CN117230036A

CN117230036A - OsUBC45 protein related to plant disease resistance and yield increase as well as related biological material and application thereof

Info

Publication number: CN117230036A
Application number: CN202210640370.6A
Authority: CN
Inventors: 陈倩; 彭友良; 王羽
Original assignee: China Agricultural University
Current assignee: China Agricultural University
Priority date: 2022-06-08
Filing date: 2022-06-08
Publication date: 2023-12-15

Abstract

The application discloses an OsUBC45 protein related to plant disease resistance and yield increase and a related biological material and application thereof. The OsUBC45 protein can be specifically the protein of the following A1), A2) or A3): a1 Amino acid sequence is protein of SEQ ID No.1 in a sequence table; a2 Protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the protein of A1), has more than 75 percent of identity with the protein shown in A1) and has the activity of regulating and controlling the disease resistance and the yield increase of plants; a3 Fusion proteins obtained by ligating protein tags at the N-terminal or/and C-terminal of A1) or A2). OsUBC45 protein and related biological materials thereof can be used for regulating and controlling disease resistance and yield increase of plants.

Description

OsUBC45 protein related to plant disease resistance and yield increase as well as related biological material and application thereof

Technical Field

The application relates to an OsUBC45 protein related to plant disease resistance and yield increase in the technical field of biology, and a coding gene and application thereof.

Background

The rice is a main ration crop, and diseases such as rice blast seriously affect the yield and quality of the rice, and become one of important restriction factors for stable yield of the rice. The rice blast frequently occurs in each rice cultivation area, and the spraying of chemical bactericides and the cultivation of disease-resistant varieties are the main means for preventing and treating the rice blast. However, the wide use of bactericides causes environmental pollution and affects the quality of agricultural products, so that the cultivation of disease-resistant varieties becomes the most economical and effective choice for defending plant diseases. Therefore, it is important to explore how to deal with rice blast and to explore the excellent genes of broad-spectrum disease resistance of rice.

Ubiquitin proteasome pathways play an important role in plant growth and development, as well as in plant response to abiotic and biotic stresses. The ubiquitin proteasome pathway is catalyzed by three enzymes, namely ubiquitin activating enzyme, ubiquitin binding enzyme and ubiquitin ligase, which are cascaded, and finally ubiquitin small molecules are added on substrate proteins and mainly act through mediating degradation of the substrate proteins. Each ubiquitin ligase can have multiple substrate proteins and regulate different signaling pathways and phenotypes by mediating ubiquitination modification and degradation of different substrate proteins. In recent years researchers have found that key components of the ubiquitin proteasome pathway play an important role in rice blast resistance. RING type E3 ligase OsBBI1 is induced to express by rice blast, and over-expression of OsBBI1 in rice can enhance the resistance of the rice to various rice blast micro-species by changing the defense response of cell walls. EBR1 also encodes a RING type E3 ligase, EBR1 exhibited high resistance to both rice blast and leaf blight. Studies show that OsBAG4 is a ubiquitinated substrate of EBR1, and the module plays a broad-spectrum disease-resistant role mainly by regulating immune response stimulated by pathogen-associated molecular patterns of plants. The above studies demonstrate that ubiquitin-related components play an important role in rice blast resistance in rice.

The degradation process of endoplasmic reticulum related proteins is catalyzed by ubiquitin-binding enzymes and ubiquitin ligases which are positioned in the endoplasmic reticulum membrane or anchored in the endoplasmic reticulum membrane by other proteins, and plays an important role in helping the normal growth of plants and adapting to abiotic stresses such as high temperature, salt, drought and the like. Studies have shown that in Arabidopsis, molecular pattern flg22 can induce endoplasmic reticulum stress, up-regulate the expression of non-folding protein response related coding genes Bip, CNX, PDI, etc., suggesting that non-folding protein response and endoplasmic reticulum related protein degradation pathways may be involved in the plant's process of resisting biotic stress. The ubiquitin-proteasome approach of plants is researched and utilized, more ubiquitin-related components or ubiquitination substrates are discovered, and the working modes of the ubiquitin-proteasome approach and the ubiquitination substrates are analyzed, so that the ubiquitin-proteasome approach is a new break for cultivating disease-resistant materials.

