-5:
CCAGCAAAAGATGGTGGTT(SEQ ID NO:66)
target sequence XVI:
GCAAAATAGTGCTCTGTTATAGAATTGCTTGTTTCACGATACATCATGACAGA TA(SEQ ID NO:16)
Target sequence XVI-1:
GCAAAATAGTGCTCTGTTA(SEQ ID NO:67)
target sequence XVI-2:
TGCTTGTTTCACGATACATCATGACAGATA(SEQ ID NO:68)
1.2 description of the synthesis method:
the nucleoside monomers are linked one by one in the 3'-5' direction according to the nucleotide arrangement sequence by a solid-phase phosphoramidite method. Each nucleoside monomer attached includes four steps of deprotection, coupling, capping, oxidation or vulcanization. Wherein, when two nucleotides are connected by phosphate, the connection of the latter nucleoside monomer comprises deprotection, coupling, capping and oxidation. When phosphorothioate is adopted to connect two nucleotides, the following nucleoside monomer is connected, and the four steps of protection, coupling, capping and vulcanization are included.
1.3 synthetic conditions were given as follows:
the nucleoside monomer is provided in an acetonitrile solution with the concentration of 0.1M, the deprotection reaction conditions of each step are the same, namely the temperature is 25 ℃, the reaction time is 70 seconds, the deprotection reagent is dichloromethane solution (3%V/V) of dichloroacetic acid, and the molar ratio of the dichloroacetic acid to the 4,4' -dimethoxytrityl protecting group on the solid carrier is 5:1.
The coupling reaction conditions of each step are the same, the temperature is 25 ℃, the mole ratio of the nucleic acid sequence connected on the solid carrier to the nucleoside monomer is 1:10, the mole ratio of the nucleic acid sequence connected on the solid carrier to the coupling reagent is 1:65, the reaction time is 600 seconds, and the coupling reagent is a 0.5M acetonitrile solution of 5-ethylthio-1H-tetrazole.
The capping conditions were the same for each step, including a temperature of 25℃and a reaction time of 15 seconds. The capping reagent solution is a mixed solution of CapA and CapB with a molar ratio of 1:1, and the molar ratio of the capping reagent to the nucleic acid sequence connected to the solid phase carrier is acetic anhydride, N-methylimidazole and the nucleic acid sequence connected to the solid phase carrier=1:1:1.
The oxidation reaction conditions are the same in each step, the temperature is 25 ℃, the reaction time is 15 seconds, and the oxidizing agent is iodine water with the concentration of 0.05M. The molar ratio of iodine to nucleic acid sequence attached to the solid support in the coupling step was 30:1. The reaction was carried out in a mixed solvent of tetrahydrofuran, water, pyridine=3:1:1.
The conditions for each step of sulfiding reaction were the same, including a temperature of 25 ℃, a reaction time of 300 seconds, and the sulfiding reagent was hydrogenation Huang Yuansu. The molar ratio of sulfiding reagent to nucleic acid sequence attached to the solid support in the coupling step was 120:1. The reaction was carried out in a mixed solvent of acetonitrile: pyridine=1:1.
After the last nucleoside monomer is connected, sequentially cutting, deprotecting, purifying and desalting the nucleic acid sequence connected on the solid phase carrier, and then freeze-drying to obtain a sense strand and an antisense strand; and finally, carrying out heating annealing on the two chains to obtain a product, and freeze-drying to obtain freeze-dried powder.
Example 2: synthesis of siRNA conjugates (GalNAc-siRNA)
2.1siRNA conjugates have the structure shown in formula II below:
2.2 Synthesis procedure of siRNA conjugates
In the first step, DMTR-L96 is reacted with succinic anhydride to give compound L96-A:
the preparation process comprises the following steps: DMTR-L96, succinic anhydride, 4-dimethylaminopyridine and diisopropylethylamine are added into dichloromethane, stirred and reacted for 24 hours at 25 ℃, then the reaction liquid is washed by 0.5M triethylamine phosphate, the water phase is washed three times by dichloromethane, and the organic phases are combined and evaporated to dryness under reduced pressure to obtain a crude product. Then purifying by column chromatography to obtain the pure L96-A.
Second, L96-A is reacted with NH 2 SPS reaction gives L96-B:
the preparation process comprises the following steps: L96-A, O-benzotriazol-tetramethyluronium Hexafluorophosphate (HBTU) and diisopropylethylamine were mixed and dissolved in acetonitrile, stirred at room temperature for 5 minutes to give a homogeneous solution, and aminomethyl resin (NH) was added 2 SPS,100-200 meshes) into a reaction liquid, starting a shaking table reaction at 25 ℃, filtering after 18 hours of reaction, and washing a filter cake by dichloromethane and acetonitrile in sequence to obtain the filter cake. Capping the filter cake with CapA/CapB mixed solution to obtain L96-B, namely a solid phase carrier containing conjugate molecules, connecting nucleoside monomers to the conjugate molecules under the coupling reaction, synthesizing siRNA sense strand connected to the conjugate molecules according to the siRNA molecule synthesis method, synthesizing siRNA antisense strand by adopting the siRNA molecule synthesis method, and annealing to generate the siRNA conjugate.
Example 3: siRNA and siRNA modifier for inhibiting HMGB1 gene expression
3.1 experimental materials:
HepG2 cells, purchased from ATCC under the accession number HB-8065;
the kit for extracting RNA comprises a kit for extracting RNA,96Kit, available from QIAGENCargo number 74182;
RNAiMax transfection reagent, available from Invitrogen under the accession number 13778-150;
FastStart Universal Probe Master from Roche, cat No. 04914058001;
opti-medium: purchased from Gibco under the accession number 31985-070;
RPMI1640Medium, available from Gibco under the accession number C22400500BT;
FBS, available from Gibco under the trade designation 10099141;
fastking RT Kit (with gDNase), available from TIANGEN under the accession number KR116-02;
target HMGB1 primer and probe set, available from Thermo, ID-HS01923466g1.
3.2 experimental method:
3.2.1 HepG2 cells were plated in fresh Opti-medium in 96-well plates for 24 hours and the cell suspension was diluted to the desired final cell density of 2.22X10 with RPMI1640medium containing 10% FBS 5 cells/mL, plated in 96-well plates, and 90 μl of cell suspension, 20000 cells/well, was added per well.
3.2.2 Dry powders of siRNA to be tested and siRNA modification (collectively referred to as siRNA in the description of the experimental procedure of this example) were centrifuged at low temperature and high speed, and then dissolved in ultra-pure distilled water (ULtraPure Distilled Water) to prepare 100. Mu.M siRNA stock solution.
3.2.3 preparation of siRNA diluent Z2 nM and siRNA diluent W20 nM
(1) Preparation of 0.1. Mu.M siRNA stock solution X and 1. Mu.M siRNA stock solution Y:
a) Taking 2 mu l of 100 mu M siRNA mother liquor prepared in the step 3.2.2, and adding 18 mu l of ultra-pure distilled water to obtain siRNA diluent with the final concentration of 10 mu M;
b) Taking 2 mu l of the 10 mu M siRNA dilution liquid prepared in the step a), adding 18 mu l of ultra-pure distilled water, and obtaining siRNA stock solution Y with the final concentration of 1 mu M;
c) Taking 2 mu l of 1 mu M siRNA stock solution Y prepared in the step b), and adding 18 mu l of ultra-pure distilled water to obtain siRNA stock solution X with the final concentration of 0.1 mu M;
(2) 2. Mu.l each of the above-prepared siRNA stock solution X and siRNA stock solution Y was taken, and 98. Mu.l of Opti-medium was added to each to obtain 2nM siRNA dilution Z and 20nM siRNA dilution W, respectively.
3.2.4 transfection of HepG2 cells
(1) Taking outRNAiMax transfection reagent 3. Mu.l, 97. Mu.l Opti-medium was added to give +.>RNAiMax transfection reagent dilutions; will->Mixing RNAiMax transfection reagent diluent with 2nM siRNA diluent Z prepared in step 3.2.3 at a volume ratio of 1:1 to prepare a transfection mixture, standing for 5 min, adding 10 μl of the transfection mixture into a 96-well plate to transfect HepG2 cells cultured in step 3.2.1 (final volume 100 μl, concentration of siRNA in the system is 0.1 nM);
(2) Taking outRNAiMax transfection reagent 3. Mu.l, 97. Mu.l Opti-medium was added to give +.>RNAiMax transfection reagent dilutions; will->RNAiMax transfection reagent dilution was mixed with 20nM siRNA dilution W prepared in step 3.2.3 at a 1:1 volume ratio to prepare a transfection mixture, which was allowed to stand for 5 minutes, 10. Mu.l of the transfection mixture was added to a 96-well plate to transfect HepG2 cells cultured in step 3.2.1 (final volume 100. Mu.l, siRNA concentration in the system was 1 nM).
Culturing for 48 hours after the transfection; 2 replicates were set for each concentration (0.1 nM and 1 nM).
3.2.5 according to the specification96Kit extracts total RNA:
3.2.6 reverse transcription of total RNA to cDNA was performed with the Kit Fastking RT Kit (with gDNase) according to the following procedure:
the method comprises the following steps of:
a) gDNA was removed with gDNase according to the following table;
TABLE 6
Volume/. Mu.l
5×gDNA Buffer 2
Sample(RNA) 8
42 ℃ for 3min; standing at 4 DEG C
b) Adding the reagents described below to the system obtained in step a) and performing reverse transcription
TABLE 7
Volume/. Mu.l
FastKing RT Enzyme Mix 1
FQ-RT Primer Mix 2
10×King RT Buffer 2
RNase-Free ddH 2 O 5
42℃，15min；95℃，3min。
c) Storing the reverse transcription product obtained in step b) at-20 ℃ for real-time PCR analysis.
3.2.7 real-time PCR analysis
a) qPCR reaction mixtures were prepared as shown in the following table, with all reagents placed on ice throughout the run;
TABLE 8
b) qPCR procedure was performed as follows
95 ℃ for 10 minutes;
95 ℃ for 15 seconds; 60℃for 1 minute (40 cycles).
3.2.8 analysis of results
a) Using Quant Studio 7 software to automatically calculate Ct value by default;
b) The relative expression amount of the gene was calculated using the following formula:
delta ct=ct (HMGB 1 gene) -Ct (GAPDH)
ΔΔΔCt =Δct (detection of sample) group) -delta Ct (Mock group)
mRNA tables relative to Mock groupUp to=2 -ΔΔCt 。
Mock group represents: the group to which no siRNA was added was compared with the test sample group.
Inhibition ratio (%) = (relative expression amount of mRNA in Mock group-relative expression amount of mRNA in test sample group)/relative expression amount of mRNA in Mock group×100%
3.3 silencing assay results
3.3.1 concentrations of 0.1nM and 1nM were selected for testing and the results are shown in Table 9 below.
TABLE 9
/>
/>
/>
/>
/>
3.3.2IC 50 Measurement results
The following siRNA to be tested was set to a concentration range (nM): 5. 1.67, 0.417, 0.104, 0.026, 0.065, 0.00163, 0.00041, and then IC was carried out in a similar manner to 3.2 50 And (5) measuring.
Analysis of results:
a) Using Quant Studio 7 software to automatically calculate Ct value by default;
b) The relative expression amount of the gene was calculated using the following formula:
delta ct=ct (HMGB 1 gene) -Ct (GAPDH)
ΔΔΔCt =Δct (detection of sample) group) - Δct (Mock group);
mRNA expression = 2 relative to Mock group -ΔΔCt
Inhibition ratio (%) = (relative mRNA expression amount of Mock group-relative mRNA expression amount of test sample group)/relative mRNA expression amount of Mock group x 100%;
wherein Mock groups represent groups to which no siRNA was added compared to the test sample groups.
The log value of siRNA concentration is taken as the X axis, the percent inhibition rate is taken as the Y axis, and the "log (inhibitor) vs. response-variable slope" functional module of analysis software GraphPad Prism 8 is adopted to fit the quantitative effect curve, so that the IC50 value of each siRNA is obtained.
The fitting formula is: y=bottom+ (Top-Bottom)/(1+10++LogIC 50-X. Times HillSlope)
Wherein: top represents percent inhibition at the Top plateau, the Top criterion of the curve is typically 80% to 120%; bottom represents the percent inhibition at the Bottom plateau, with Bottom of the curve typically between-20% and 20%; hillSlope represents the slope of the percent inhibition curve.
Table 10
Example 4: delivery system verification
4.1 experimental materials:
human primary hepatocytes PHH cells, supplied by the medicine Mingkang;
PHH medium: invitroGRO CP Meduim serum free BIOVIT, cargo number: s03316
RNAiMax transfection reagent, available from Invitrogen, cat: 13778-150;
RNA extraction kit 96Kit, available from QIAGEN, cat: 74182;
reverse transcription Kit FastKing RT Kit (With gDNase), available from TianGen, cat: KR116-02;
FastStart Universal Probe master from Roche, cat: 04914058001;
the HMGB1 primer and GAPDH primer are provided by samsungde.
4.2 experimental method:
siRNA conjugates (final siRNA conjugate concentrations of 10nM, 2.5nM, 0.63nM, 0.16nM, 0.04nM, 0.01nM, 0.0024nM and 0.0006nM, compound wells) were transfected into PHH cells as follows: taking cryopreserved PHH cells, resuscitating, counting, and adjusting cell to 6×10 5 Cell/ml, simultaneous applicationRNAiMax transfection reagent siRNA conjugates were transferred to cells and seeded into 96-well plates at a density of 54,000 cells per well, with 100. Mu.L of PPH medium added per well. Cells were exposed to 5% CO 2 Culturing in incubator at 37 ℃. After 48 hours, the medium was removed and the cells were collected for total RNA extraction. Use according to the kit product instructions +.>Total RNA was extracted at 96 Kit.
The siRNA conjugates (siRNA conjugates at final concentrations of 500nM, 125nM, 31.25nM, 7.81nM, 1.95nM, 0.49nM, 0.12nM and 0.03nM, and multiple wells) entered PHH cells by free uptake as follows: taking cryopreserved PHH cells, resuscitating, counting, and adjusting cell to 6×10 5 Cells/ml, while adding siRNA conjugates at 54,000 cells per wellIs inoculated into 96-well plates at a density of 100. Mu.l per well. Cells were exposed to 5% CO 2 Culturing in incubator at 37 ℃. After 48 hours, the medium was removed and the cells were collected for total RNA extraction. Use according to the kit product instructionsTotal RNA was extracted at 96 Kit.
The extracted total RNA was reverse transcribed into cDNA by reverse transcription reaction, and HMGB1 cDNA obtained by reverse transcription was quantitatively amplified by qPCR, using a method similar to that in example 3. GAPDH cDNA will be amplified in parallel as an internal control. The PCR reaction procedure was: 10 minutes at 95℃and then enter a cyclic mode, 95℃for 15 seconds followed by 60℃for 60 seconds for a total of 40 cycles.
4.3 analysis of results
a) Using Quant Studio 7 software to automatically calculate Ct value by default;
b) The relative expression amount of the gene was calculated using the following formula:
delta ct=ct (HMGB 1 gene) -Ct (GAPDH)
ΔΔΔCt =Δct (detection of sample) group) -delta Ct (Mock group)
mRNA expression = 2 relative to Mock group -ΔΔCt Wherein Mock groups represent groups to which no siRNA conjugate was added compared to the test sample groups.
Inhibition ratio= (mRNA expression level of Mock group-mRNA expression level of test sample group)/mRNA expression level of Mock group x 100%.
The IC50 values of the individual siRNA conjugates were obtained by fitting the dose-response curves using the log of the siRNA conjugate concentration as X-axis and the percent inhibition as Y-axis, using the "log (inhibitor) vs. response-variable slope" function of analytical software GraphPad Prism 8.
The fitting formula is: y=bottom+ (Top-Bottom)/(1+10++LogIC 50-X. Times HillSlope)
Wherein: top represents percent inhibition at the Top plateau, the Top criterion of the curve is typically 80% to 120%; bottom represents the percent inhibition at the Bottom plateau, with Bottom of the curve typically between-20% and 20%; hillSlope represents the slope of the percent inhibition curve.
TABLE 11
L96 in the above table is the conjugate group GalNAc of formula I.
Example 5: synthesis of siRNA
5.1siRNA sequence design
The siRNA sequence design concept and method in this example are the same as those in example 1, and the target sequence for designing siRNA is shown below, the target sequence being derived from the mRNA sequence of HMGB1 gene (see nm_ 002128.7).
Target sequence XVII:
TCCCGCTCTCACAGCCATTGCAGTACATTGAGCTCCATAGAGACAGC(SEQ ID NO:560)
target sequence XVII:
AACTAAACATGGGCAAAGGAGATCCTAAGAAGCCGAGAGGCAAAATGTC(SEQ ID NO:561)
target sequence XVII-1:
AACTAAACATGGGCAAAGGAGATCCTAAGA(SEQ ID NO:568)
target sequence XVII-2:
AGCCGAGAGGCAAAATGTC(SEQ ID NO:569)
target sequence XVIII:
AGAGGTGGAAGACCATGTCTGCTAAAG(SEQ ID NO:562)
target sequence XIX:
GAAGATGATGATGATGAATAAGTTGGTTCTAGCG(SEQ ID NO:563)
target sequence XX:
AGCATTTAACCCCCCTGTACACAACTCACTCCTTTT(SEQ ID NO:564)
Target sequence XXI:
GAATGTGTCTTTAGATAGCCCTGTCC(SEQ ID NO:565)
target sequence XXII:
GTTGTTCTGTTAACTGAATACCACTCTGTAATTG(SEQ ID NO:566)
target sequence XXIII:
GTATGTTCTAACCTTTACA(SEQ ID NO:567)
5.2, the synthesis method comprises the following steps:
the synthesis method was the same as that in "1.2" in example 1.
5.3 Synthesis conditions:
the synthesis conditions were the same as those in "1.3" in example 1.
Example 6: siRNA and siRNA modifier for inhibiting HMGB1 gene expression
The experimental materials and experimental methods used in this example were the same as those in example 3. The results of the gene expression silencing experiments are shown in Table 12 below.
Table 12
/>
/>
/>
Example 7: inhibition ratio assay for inhibiting HMGB1 gene expression by siRNA conjugate
7.1 experimental materials:
human primary hepatocytes PHH cells, supplied by the medicine Mingkang;
PHH medium: invitroGRO CP Meduim serum free BIOVIT, cargo number: s03316
RNAiMax transfection reagent, available from Invitrogen, cat: 13778-150;
RNA extraction kit96Kit, available from QIAGEN, cat: 74182;
reverse transcription Kit FastKing RT Kit (With gDNase), available from TianGen, cat: KR116-02;