Antagonism often exists between high yield and disease resistance of rice, and generally, the enhancement of defense is accompanied by the cost of dwarf plants and reduced yield, while high yield is poor in resistance. At present, few genes which can be identified simultaneously and high in yield and resistance are identified, the transcription factor IPA1 is an excellent gene which can simultaneously realize disease resistance and yield increase, and research discovers that the phosphorylation modification of IPA1 protein is a key pivot for balancing the yield and the resistance of rice. The non-phosphorylated IPA1 is combined with a promoter of a development related gene DEP1 to promote the expression of the gene DEP1 and is responsible for increasing the yield of rice; phosphorylated IPA1 preferentially binds to the promoter of the disease-resistance related gene WRKY45, promoting its expression, responsible for enhancing immune responses. Therefore, maintaining the balance between plant disease resistance and growth is a key for cultivating high-resistance stable-yield rice; the development of more excellent gene resources with high disease resistance and high yield is significant for cultivating disease-resistant stable rice varieties.

Disclosure of Invention

The application aims to solve the technical problem of how to regulate and control disease resistance and yield increase of plants.

The application provides a protein, named OsUBC45, which is the protein of A1), A2) or A3) as follows:

a1 Amino acid sequence is protein of SEQ ID No.1 in a sequence table;

a2 Protein which is obtained by substituting and/or deleting and/or adding amino acid residues of the protein of A1), has more than 75 percent of identity with the protein shown in A1) and has the activity of regulating and controlling plant disease resistance and increasing yield;

a3 Fusion proteins obtained by ligating protein tags at the N-terminal or/and C-terminal of A1) or A2).

Wherein SEQ ID No.1 consists of 313 amino acid residues.

The protein can be derived from rice.

In the above proteins, the identity refers to the identity of amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the internet, such as BLAST web pages of the NCBI homepage website. For example, in advanced BLAST2.1, the identity of a pair of amino acid sequences can be searched for by using blastp as a program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as Matrix, setting Gap existence cost, per residue gap cost and Lambda ratio to 11,1 and 0.85 (default values), respectively, and calculating, and then obtaining the value (%) of the identity.

In the above protein, the above 75% identity may be at least 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% identity.

Among the above proteins, the protein tag (protein-tag) refers to a polypeptide or protein that is fusion expressed together with a target protein by using a DNA in vitro recombination technique, so as to facilitate the expression, detection, tracing and/or purification of the target protein. The protein tag can be Flag tag, his tag, MBP tag, HA tag, myc tag, GST tag and/or SUMO tag, and the amino acid sequence of part of available tag is shown in table 1.

TABLE 1 sequence of tags

The protein can be synthesized artificially or obtained by synthesizing the coding gene and then biologically expressing.

Biological materials related to the protein OsUBC45 are also within the scope of the present application.

The biological material related to the protein OsUBC45 provided by the application is any one of the following B1) to B5):

is any one of the following B1) to B5):

b1 A nucleic acid molecule encoding said protein OsUBC 45;

b2 An expression cassette comprising the nucleic acid molecule of B1);

b3 A recombinant vector comprising the nucleic acid molecule of B1) or a recombinant vector comprising the expression cassette of B2);

b4 A recombinant microorganism comprising the nucleic acid molecule of B1), or a recombinant microorganism comprising the expression cassette of B2), or a recombinant microorganism comprising the recombinant vector of B3);

b5 A transgenic plant cell line, a transgenic plant tissue or a transgenic plant organ comprising the nucleic acid molecule of B1), or a transgenic plant cell line, a transgenic plant tissue or a transgenic plant organ comprising the expression cassette of B2).

Wherein the nucleic acid molecule may be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.

In the above biological material, the DNA molecule of B1) is a gene as shown in any one of the following B1) to B3):

b1 A cDNA molecule or a DNA molecule of SEQ ID No. 3;

b2 A DNA molecule of SEQ ID No. 3;

b3 Nucleotides 3001 to 5899 of SEQ ID No. 2.