FastStart Universal Probe master from Roche, cat: 04914058001;
the HMGB1 primer and GAPDH primer are provided by samsungde.
7.2 experimental method:
siRNA conjugates (final concentration of siRNA conjugate 5nM and 0.1nM, multiplex wells) were transfected into PHH cells by the following procedure: taking cryopreserved PHH cells, resuscitating, counting, and adjusting cell to 6×10 5 Cell/ml, simultaneous applicationRNAiMax transfection reagent siRNA conjugates were transferred to cells and seeded into 96-well plates at a density of 54,000 cells per well, with 100. Mu.L of PPH medium added per well. Cells were exposed to 5% CO 2 Culturing in incubator at 37 ℃. After 48 hours, the medium was removed and the cells were collected for total RNA extraction. Use according to the kit product instructions +.>Total RNA was extracted at 96 Kit.
siRNA conjugates (final concentration of siRNA conjugate 200nM and 10nM, multiplex wells) were entered into PHH cells by free uptake, as follows: taking cryopreserved PHH cells, resuscitating, counting, and adjusting cell to 6×10 5 Cells/ml, while siRNA conjugate was added, were seeded into 96-well plates at a density of 54,000 cells per well, and 100 μl per well of culture broth. Cells were exposed to 5% CO 2 Culturing in incubator at 37 ℃. After 48 hours, the medium was removed and the cells were collected for total RNA extraction. Use according to the kit product instructionsTotal RNA was extracted at 96 Kit.
The extracted total RNA was reverse transcribed into cDNA by reverse transcription reaction, and HMGB1 cDNA obtained by reverse transcription was quantitatively amplified by qPCR, using a method similar to that in example 3. GAPDH cDNA will be amplified in parallel as an internal control. The PCR reaction procedure was: 10 minutes at 95℃and then enter a cyclic mode, 95℃for 15 seconds followed by 60℃for 60 seconds for a total of 40 cycles.
7.3 analysis of results
a) Using Quant Studio 7 software to automatically calculate Ct value by default;
b) The relative expression amount of the gene was calculated using the following formula:
delta ct=ct (HMGB 1 gene) -Ct (GAPDH)
ΔΔΔCt =Δct (detection of sample) group) -delta Ct (Mock group)
mRNA expression = 2 relative to Mock group -ΔΔCt Wherein Mock groups represent groups to which no siRNA conjugate was added compared to the test sample groups.
Inhibition ratio= (mRNA expression level of Mock group-mRNA expression level of test sample group)/mRNA expression level of Mock group x 100%.
The inhibition test results are shown in table 13 below.
TABLE 13
/>
Example 8: inhibition of HMGB1 Gene expression by siRNA conjugates in wild C57BL/6 mice
After 6-8 week old C57BL/6 male mice were adaptively fed for 7 days, 6 animals per group were randomly grouped by body weight, subcutaneously dosed with 3mg/kg of a single dose of siRNA conjugate (as indicated by siRNA ID in Table 14 below) and PBS (available from Gibco, cat. No. 10010-023), injected at a volume of 5. Mu.l/g, and after two weeks of dosing mice were euthanized, 30mg of left leaf tissue of the liver of the mice was harvested, frozen with 2 liquid nitrogen, frozen and ground to tissue homogenate, tissue RNA was extracted and target gene mRNA expression was examined, with the results as shown in the following Table:
TABLE 14siRNA conjugate pairsHMGB1Inhibition ratio of Gene
/>
As can be seen from table 14, the siRNA conjugates of the present disclosure have higher inhibitory activity on HMGB1 gene in vivo, and the inhibition rate reaches 84.05% at day 14.
Example 9: siRNA conjugates in CD-1 mice plasma kinetics studies
Test animals: CD-1 mice, SPF grade, male, about 30g, purchased from Si Bei Fu (Beijing) Biotechnology Co., ltd.
Dosage and mode of administration: the siRNA conjugates were administered at a dose of 3mg/kg (10 mL/kg), with a single subcutaneous injection following randomization, with 6 mice per group.
Sample collection: samples of whole blood were collected at 10 points at 0.0833, 0.25, 0.5, 1, 2, 4, 8, 24, 36, 48h post-administration. The front 3 of each group is collected for 0.0833, 0.5, 2, 8 and 36 hours, and the rear 3 is collected for 0.25, 1, 4, 24 and 48 hours, and the whole blood is collected and then the blood plasma is centrifugally separated for detection and analysis.
Sample detection and analysis: the concentration of the original drug in plasma samples at each time point was measured by LC-MS/MS method and PK parameters were calculated using WinNonlin software: c (C) max 、T max 、AUC、MRT、t 1/2 。
From this experiment, it can be concluded that the siRNA conjugates of the present disclosure have a shorter half-life in plasma and are cleared faster.
Example 10: siRNA conjugates in CD-1 mice tissue distribution assay
Test animals: CD-1 mice, SPF grade, male, about 30g, purchased from Si Bei Fu (Beijing) Biotechnology Co., ltd.
Dosage and mode of administration: the siRNA conjugates were administered at a dose of 3mg/kg (10 mL/kg), a single subcutaneous injection following randomization, 3 animals at each time point, and 24 mice total.
Sample collection:
24h after administration: collecting plasma, liver, kidney and spleen;
72h after administration: collecting plasma, liver, kidney and spleen;
168h (1 week) after administration: collecting plasma, liver, kidney, spleen, brain, heart, lung, stomach, small intestine, muscle, testis;
336h (2 weeks) post-dose: collecting plasma, liver, kidney and spleen;
672h (4 weeks) post-dose: collecting plasma, liver, kidney, spleen, brain, heart, lung, stomach, small intestine, muscle, testis; 1008h (6 weeks) after dosing: collecting plasma, liver, kidney and spleen;
1344h (8 weeks) after dosing: collecting plasma, liver, kidney and spleen;
1680h (10 weeks) post-dose: plasma, liver, kidney, spleen, brain, heart, lung, stomach, small intestine, muscle, testis were collected.
Sample detection and analysis: the concentration of the original drug in the plasma and tissue samples at each time point was detected by LC-MS/MS method, and AUC in the plasma and tissue was calculated by trapezoidal area method.
From the experiment, the siRNA conjugate disclosed by the invention is mainly enriched in the liver, has long retention time in tissues and has good stability.
Example 11: single subcutaneous injection of siRNA conjugate C57B/L mice given MTD assay
Test animals: c57 mice, SPF grade, male, about 25g, purchased from si Bei Fu (beijing) biotechnology limited. Mice were grouped according to body weight at the last 1 day of the adaptive feeding period using the body weight randomized block design (Randomized Block Design), with specific dose designs and groupings as shown in table 15 below:
TABLE 15
Detecting the index:
clinical observation: the administration day was continuously observed for 4 hours, and at least one clinical observation was performed daily during the recovery period.
Weight of: all surviving animals were weighed 2 times per week.
Immunotoxicity: MTD dose animals were alternately bled 1 h.+ -. 2min,4 h.+ -. 5min,8 h.+ -. 10min,24 h.+ -. 20min after D1 dosing, 3 animals per sex/group were harvested at each time point and tested for cytokines (IFN-. Gamma., TNF-. Alpha., IL-2/6/8).
Toxicological kinetics: MTD dose animals are alternately sampled before and 30min 2min,1h 2min,4h 5min,8h 10min and 24h 20min after D1 administration, and blood concentration is detected by collecting 3 animals/sex/animal group at each time point.
Chemistry of blood generation: the primary test animals were sectioned at D28, and the satellite animals were sectioned at batches D7, D14, D21, and D28 for blood biochemistry.
Tissue distribution: the animals of the main test group are subjected to D28 sectioning, the animals of the satellite group are subjected to D7, D14, D21 and D28 sectioning in batches, blood and liver are collected, and the tissue drug concentration is detected.
Histopathological examination: the animals of the main test group were examined by D28 dissection, and the main organs (heart, liver, spleen, lung, kidney, brain, adrenal gland, thymus, stomach, uterus/testis, ovary/epididymis) and the tissues or organs found abnormal were collected, fixed, and subjected to histopathological examination.
From this experiment, it can be seen that the siRNA conjugates of the present disclosure are less toxic, with an excellent window of drug safety.
The above examples of the present disclosure are merely examples for clearly illustrating the present disclosure and are not limiting of the embodiments of the present disclosure. Other variations or modifications of the above teachings will be apparent to those of ordinary skill in the art. It is not necessary here nor is it exhaustive of all embodiments. Any modifications, equivalent substitutions, improvements, etc. that fall within the spirit and principles of the present disclosure are intended to be included within the scope of the claims of the present disclosure.

Claims (45)

1. A double-stranded ribonucleic acid comprising a sense strand and an antisense strand, the sense strand being complementary to and/or substantially reverse complementary to the antisense strand to form a double-stranded region of the double-stranded ribonucleic acid;
Wherein the sense strand comprises a sequence a that differs by no more than 3 nucleotides from at least 15 consecutive nucleotides in the target sequence, and the antisense strand comprises a sequence B that differs by no more than 3 nucleotides from the reverse complement of at least 15 consecutive nucleotides in the target sequence;
the target sequence is selected from nucleotide sequences shown in any one of SEQ ID NO 1-16 and SEQ ID NO 560-567.
2. The double-stranded ribonucleic acid according to claim 1, wherein said target sequence is selected from the group consisting of the nucleotide sequences shown in any one of SEQ ID NOS.17 to 68, SEQ ID NO 560, and SEQ ID NOS.562 to 569, said sense strand comprises a sequence A consisting of at least 15 consecutive nucleotides of the nucleotide sequences shown in any one of SEQ ID NOS.17 to 68, SEQ ID NO 560, and SEQ ID NO 562 to 569, and said antisense strand comprises a sequence B which is reverse complementary to a sequence consisting of at least 15 consecutive nucleotides of the nucleotide sequences shown in any one of SEQ ID NOS.17 to 68, SEQ ID NO 560, and SEQ ID NO 562 to 569.
3. The double stranded ribonucleic acid according to claim 1 or 2, wherein said sense strand consists of 15-28 nucleotides, preferably 19-25 nucleotides, more preferably 19-23 nucleotides, more preferably 19, 21 or 23 nucleotides.
4. A double stranded ribonucleic acid according to claim 3, wherein the nucleotide sequence of the sense strand differs by NO more than 1 nucleotide in sequence a, preferably 19-25 consecutive nucleotides, more preferably 19-23 consecutive nucleotides, more preferably 19, 21 or 23 nucleotides from a sequence consisting of 15-28 consecutive nucleotides in the nucleotide sequences shown in any of SEQ ID NOs 17 to 68, 560, 562-569.
5. The double stranded ribonucleic acid of any one of claims 1 to 4, wherein the antisense strand consists of 15 to 28 nucleotides, preferably 19 to 25 nucleotides, more preferably 19 to 23 nucleotides, more preferably 19, 21 or 23 nucleotides.
6. The double-stranded ribonucleic acid according to claim 5, wherein the nucleotide sequence of the antisense strand is a sequence B differing by NO more than 1 nucleotide, preferably 19 to 25 consecutive nucleotides, more preferably 19 to 23 consecutive nucleotides, more preferably 19, 21 or 23 nucleotides, compared to the reverse complement of a sequence consisting of 15 to 28 consecutive nucleotides in the nucleotide sequences shown in any one of SEQ ID NOS: 17 to 68, SEQ ID NO:560, SEQ ID NOS: 562 to 569.
7. The double stranded ribonucleic acid of any one of claims 1 to 6, wherein the double stranded region is 15 to 25 nucleotides in length, preferably 19 to 23 nucleotides, more preferably 19 to 21 nucleotides, more preferably 19, 21 or 23 nucleotides.
8. The double-stranded ribonucleic acid according to any one of claims 1 to 7, wherein,
the sense strand is complementary to the antisense strand to form the double-stranded region, and the 3 'end of the sense strand has 1-2 protruding nucleotides extending out of the double-stranded region, the 3' end of the antisense strand forming a blunt end; or,
the sense strand is complementary to the antisense strand to form the double-stranded region, and the 3 'end of the antisense strand has 1-2 protruding nucleotides extending out of the double-stranded region, the 3' end of the sense strand forming a blunt end; or,
the sense strand and the antisense strand are complementary to form the double-stranded region, and the 3' -ends of the sense strand and the antisense strand each have 1-2 protruding nucleotides extending out of the double-stranded region; or,
the sense strand is complementary to the antisense strand to form the double-stranded region, and the sense strand and the 3' -end of the antisense strand each form a blunt end.
9. The double-stranded ribonucleic acid of any one of claims 1 to 8, wherein the sense strand and the antisense strand are selected from the group consisting of:
1) The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 69 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 179;
2) The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 70, and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 180;
3) The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 71 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 181;
4) The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 72 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 182;
5) The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 73 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 183;
6) The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 74 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 184;
7) The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 75 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 185;
8) The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 76 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 186;
9) The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 77 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 187;
10 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 78 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 188;
11 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 79 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 189;
12 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 80 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 190;
13 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 81 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 191;
14 The sense strand comprises the nucleotide sequence set forth in SEQ ID NO. 82 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO. 192;
15 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 83 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 193;
16 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 84 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 194;
17 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 85 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 195;
18 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 86 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 196;
19 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 87 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 197;
20 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 88 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 198;
21 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 89, and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 199;
22 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 90, and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 200;
23 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 91 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 201;
24 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 92, and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 202;
25 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 93 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 203;
26 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 94 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 204;
27 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 95 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 205;
28 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 96 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 206;
29 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 97 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 207;
30 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 98 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 208;
31 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 99 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 209;
32 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 100 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 210;
33 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 101 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 211;
34 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 102 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 212;
35 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 103 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 213;
36 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 104 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 214;
37 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 105 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 215;
38 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 106 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 216;
39 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 107 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 217;
40 The sense strand comprises the nucleotide sequence set forth in SEQ ID NO. 108 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO. 218;
41 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 109 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 219;
42 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 110 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 220;
43 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 111, and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 221;
44 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 112 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 222;
45 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 113 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 223;
46 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 114 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 224;
47 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 115 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 225;
48 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 116, and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 226;
49 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 117 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 227;
50 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 118 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 228;
51 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 119 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 229;
52 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 120 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 230;
53 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 121 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 231;
54 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 122 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 232;
55 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 123 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 233;
56 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 124 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 234;
57 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 125 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 235;
58 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 126 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 236;
59 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 127 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 237;
60 The sense strand comprises the nucleotide sequence set forth in SEQ ID NO. 128 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO. 238;
61 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 129 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 239;
62 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 130 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 240;
63 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 131, and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 241;
64 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 132 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 242;
65 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 133 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 243;
66 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 134 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 244;
67 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 135 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 245;
68 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 136 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 246;
69 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 137 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 247;
70 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 138 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 248;
71 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 139 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 249;
72 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 140 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 250;
73 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 141 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 251;
74 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 142 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 252;
75 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 143 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 253;
76 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 144 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 254;
77 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 145 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 255;
78 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 146 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 256;
79 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 147 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 257;
80 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 148 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 258;
81 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 149 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 259;
82 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 150 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 260;
83 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 151 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 261;
84 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 152 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 262;
85 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 153 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 263;
86 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 154 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 264;
87 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 155 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 265;
88 The sense strand comprises the nucleotide sequence set forth in SEQ ID NO. 156 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO. 266;
89 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 157 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 267;
90 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 158 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 268;
91 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 159 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 269;
92 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 160 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 270;
93 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 161 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 271;
94 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 162 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 272;
95 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 163 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 273;
96 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 164 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 274;
97 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 165 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 275;
98 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 166 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 276;
99 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 167 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 277;
100 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 168 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 278;
101 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 169 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 279;
102 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 170 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 280;
103 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 171 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 281;
104 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 172 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 282;
105 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 173 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 283;
106 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 174 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 284;
107 The sense strand comprises the nucleotide sequence set forth in SEQ ID NO. 175 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO. 285;
108 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 176 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 286;
109 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 177 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 287;
110 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 178 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 288;
111 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO:289 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 299;
112 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 290 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 300;
113 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 291, and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 301;
114 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 292, and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 302;
115 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 293 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 303;
116 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 294 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 304;
117 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 295 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 305;
118 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 296 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 306;
119 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 297 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 307;