In the above biological material, the expression cassette (OsUBC 45 gene expression cassette) containing the DNA molecule described in B2) refers to a DNA molecule capable of expressing OsUBC45 in a host cell, and the DNA molecule may include not only a promoter for promoting transcription of OsUBC45 gene but also a terminator for terminating transcription of OsUBC45. Further, the expression cassette may also include an enhancer sequence. Promoters useful in the present application include, but are not limited to: constitutive promoters, tissue, organ and development specific promoters, and inducible promoters. Examples of promoters include, but are not limited to: the self promoter of the gene OsUBC45 (the nucleotide sequence is shown in positions 1-3000 of SEQ ID No. 2); a constitutive promoter of cauliflower mosaic virus 35S; wound-inducible promoter from tomato, leucine aminopeptidase ("LAP", chao et al (1999) Plan)t physiolog 120:979-992); a chemically inducible promoter from tobacco, pathogenesis-related 1 (PR 1) (induced by salicylic acid and BTH (benzothiadiazole-7-carbothioic acid S-methyl ester); tomato protease inhibitor II promoter (PIN 2) or LAP promoter (both inducible with jasmonic acid ester); heat shock promoters (U.S. Pat. No. 5,187,267); tetracycline-inducible promoters (U.S. Pat. No. 5, 057,422); seed-specific promoters, such as the millet seed-specific promoter pF128 (CN 101063139B (China patent 2007 1 0099169.7)), seed storage protein-specific promoters (e.g., the promoters of phaseolin, napin, oleosin and soybean beta-glycin (Beachy et al (1985) EMBO J.4:3047-3053)). They may be used alone or in combination with other plant promoters. All references cited herein are incorporated by reference in their entirety. Suitable transcription terminators include, but are not limited to: agrobacterium nopaline synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator and nopaline and octopine synthase terminator (see, e.g., odell et al (I) ⁹⁸⁵ ) Nature 313:810; rosenberg et al (1987) Gene,56:125; guerineau et al (1991) mol. Gen. Genet,262:141; proudroot (1991) Cell,64:671; sanfacon et al Genes Dev.,5:141; mogen et al (1990) Plant Cell,2:1261; munroe et al (1990) Gene,91:151; ballad et al (1989) Nucleic Acids Res.17:7891; joshi et al (1987) Nucleic Acid Res., 15:9627).

Recombinant vectors containing the gene encoding the protein OsUBC45 or the gene expression cassette encoding the protein OsUBC45 can be constructed by using existing plant expression vectors. The plant expression vector may be a Gateway system vector or a binary agrobacterium vector, etc., such as pCG1301, pGWB411, pGWB412, pGWB405, pBin438, pCAMBIA1302, pCAMBIA2300, pCAMBIA2301, pCAMBIA1301, pGWB18, pBI121, pCAMBIA1391-Xa, or pCAMBIA1391-Xb. When OsUBC45 is used to construct a recombinant vector, any one of enhanced, constitutive, tissue-specific or inducible promoters such as cauliflower mosaic virus (CAMV) 35S promoter, ubiquitin gene Ubiqutin promoter (pUbi) and the like can be added before the transcription initiation nucleotide thereof, and can be used alone or in combination with other plant promoters; in addition, when the gene of the present application is used to construct a plant expression vector, enhancers, including translational enhancers or transcriptional enhancers, may be used, and these enhancers may be ATG initiation codon or adjacent region initiation codon, etc., but must be identical to the reading frame of the coding sequence to ensure proper translation of the entire sequence. The sources of the translational control signals and initiation codons are broad, and can be either natural or synthetic. The translation initiation region may be derived from a transcription initiation region or a structural gene.

In order to facilitate the identification and selection of transgenic plant cells or plants, the plant expression vectors used may be processed, for example, by adding genes encoding enzymes or luminescent compounds which produce a color change (GUS gene, luciferase gene, etc.), antibiotic markers with resistance (gentamicin markers, kanamycin markers, etc.), or anti-chemical marker genes (e.g., anti-herbicide genes), etc., which may be expressed in plants.