120 The sense strand comprises the nucleotide sequence set forth in SEQ ID NO. 298 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO. 308;
167 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 376 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 412;
168 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 377 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 413;
169 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 378 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 414;
170 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 379 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 415;
171 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 380 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 416;
172 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 381 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 417;
173 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 382 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 418;
174 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 383 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 419;
175 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 384 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 420;
176 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 385 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 421;
177 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 386 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 422;
178 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 387 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 423;
179 The sense strand comprises the nucleotide sequence set forth in SEQ ID NO. 388 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO. 424;
180 The sense strand comprises the nucleotide sequence shown as SEQ ID NO:389 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO: 425;
181 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 390 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 426;
182 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 391 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 427;
183 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 392 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 428;
184 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 393 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 429;
185 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 394 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 430;
186 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 395 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 431;
187 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 396 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 432;
188 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 397 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 433;
189 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 398 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 434;
190 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 399 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 435;
191 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 400 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 436;
192 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 401 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 437;
193 The sense strand comprises the nucleotide sequence set forth in SEQ ID NO. 402 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO. 438;
194 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 403 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 439;
195 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 404 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 440;
196 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 405 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 441;
197 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 406 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 442;
198 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 407 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 443;
199 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 408 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 444;
200 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 409 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 445;
201 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 410 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 446;
202 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 411 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 447;
318 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 570 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 603;
319 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 571 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 604;
320 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 572 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 605;
321 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 573 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 606;
322 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 574 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 607;
323 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 575 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 608;
324 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 576 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 609;
325 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 577 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 610;
326 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 578 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 611;
327 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 579 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 612;
328 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 580 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 613;
329 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 581 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 614;
330 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 582 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 615;
331 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 583 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 616;
332 584, and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 617;
333 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 585 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 618;
334 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 586 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 619;
335 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 587 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 620;
336 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 588 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 621;
337 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 589 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 622;
338 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 590 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 623;
339 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 591 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 624;
340 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 592 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 625;
341 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 593 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 626;
342 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 594 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 627;
343 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 595 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 628;
344 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 596 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 629;
345 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 597 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 630;
346 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 598 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 631;
347 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 599 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 632;
348 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 600 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 633;
349 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 601 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 634;
350 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 602 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 635;
preferably, the sense strand and the antisense strand are selected from the following combinations:
7) The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 75 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 185;
30 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 98 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 208;
39 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 107 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 217;
49 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 117 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 227;
55 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 123 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 233;
62 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 130 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 240;
168 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 377 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 413;
169 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 378 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 414;
170 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 379 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 415;
198 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 407 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 443.
10. The double-stranded ribonucleic acid of any one of claims 1 to 9, wherein each nucleotide in the sense strand is a modified nucleotide or an unmodified nucleotide independently of each other and/or each nucleotide in the antisense strand is a modified nucleotide or an unmodified nucleotide independently of each other.
11. The double-stranded ribonucleic acid of any one of claims 1 to 10, wherein any two nucleotides linked in the sense strand are linked by a phosphodiester or phosphorothioate linkage and/or any two nucleotides linked in the antisense strand are linked by a phosphodiester or phosphorothioate linkage.
12. The double stranded ribonucleic acid of any one of claims 1 to 11, wherein the 5 'terminal nucleotide of the sense strand is linked to a 5' phosphate group or a 5 'phosphate derivative group and/or the 5' terminal nucleotide of the antisense strand is linked to a 5 'phosphate group or a 5' phosphate derivative group.
13. The double-stranded ribonucleic acid of any one of claims 1 to 12, wherein the double-stranded ribonucleic acid is an siRNA.
14. The double-stranded ribonucleic acid of any one of claims 1 to 13, wherein the double-stranded ribonucleic acid is an siRNA for inhibiting HMGB1 gene expression.
15. A double-stranded ribonucleic acid modification, which is a modification of a double-stranded ribonucleic acid according to any one of claims 1 to 14, said double-stranded ribonucleic acid modification comprising a chemical modification of at least one of:
(1) Modification of at least one nucleotide in the sense strand,
(2) Modification of the phosphodiester bond in at least one position in the sense strand,
(3) Modification of at least one nucleotide in the antisense strand,
(4) Modification of the phosphodiester bond at least one position in the antisense strand;
optionally, the 3' -end of sequence A in the sense strand of the double-stranded ribonucleic acid is linked to a sequence D consisting of 1-2 nucleotides, preferably 1-2 thymine deoxyribonucleotides; and/or, the 3' -end of the sequence B in the antisense strand of the double-stranded ribonucleic acid is connected with a sequence E consisting of 1-2 nucleotides, preferably a sequence E consisting of 1-2 thymine deoxyribonucleotides; and/or, the 3 '-end of the sequence A in the sense strand of the double-stranded ribonucleic acid excludes 1-2 nucleotides to form a sequence A';
alternatively, the sense strand and the antisense strand of the double-stranded ribonucleic acid modification are selected from the following sequence combinations:
the nucleotide sequence of the sense strand is a sequence shown in a sequence A, and the nucleotide sequence of the antisense strand is a sequence shown in a sequence B;
or the nucleotide sequence of the sense strand is a sequence shown in a sequence A, and the nucleotide sequence of the antisense strand is a sequence shown in a sequence B and a connecting sequence E;
or the nucleotide sequence of the sense strand is a sequence shown in a sequence A and a connecting sequence D, and the nucleotide sequence of the antisense strand is a sequence shown in a sequence B;
Or the nucleotide sequence of the sense strand is a sequence shown in a sequence A connected with a sequence D, and the nucleotide sequence of the antisense strand is a sequence shown in a sequence B connected with a sequence E;
alternatively, the nucleotide sequence of the sense strand is the sequence shown in the sequence A', and the nucleotide sequence of the antisense strand is the sequence shown in the sequence B;
alternatively, the nucleotide sequence of the sense strand is the sequence shown in the sequence A', and the nucleotide sequence of the antisense strand is the sequence shown in the sequence B and the connecting sequence E.
16. The double-stranded ribonucleic acid modification of claim 15, where the modification of the nucleotide is selected from the group consisting of a 2 '-fluoro modification, a 2' -alkoxy modification, a 2 '-substituted alkoxy modification, a 2' -alkyl modification, a 2 '-substituted alkyl modification, a 2' -deoxy modification, a nucleotide derivative modification, or a combination of any two or more thereof.
17. The double-stranded ribonucleic acid modification of claim 15 or 16, wherein the modification of the nucleotide is selected from the group consisting of a 2'-F modification, a 2' -O-CH modification 3 Modification, 2' -O-CH 2 -CH 2 -O-CH 3 Modification, 2' -O-CH 2 -CH＝CH 2 Modification, 2' -CH 2 -CH 2 -CH＝CH 2 Modification, 2' -deoxy modification, nucleotide derivative modification, or a combination of any two or more thereof.
18. The double-stranded ribonucleic acid modification of claim 16 or 17, wherein the nucleotide derivative in the nucleotide derivative modification is selected from the group consisting of an iso-nucleotide, LNA, ENA, cET, UNA, or GNA.
19. The double-stranded ribonucleic acid modification of any one of claims 15 to 18, wherein the ribonucleotides at positions 7, 9, 10 and 11 in the sense strand are 2' -F modified ribonucleotides in the direction of the 5' terminus towards the 3' terminus, the ribose at the remaining positions in the sense strandThe nucleotide being 2' -O-CH 3 Modified ribonucleotides.
20. The double stranded ribonucleic acid modification of any one of claims 15 to 19, wherein the sense strand comprises phosphorothioate linkages at positions as shown in the 5 'to 3' terminal orientation:
between nucleotide 1 and nucleotide 2 from the 5' end of the sense strand;
between nucleotide 2 and nucleotide 3 from the 5' end of the sense strand;
between nucleotide 1 and nucleotide 2 from the 3' end of the sense strand;
between nucleotide 2 and nucleotide 3 from the 3' end of the sense strand;
or,
the sense strand comprises phosphorothioate linkages at the positions shown below:
Between nucleotide 1 and nucleotide 2 from the 5' end of the sense strand;
between nucleotide 2 and nucleotide 3, starting at the 5' end of the sense strand.
21. The double-stranded ribonucleic acid modification of any one of claims 15 to 20, wherein the ribonucleotide at any odd position in the antisense strand in the 5' to 3' terminal direction is 2' -O-CH 3 A modified ribonucleotide, said ribonucleotide at any even numbered position in the antisense strand being a 2' -F modified ribonucleotide;
alternatively, the ribonucleotides at positions 2, 6, 14 and 16 in the antisense strand are 2'-F modified ribonucleotides in the direction of the 5' end toward the 3 'end, and the ribonucleotides at the remaining positions in the antisense strand are 2' -O-CH 3 Modified ribonucleotides;
alternatively, the ribonucleotides at positions 2, 6, 8, 9, 14 and 16 in the antisense strand are 2' -F modified nuclei in the direction from the 5' end to the 3' endSugar nucleotides, the ribonucleotides at the rest of the antisense strand are 2' -O-CH 3 Modified ribonucleotides;
alternatively, the ribonucleotides at positions 2, 14 and 16 in the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 6 in the antisense strand is a nucleotide derivative GNA modified ribonucleotide, and the ribonucleotides at the rest positions in the antisense strand are 2' -O-CH 3 Modified ribonucleotides;
alternatively, in the direction from the 5 '-end to the 3' -end, the ribonucleotides at positions 2, 6, 14 and 16 in the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 7 in the antisense strand is a nucleotide derivative GNA modified ribonucleotide, and the ribonucleotides at the rest positions in the antisense strand are 2' -O-CH 3 Modified ribonucleotides.
22. The double stranded ribonucleic acid modification of any one of claims 15 to 21, wherein the nucleotide at the 5' end of the antisense strand is linked to a 5' phosphate group or a 5' phosphate derivative group in the direction of the 5' end towards the 3' end.
23. The double stranded ribonucleic acid modification of any one of claims 15 to 22, wherein the antisense strand comprises phosphorothioate linkages at positions shown below:
between nucleotide 1 and nucleotide 2 from the 5' end of the antisense strand;
between nucleotide 2 and nucleotide 3 from the 5' end of the antisense strand;
between nucleotide 1 and nucleotide 2 from the 3' end of the antisense strand;
the antisense strand is between nucleotide 2 and nucleotide 3 from the 3' terminus.
24. The double-stranded ribonucleic acid modification of any one of claims 15 to 23, wherein the double-stranded ribonucleic acid modificationThe sense strand of the ornament has a sequence as shown in (a 1 )-(a 5 ) The structure shown in any one of:
(a 1 )5’-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’，
(a 2 )5’-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’，
(a 3 )5’-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’，
(a 4 )5’-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3’，
(a 5 )5’-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-N 10 f-N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -3’；
wherein N is 1 -N 23 Independently of one another, from ribonucleotides of base A, U, C or G,
the capital letter T denotes a deoxyribonucleotide with the base thymine,
the lower case letter m indicates that one ribonucleotide adjacent to the right side of the letter m is 2' -O-CH 3 The modified ribonucleotides are used as the amino acids,
the lower case letter F indicates that the adjacent ribonucleotide to the left of the letter F is a 2' -F modified ribonucleotide,
-(s) -means that two nucleotides adjacent to each other are linked by a phosphorothioate linkage.
25. The double stranded ribonucleic acid modification of any one of claims 15 to 24, wherein the antisense strand of the double stranded ribonucleic acid modification has a sequence as defined in (b 1 )-(b 15 ) The structure shown in any one of:
(b 1 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -N 4 f-mN 5 -N 6 f-mN 7 -N 8 f-mN 9 -N 10 f-mN 11 -N 12 f-mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -N 18 f-mN 19 -(s)-T-(s)-T-3’，
(b 2 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -N 4 f-mN 5 -N 6 f-mN 7 -N 8 f-mN 9 -N 10 f-mN 11 -N 12 f-mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -N 18 f-mN 19 -(s)-N 20 f-(s)-mN 21 -3’，
(b 3 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -N 4 f-mN 5 -N 6 f-mN 7 -N 8 f-mN 9 -N 10 f-mN 11 -N 12 f-mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -N 18 f-mN 19 -N 20 f-mN 21 -(s)-N 22 f-(s)-mN 23 -3’，
(b 4 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’，
(b 5 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’，
(b 6 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’，
(b 7 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -N 8 f-N 9 f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’，
(b 8 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -N 8 f-N 9 f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’，
(b 9 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -N 8 f-N 9 f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’，
(b 10 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -[GNA]N 6 -mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’，
(b 11 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -[GNA]N 6 -mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’，
(b 12 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -[GNA]N 6 -mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’，
(b 13 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-[GNA]N 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-T-(s)-T-3’，
(b 14 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-[GNA]N 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’，
(b 15 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-[GNA]N 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’，
wherein N is 1 -N 23 Independently of one another, from ribonucleotides of base A, U, C or G,
the capital letter T denotes a deoxyribonucleotide with the base thymine,
the lower case letter m indicates that one ribonucleotide adjacent to the right side of the letter m is 2' -O-CH 3 The modified ribonucleotides are used as the amino acids,
the lower case letter F indicates that the adjacent ribonucleotide to the left of the letter F is a 2' -F modified ribonucleotide,
P1 represents that one nucleotide adjacent to the right side of the letter is a nucleotide 5' -phosphate,
-(s) -means that two nucleotides adjacent to each other are linked by phosphorothioate linkages,
[ GNA ] means that one of the ribonucleotides adjacent to the right thereof is a ribonucleotide in which GNA modification is present.
26. The double stranded ribonucleic acid modification of any one of claims 15 to 25, wherein the double stranded ribonucleic acid modification is an siRNA modification.
27. The double stranded ribonucleic acid modification of any one of claims 15 to 26, wherein the double stranded ribonucleic acid modification is an siRNA modification for inhibiting HMGB1 gene expression.
28. The double stranded ribonucleic acid modification of any one of claims 15 to 27, wherein the sense strand and the antisense strand are selected from the group consisting of:
121 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 309 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 343;
122 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 310 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 343;
123 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 311 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 344;
124 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 312 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 345;
125 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 313 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 345;
126 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 314 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 346;
127 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 315 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 347;
128 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 316 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 347;
129 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 317 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 348;
130 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 318 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 349;
131 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 319 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 349;
132 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 320 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 350;
133 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 321 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 350;
134 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 322 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 351;
135 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 323 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 351;
136 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 324 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 352;
137 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 325 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 353;
138 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 326 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 353;
139 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO:327 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 354;
140 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 328 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 355;
141 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 329 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 356;
142 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 330 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 356;
143 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 331 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 357;
144 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 332 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 358;
145 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 333 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 358;
146 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 334 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 359;
147 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 335 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 359;
148 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 336 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 360;
149 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 337 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 360;
150 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 338 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 361;
151 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 339 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 361;
152 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 340 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 362;
153 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 341 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 363;
154 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 342 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 363;
203 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 448 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 471;
204 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 449 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 472;
205 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 449 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 473;
206 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 449 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 474;
207 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 450 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 475;
208 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 450 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 476;
209 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 450 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 477;
210 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 450 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 478;
211 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 451 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 479;
212 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 451 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 480;
213 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 451 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 481;
214 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 451 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 482;
215 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 452 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 483;
216 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 452 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 484;
217 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 453 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 485;
218 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 453 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 486;
219 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 309 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 487;
220 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 310 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 487;
221 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 309 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 488;
222 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 309 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 489;
223 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 309 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 490;
224 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 454 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 491;
225 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 454 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 492;
226 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 455 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 493;
227 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 455 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 494;
228 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 456 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 495;
229 The sense strand comprises the nucleotide sequence set forth in SEQ ID NO. 456 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO. 496;
230 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 457 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 497;
231 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 457 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 498;
232 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 458 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 499;
233 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 458 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 500;
234 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO:459 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO: 501;
235 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 459 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 502;
236 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 460 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 503;
237 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 460 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 504;
238 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 461 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 505;
239 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 461 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 506;
240 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 462 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 507;
241 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 462 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 508;
242 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 463 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 509;
243 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 463 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 510;
244 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 464 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 511;
245 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 464 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 512;
246 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 465 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 513;
247 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 465 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 514;
248 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 466 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 515;
249 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 466 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 516;
250 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 318 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 517;
251 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO:319 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO: 517;
252 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 318 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 518;
253 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 318 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 519;
254 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 318 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 520;
255 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 467 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 521;
256 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 467 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 522;
257 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 468 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 523;
258 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 468 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 524;
259 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 469 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 525;
260 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 469 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 526;
261 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 320 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 527;
262 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 321 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 527;
263 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 320 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 528;
264 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 320 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 529;
265 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 320 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 530;
266 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 470 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 531;
267 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 470 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 532;
268 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 322 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 533;
269 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 323 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 533;
270 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 322 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 534;
271 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 322 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 535;
272 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 322 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 536;
273 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 325 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 537;
274 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 326 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 537;
275 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 325 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 538;
276 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 325 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 539;
277 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 325 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 540;
278 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 329 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 541;
279 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 330 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 541;
280 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 329 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 542;
281 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 329 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 543;
282 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 329 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 544;
283 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 332 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 545;
284 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 333 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 545;
285 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 332 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 546;
286 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 332 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 547;
287 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 332 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 548;
288 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 334 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 549;
289 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 335 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 549;