In the above biological material, the recombinant microorganism may specifically be yeast, bacteria, algae and fungi; the bacterium may be an agrobacterium EHA105 strain.

The use of the above proteins, or any of the following C1-C2 of the above biological materials, is also within the scope of the present application:

c1 Use in regulating plant disease resistance and/or plant yield;

c2 The use of the composition for controlling plant disease resistance and/or plant yield.

In the present application, the modulation may be up-regulation or enhancement or improvement.

The application also provides a method for improving plant disease resistance and/or plant yield, which comprises the step M, wherein the step M is used for enhancing, improving or up-regulating the activity and/or content of the OsUBC45 protein in a target plant, or/and enhancing, improving or up-regulating the expression level of a coding gene of the OsUBC45 protein so as to improve plant disease resistance and/or plant yield.

In the above method, the plant may be a gramineous plant, specifically, rice.

In the method, the disease resistance can be specifically expressed as that after the rice blast pathogenic bacteria are infected, the length (the area of the disease spots) of the target plant leaves is shorter (smaller) than that of the receptor plants, and the biomass of the rice blast pathogenic bacteria on the target plant leaves is smaller than that of the receptor plants. The yield can be expressed in particular as that the spike length of the target plant is longer than that of the receptor plant, the seed length of the target plant is longer than that of the receptor plant, the thousand seed weight of the seed of the target plant is heavier than that of the receptor plant, and the single plant yield of the target plant is higher than that of the receptor plant.

In order to solve the technical problems, the application also provides a plant reagent which is used for regulating and controlling the disease resistance and yield increase of plants.

The plant reagent provided by the application contains the protein or/and the protein related biological material.

The active ingredients of the plant agent can be the protein or/and the biological material related to the protein, the active ingredients of the plant agent can also contain other biological ingredients or/and non-biological ingredients, and the other active ingredients of the plant agent can be determined by a person skilled in the art according to the disease resistance and yield increase effect of plants.

The plant of interest may be a monocot or dicot. The monocotyledonous plant may be a plant of the Gramineae family, in particular rice.

Experiments of over-expressing the OsUBC45 gene in rice prove that compared with receptor rice, the transgenic rice over-expressing the OsUBC45 protein has enhanced resistance to rice blast, and the yield is not reduced, but is increased to a certain extent, so that the OsUBC45 protein is a gene related to plant disease resistance and yield increase, and the over-expression of the OsUBC45 protein improves plant disease resistance and yield increase. The method of the application has simple operation and low cost, greatly accelerates the breeding process and has wide application prospect.

Drawings

Fig. 1 shows the relative expression levels of OsUBC45 gene in wild-type medium flower 11 (WT) and OsUBC45 overexpressing plants (OE 2, OE3, OE 8) of example 2 of the present application, where P <0.05 represents the difference significance analysis result and P <0.01 represents the difference significance analysis result.

FIG. 2 shows the results of the detection of rice blast susceptibility by wild-type medium flower No. 11 and OsUBC45 overexpressing plants (OE 2, OE3, OE 8) in example 2 of the present application. Panel A of FIG. 2 shows the phenotype of wild type medium flower 11 (WT), OE2, OE3 and OE8 after inoculation with RB22 strain. Fig. 2B is a graph of statistics of the lesion length in fig. 2 a. FIG. 2C shows the result of detecting Pyricularia oryzae biomass in FIG. 2A. Panel D of FIG. 2 shows the phenotype of wild type medium flower No. 11 (WT), OE2 (designated 2) and OE8 (designated 8) after inoculation with SZ3005-2 strain, SZ3005-4 strain and SZ3005-5 strain. Fig. 2E is a graph of the statistics of the lesion length in fig. 2D. In the figure, P <0.05 represents the difference significance analysis result, and P <0.01 represents the difference significance analysis result.

FIG. 3 shows the level of MAPK activation in wild-type flower 11 (WT) and OsUBC45 overexpressing plants (OE 2, labeled OsUBC45-OE 2) at different time points after chitin treatment in example 3 of the application.

FIG. 4 shows the relative expression levels of the disease-resistance-related gene after chitin treatment in example 4 of the present application in wild type flower 11 (WT) and OsUBC45 overexpressing plants (OE 2, labeled OsUBC45-OE 2). In the figure, the difference significance analysis result is P <0.01. The disease-associated genes are OsPR4-1 (labeled PR 4-1), osPR4-2 (labeled PR 4-2), osPR5-1 (labeled PR 5-1) and OsPR10 (labeled PR 10).

FIG. 5 shows the yield statistics of wild-type medium flower No. 11 (WT) and OsUBC45 overexpressing plants (OE 2, OE3, OE 8) in example 5 of the present application. Panel A of FIG. 5 is a photograph of a rice ear. Panel B of FIG. 5 shows spike length statistics. Panel C of FIG. 5 shows the individual yield statistics. Fig. 5D is a seed photograph. Figure E of fig. 5 is a thousand kernel weight statistic of seeds. In the figure, P <0.05 represents the difference significance analysis result, and P <0.01 represents the difference significance analysis result.

Detailed Description

The following detailed description of the application is provided in connection with the accompanying drawings that are presented to illustrate the application and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the application in any way.

The quantitative tests in the following examples were all performed in triplicate, and the results were averaged.

The experimental methods in the following examples are conventional methods unless otherwise specified. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

The vectors pCG1301 in the examples described below are all described in non-patent documents "Zhao et al, 2021 (Tianchosing Zhao, tiancheng Qia, huijing Feng, changfa Yin, xunei Zheng, jun Yang, young Peng, wensheng Zhao.2021.A novel glycine-rich domain protein, GRDP1, functions as a critical feedback regulator for controlling cell death and disease resistance in rice, journal of Experimental Botany,72 (2): 608-622.)", and are publicly available from the national agricultural university (i.e., the applicant) to repeat the experiments of the present application, and are not useful for other purposes.

Flower 11 in the rice varieties in the following examples is a variety bred by the institute of crop science of the national academy of agricultural sciences, and is examined and approved in 1989, numbered: the jin's rice 1989016, which is publicly available from the university of agricultural science (i.e., applicant) to repeat the experiments of the present application, is not available for other uses.

The Magnaporthe grisea (Magnaporthe oryzae) RB22 strain, SZ3005-2 strain, SZ3005-4 strain and SZ3005-5 strain, which are rice blast pathogens, are all other laboratory gifts, described in non-patent literature, "Zhang et al Plant Biotechnology Journal,2020 (Zhang CY., fang H., shi XT., he F., wang RY., fan JB., bai PF., wang JY., park CH., bellizzi M., zhou XP., wang G., ning YS.A fungal effector and a rice NLR protein have antagonistic effects on a Bowman-Birk try inhibitor.plant Biotechnology journal.18:2354-2363, 2020)"; the SZ3005-2 strain, the SZ3005-4 strain and the SZ3005-5 strain are isolated and stored in the laboratory, and are publicly available from the national agricultural university (i.e., applicant) to repeat the experiments of the present application, and cannot be used for other purposes.

The composition and use concentration of the MS medium in the examples below are shown in Table 2.

TABLE 2MS Medium composition and use concentration

The following examples were run using GraphPad Prism 8 statistical software and the experimental results were expressed as mean ± standard deviation, with a t-test, P <0.05 (x) for significant differences and P <0.01 (x) for very significant differences.

Example 1 construction of OsUBC45 overexpression vector

The genomic sequence of the OsUBC45 gene is shown in SEQ ID No.2, wherein the 1 st to 3000 th positions are self promoters, the 3111 st to 3224 th positions are first exons, the 3660 th to 3791 th positions are second exons, the 3880 th to 3964 th positions are third exons, the 4882 th to 5045 th positions are fourth exons, and the 5125 th to 5271 th positions are fifth exons.