290 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 334 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 550;
291 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 334 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 551;
292 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 334 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 552;
293 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO:336 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 553;
294 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 336 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 554;
295 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO:336 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 555;
296 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 336 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 556;
351 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 449 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 636;
352 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 452 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 637;
353 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 452 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 638;
354 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 454 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 639;
355 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 454 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 640;
356 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO:457 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 641;
357 The sense strand comprises a nucleotide sequence as shown in SEQ ID NO. 457 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 642;
358 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 465 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 643;
359 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 465 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 644;
360 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 466 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 645;
361 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 466 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 646;
362 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 467 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 647;
363 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 467 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 648;
364 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 468 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 649;
365 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 468 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 650;
366 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 469 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 651;
367 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 469 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 652;
368 The sense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 470 and the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO. 653;
369 The sense strand comprises the nucleotide sequence shown as SEQ ID NO. 470 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 654.
29. A double-stranded ribonucleic acid conjugate, wherein the double-stranded ribonucleic acid conjugate comprises a double-stranded ribonucleic acid according to any one of claims 1 to 14, or a double-stranded ribonucleic acid modification according to any one of claims 15 to 28; and, conjugating a conjugation group attached to the double-stranded ribonucleic acid or the double-stranded ribonucleic acid modification.
30. The double-stranded ribonucleic acid conjugate of claim 29, wherein said conjugate group has the structure:
31. the double stranded ribonucleic acid conjugate of claim 29 or 30, wherein said conjugate group is attached to the 3' end of the sense strand.
32. The double stranded ribonucleic acid conjugate of claim 31, where the conjugate group is attached by a phosphodiester bond conjugated to the 3' end of the sense strand;
preferably, the sense strand and the antisense strand of the double-stranded ribonucleic acid conjugate are complementary to form a double-stranded region of the double-stranded ribonucleic acid conjugate, and the 3 'end of the sense strand forms a blunt end, the 3' end of the antisense strand having 1-2 protruding nucleotides extending out of the double-stranded region;
or,
the sense strand and the antisense strand of the double-stranded ribonucleic acid conjugate are complementary to form a double-stranded region of the double-stranded ribonucleic acid conjugate, and the 3 'end of the sense strand forms a blunt end and the 3' end of the antisense strand forms a blunt end.
33. The double-stranded ribonucleic acid conjugate of any one of claims 29 to 32, wherein the double-stranded ribonucleic acid conjugate has the structure:
wherein the double helix structure is double-stranded ribonucleic acid or double-stranded ribonucleic acid modifier.
34. The double stranded ribonucleic acid conjugate of any of claims 29 to 33, wherein the double stranded ribonucleic acid conjugate is an siRNA conjugate.
35. The double stranded ribonucleic acid conjugate of any one of claims 29 to 34, wherein the double stranded ribonucleic acid conjugate is an siRNA conjugate for inhibiting HMGB1 gene expression.
36. The double-stranded ribonucleic acid conjugate of any of claims 29 to 35, where the double-stranded ribonucleic acid conjugate is formed by the attachment of any one of the sirnas shown in table 1 to a conjugate group, or the double-stranded ribonucleic acid conjugate is formed by the attachment of any one of the siRNA modifications shown in table 2 to a conjugate group;
preferably, the double-stranded ribonucleic acid conjugate is selected from the following:
155 The sense strand of the linker conjugate group comprises the nucleotide sequence shown as SEQ ID NO. 364 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 349;
156 A sense strand of the linker conjugate group comprising a nucleotide sequence as shown in SEQ ID NO. 365 and an antisense strand comprising a nucleotide sequence as shown in SEQ ID NO. 350;
157 The sense strand of the linker conjugate group comprises a nucleotide sequence as shown in SEQ ID NO. 366 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 359;
158 The sense strand of the linker conjugate group comprises a nucleotide sequence as shown in SEQ ID NO. 367 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 360;
159 The sense strand of the linker conjugate group comprises the nucleotide sequence shown as SEQ ID NO. 368 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 363;
160 A sense strand of the linker conjugate group comprising a nucleotide sequence as shown in SEQ ID NO. 369 and an antisense strand comprising a nucleotide sequence as shown in SEQ ID NO. 351;
161 The sense strand of the linker conjugate group comprises the nucleotide sequence shown as SEQ ID NO. 370 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 353;
162 A sense strand of the linker conjugate group comprising a nucleotide sequence as set forth in SEQ ID NO. 371 and an antisense strand comprising a nucleotide sequence as set forth in SEQ ID NO. 356;
163 A sense strand of the linker conjugate group comprising a nucleotide sequence as set forth in SEQ ID NO. 372 and an antisense strand comprising a nucleotide sequence as set forth in SEQ ID NO. 343;
164 The sense strand of the linker conjugate group comprises the nucleotide sequence shown as SEQ ID NO. 373 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 347;
165 The sense strand of the linker conjugate group comprises the nucleotide sequence shown as SEQ ID NO. 374 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 358;
166 The sense strand of the linker conjugate group comprises the nucleotide sequence shown as SEQ ID NO. 375 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 361;
297 A sense strand of the linker conjugate group comprising a nucleotide sequence as set forth in SEQ ID NO. 364 and an antisense strand comprising a nucleotide sequence as set forth in SEQ ID NO. 517;
298 A sense strand of the linker conjugate group comprising a nucleotide sequence as set forth in SEQ ID NO. 364 and an antisense strand comprising a nucleotide sequence as set forth in SEQ ID NO. 518;
299 A sense strand of the linker conjugate group comprising a nucleotide sequence as shown in SEQ ID NO. 365 and an antisense strand comprising a nucleotide sequence as shown in SEQ ID NO. 527;
300 A sense strand of the linker conjugate group comprising a nucleotide sequence as shown in SEQ ID NO. 365 and an antisense strand comprising a nucleotide sequence as shown in SEQ ID NO. 528;
301 The sense strand of the linker conjugate group comprises a nucleotide sequence as shown in SEQ ID NO. 366 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 549;
302 The sense strand of the linker conjugate group comprises the nucleotide sequence shown as SEQ ID NO. 366 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 550;
303 The sense strand of the linker conjugate group comprises a nucleotide sequence as shown in SEQ ID NO:367 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO: 553;
304 The sense strand of the linker conjugate group comprises a nucleotide sequence as shown in SEQ ID NO. 367 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 554;
305 A sense strand of the linker conjugate group comprising the nucleotide sequence shown as SEQ ID NO. 372 and an antisense strand comprising the nucleotide sequence shown as SEQ ID NO. 487;
306 A sense strand of the linker conjugate group comprising a nucleotide sequence as set forth in SEQ ID NO. 372 and an antisense strand comprising a nucleotide sequence as set forth in SEQ ID NO. 488;
307 A sense strand of the linker conjugate group comprising a nucleotide sequence as set forth in SEQ ID NO:369 and an antisense strand comprising a nucleotide sequence as set forth in SEQ ID NO: 533;
308 A sense strand of the linker conjugate group comprising a nucleotide sequence as shown in SEQ ID NO. 369 and an antisense strand comprising a nucleotide sequence as shown in SEQ ID NO. 534;
309 The sense strand of the linker conjugate group comprises the nucleotide sequence shown as SEQ ID NO. 370 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 537;
310 A sense strand of the linker conjugate group comprising a nucleotide sequence as set forth in SEQ ID NO. 370 and an antisense strand comprising a nucleotide sequence as set forth in SEQ ID NO. 538;
311 The sense strand of the linker conjugate group comprises the nucleotide sequence shown as SEQ ID NO. 371 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 541;
312 The sense strand of the linker conjugate group comprises the nucleotide sequence shown as SEQ ID NO. 371 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 542;
313 The sense strand of the linker conjugate group comprises the nucleotide sequence shown as SEQ ID NO. 374 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 545;
314 The sense strand of the linker conjugate group comprises the nucleotide sequence shown as SEQ ID NO. 374 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 546;
315 A sense strand of the linker conjugate group comprising a nucleotide sequence as shown in SEQ ID NO:557 and an antisense strand comprising a nucleotide sequence as shown in SEQ ID NO: 472;
316 The sense strand of the linker conjugate group comprises the nucleotide sequence shown as SEQ ID NO. 558 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 475;
317 A sense strand of the linker conjugate group comprising a nucleotide sequence as shown in SEQ ID NO:559 and an antisense strand comprising a nucleotide sequence as shown in SEQ ID NO: 479;
370 A sense strand of the linker conjugate group comprising a nucleotide sequence as shown in SEQ ID NO:655 and an antisense strand comprising a nucleotide sequence as shown in SEQ ID NO: 483;
371 A sense strand of the linker conjugate group comprising a nucleotide sequence as set forth in SEQ ID NO:655 and an antisense strand comprising a nucleotide sequence as set forth in SEQ ID NO: 484;
372 The sense strand of the linker conjugate group comprises a nucleotide sequence as shown in SEQ ID NO. 656 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 491;
373 A sense strand of the linker conjugate group comprising a nucleotide sequence as shown in SEQ ID NO. 656 and an antisense strand comprising a nucleotide sequence as shown in SEQ ID NO. 492;
374 A sense strand of the linker conjugate group comprising a nucleotide sequence as shown in SEQ ID NO. 657 and an antisense strand comprising a nucleotide sequence as shown in SEQ ID NO. 497;
375 The sense strand of the linker conjugate group comprises a nucleotide sequence as shown in SEQ ID NO. 657 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 498;
376 A sense strand of the linker conjugate group comprising a nucleotide sequence as shown in SEQ ID NO. 658 and an antisense strand comprising a nucleotide sequence as shown in SEQ ID NO. 513;
377 A sense strand of the linker conjugate group comprising a nucleotide sequence as set forth in SEQ ID NO. 658 and an antisense strand comprising a nucleotide sequence as set forth in SEQ ID NO. 514;
378 The sense strand of the linker conjugate group comprises a nucleotide sequence as shown in SEQ ID NO. 659 and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO. 515;
379 The sense strand of the linker conjugate group comprises the nucleotide sequence shown as SEQ ID NO. 659 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 516;
380 The sense strand of the linker conjugate group comprises the nucleotide sequence shown as SEQ ID NO. 660 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 521;
381 The sense strand of the linker conjugate group comprises the nucleotide sequence shown as SEQ ID NO. 660 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 522;
382 A sense strand of the linker conjugate group comprising a nucleotide sequence as set forth in SEQ ID NO:661 and an antisense strand comprising a nucleotide sequence as set forth in SEQ ID NO: 523;
383 A sense strand of the linker conjugate group comprising a nucleotide sequence as set forth in SEQ ID NO:661 and an antisense strand comprising a nucleotide sequence as set forth in SEQ ID NO: 524;
384 A sense strand of the linker conjugate group comprising a nucleotide sequence as shown in SEQ ID NO:662 and an antisense strand comprising a nucleotide sequence as shown in SEQ ID NO: 525;
385 A sense strand of the linker conjugate group comprising a nucleotide sequence as shown in SEQ ID NO:662 and an antisense strand comprising a nucleotide sequence as shown in SEQ ID NO: 526;
386 The sense strand of the linker conjugate group comprises the nucleotide sequence shown as SEQ ID NO:663 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO: 531;
387 The sense strand of the linker conjugate group comprises the nucleotide sequence shown as SEQ ID NO. 663 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 532;
388 A sense strand of the linker conjugate group comprising a nucleotide sequence as shown in SEQ ID NO:557 and an antisense strand comprising a nucleotide sequence as shown in SEQ ID NO: 473;
389 The sense strand of the linker conjugate group comprises the nucleotide sequence shown as SEQ ID NO. 558 and the antisense strand comprises the nucleotide sequence shown as SEQ ID NO. 476.
37. A pharmaceutical composition, wherein the pharmaceutical composition comprises at least one of: the double-stranded ribonucleic acid of any one of claims 1 to 14, a double-stranded ribonucleic acid modification of any one of claims 15 to 28, a double-stranded ribonucleic acid conjugate of any one of claims 29 to 36.
38. The pharmaceutical composition of claim 37, wherein the pharmaceutical composition further comprises one or more pharmaceutically acceptable carriers.
39. The double-stranded ribonucleic acid according to any one of claims 1 to 14, a double-stranded ribonucleic acid modification according to any one of claims 15 to 28, a double-stranded ribonucleic acid conjugate according to any one of claims 29 to 36, or a pharmaceutical composition according to any one of claims 37 to 38 for use in at least one of:
(1) Inhibiting HMGB1 gene expression, or preparing a medicament for inhibiting HMGB1 gene expression;
(2) For preventing or treating diseases related to the abnormal expression of the HMGB1 gene, or for preparing a medicament for preventing or treating diseases related to the abnormal expression of the HMGB1 gene;
(3) For use in treating a subject suffering from a disease that would benefit from reduced HMGB1 gene expression, or in the manufacture of a medicament for use in treating a subject suffering from a disease that would benefit from reduced HMGB1 gene expression.
40. Use according to claim 39, wherein the disease associated with aberrant expression of the HMGB1 gene is selected from the group consisting of:
non-alcoholic steatohepatitis, sepsis, arthritis, colitis, acute lung injury, colorectal cancer, gastric cancer, myelodysplastic syndrome, acute myeloid leukemia, chronic myelogenous leukemia, acute lymphoblastic leukemia, lymphoma, multiple myeloma, atherosclerosis, and other related conditions, pathologies or syndromes not yet identified.
41. A method for inhibiting HMGB1 gene expression in a cell, wherein the method comprises contacting the cell with a double stranded ribonucleic acid according to any one of claims 1 to 14, a double stranded ribonucleic acid modification according to any one of claims 15 to 28, a double stranded ribonucleic acid conjugate according to any one of claims 29 to 36, or a pharmaceutical composition according to any one of claims 37 to 38.
42. The method of claim 41, wherein the cell is an in vivo cell or an in vitro cell.
43. The method of claim 41 or 42, wherein the cell is in a subject.
44. The method according to claim 43, wherein the subject is a mammal, preferably a human.
45. The method of claim 43 or 44, wherein the subject has at least one of the following characteristics:
in vivo abnormal expression of the HMGB1 gene, more specifically abnormal high expression of the HMGB1 gene;
has a disease associated with abnormal expression of the HMGB1 gene;
with diseases that would benefit from reduced HMGB1 gene expression.
CN202311206215.4A 2022-09-20 2023-09-19 Double-stranded ribonucleic acid for inhibiting HMGB1 gene expression, and modification, conjugate and application thereof Pending CN117264954A (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN202211145875 2022-09-20
CN2022111458751 2022-09-20