The cDNA of flower 11 in rice variety is used as a template, the open reading frame sequence of the OsUBC45 gene is obtained through PCR amplification, and the PCR product is recovered, and the primers are as follows:

OsUBC45-GFP-F：5’-CATGGTACCATGGAGGCCACGGCGAAGT-3' (underlined sequence is Kpn I enzyme recognition site sequence);

OsUBC45-GFP-R：5’-TCCTCTAGAAAACTTGCCCTCAATGTAACCG-3' (underlined sequence is Xba I enzyme recognition site sequence).

Through sequencing, the nucleotide sequence of the coding sequence of the OsUBC45 gene is shown as SEQ ID No.3, the coding protein OsUBC45 is coded, and the amino acid sequence of the protein is shown as SEQ ID No.1.

The PCR product was digested simultaneously with Kpn I and Xba I, and the digested fragment was recovered as an OsUBC45 gene fragment. Simultaneously, the carrier pCG1301 is subjected to double digestion by Kpn I enzyme and Xba I enzyme, the digested OsUBC45 gene fragment is connected to the carrier pCG1301 subjected to double digestion, and sequencing is carried out after bacterial liquid PCR verification. The plasmid with correct sequence is recombinant expression vector pCG1301-OsUBC45 containing OsUBC45 gene. The recombinant expression vector pCG1301-OsUBC45 is obtained by replacing a fragment (a small fragment including a Kpn I enzyme recognition site and an Xba I enzyme recognition site) between a restriction endonuclease Kpn I enzyme and an Xba I enzyme recognition site of the vector pCG1301 with an OsUBC45 gene with a nucleotide of SEQ ID No.3, and keeping the other sequences of the pCG1301 vector unchanged. In the recombinant expression vector pCG1301-OsUBC45, the 35S promoter driving the expression of the OsUBC45 gene.

In the construction process of the recombinant expression vector pCG1301-OsUBC45, the OsUBC45 gene shown in SEQ ID No.3 can also be artificially synthesized.

Example 2 establishment, identification and anti-Pyricularia phenotypic analysis of OsUBC45 overexpressing Rice lines

1. Establishment and identification of OsUBC45 over-expressed rice strain

The OsUBC45 over-expression rice line is established by the following steps:

1. recombinant expression vector pCG1301-OsUBC45 obtained in example 1 was introduced into Agrobacterium strain EHA105 to obtain recombinant Agrobacterium EHA105-OsUBC45.

2. Infecting the calli of flower 11 in the rice variety with the recombinant agrobacterium EHA105-OsUBC45 obtained in the step 1, and obtaining T through hygromycin screening ₀ And replacing the transformant.

3. Scissoring wild Zhonghua No. 11 and T ₀ And (5) replacing leaves of the transformant, and respectively extracting DNA. Hyg-F and Hyg-R primers were used to generate wild type Zhonghua No. 11 and T ₀ The DNA of the transformant is used as a template for amplification, and the specific sequences of the Hyg-F and the Hyg-R are as follows:

Hyg-F：5’-AGCTGCGCCGATGGTTTCTACAA-3’；

Hyg-R：5’-ATCGCCTCGCTCCAGTCAATG-3’。

the PCR fragment obtained is subjected to gel running detection, and the plant amplified to obtain the hygromycin fragment of about 500bp is T ₀ Transgenic positive plants of the generation OsUBC45 (namely, osUBC45 over-expression plants).

4. Will T ₀ Transgenic male OsUBC45Transplanting the sexual plants into soil, and collecting T by selfing ₁ The seeds of the generation are continuously planted and then are selfed to collect T ₂ Seed of generation, and by comparison with T ₂ And analyzing the hygromycin resistance segregation condition of the generation, and selecting a plurality of transgenic homozygous lines, wherein 3 transgenic homozygous lines are respectively numbered as OsUBC45-OE2, osUBC45-OE3 and OsUBC45-OE8.

5. Total RNA of rice was extracted, cDNA was obtained by reverse transcription, qRT-PCR was performed, osActin1 gene was used as an internal reference, and the expression level of OsUBC45 gene in wild type flower No. 11 (WT) and each transgenic homozygous strain (OsUBC 45-OE2, osUBC45-OE3, osUBC45-OE 8) was detected by a fluorescent quantitative PCR apparatus (ABI 7500, USA).

The primer sequences used are