Publications (1)

Publication Number Publication Date
CN117264954A true CN117264954A (en) 2023-12-22

Family

ID=89207403

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202311206215.4A Pending CN117264954A (en) 2022-09-20 2023-09-19 Double-stranded ribonucleic acid for inhibiting HMGB1 gene expression, and modification, conjugate and application thereof

Country Status (2)

Country Link
CN (1) CN117264954A (en)
WO (1) WO2024061202A1 (en)

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111050776A (en) * 2017-06-29 2020-04-21 迪克纳制药公司 Compositions and methods for inhibiting expression of HMGB1
KR20200110655A (en) * 2017-12-18 2020-09-24 알닐람 파마슈티칼스 인코포레이티드 High mobility group box-1 (HMGB1) IRNA composition and method of use thereof
US20220072024A1 (en) * 2018-12-28 2022-03-10 Dicerna Pharmaceuticals, Inc. Compositions and methods for inhibiting hmgb1 expression

Also Published As

Publication number Publication date
WO2024061202A1 (en) 2024-03-28

Similar Documents

Publication Publication Date Title
EP3719127A1 (en) Nucleic acid, composition and conjugate containing same, preparation method, and use
WO2019105414A1 (en) Nucleic acid, composition and conjugate containing nucleic acid, preparation method therefor and use thereof
EP3903830A1 (en) Nucleic acid, composition and conjugate containing nucleic acid, preparation method therefor and use thereof
WO2020135581A1 (en) Nucleic acid, composition and conjugate containing nucleic acid, preparation method therefor and use thereof
CN111973619B (en) Nucleic acid, pharmaceutical composition containing nucleic acid, siRNA conjugate, preparation method and application
EP3974530A1 (en) Nucleic acid, pharmaceutical composition, conjugate, preparation method, and use
CN111973618B (en) Nucleic acid, pharmaceutical composition and siRNA conjugate, and preparation method and application thereof
CN113891939B (en) Nucleic acid, pharmaceutical composition and conjugate, and preparation method and application thereof
CN113227376B (en) Nucleic acid, pharmaceutical composition and conjugate, and preparation method and application thereof
WO2020238763A1 (en) Nucleic acid, pharmaceutical composition and conjugate, preparation method and use
CN113614230B (en) Nucleic acid, pharmaceutical composition and conjugate, and preparation method and application thereof
CN116769780A (en) siRNA for inhibiting expression of complement factor B, conjugate and pharmaceutical composition thereof and use thereof
CN117264954A (en) Double-stranded ribonucleic acid for inhibiting HMGB1 gene expression, and modification, conjugate and application thereof
WO2022143531A1 (en) Nucleic acid, pharmaceutical composition and sirna conjugate containing the nucleic acid, preparation method therefor, and use thereof
CN117264950A (en) Double-stranded ribonucleic acid for inhibiting C5 gene expression, and modification, conjugate and application thereof
CN116987696A (en) Double-stranded ribonucleic acid for inhibiting ANGPTL3 gene expression, and modification, conjugate and application thereof
CN117384902A (en) Double-stranded ribonucleic acid for inhibiting CYP27A1 gene expression, and modification, conjugate and application thereof
CN116622710A (en) Double-stranded ribonucleic acid for inhibiting C3 gene expression, and modification, conjugate and application thereof
CN117327698A (en) Double-stranded ribonucleic acid for inhibiting LPA gene expression, and modifications, conjugates and uses thereof
CN117757790A (en) siRNA for inhibiting SCAP gene expression, conjugate, pharmaceutical composition and application thereof
WO2023213284A1 (en) Nucleic acid, composition and conjugate comprising same, preparation method therefor, and use thereof
CN117645995A (en) SiRNA for inhibiting expression of asialoglycoprotein receptor gene, conjugate, pharmaceutical composition and application thereof
WO2022196668A1 (en) Nucleic acid drug targeting itgav
CN116515835A (en) siRNA for inhibiting HSD17B13 expression, conjugate and pharmaceutical composition thereof and application thereof
WO2020233680A1 (en) Nucleic acid, pharmaceutical composition, conjugate, preparation method, and use

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination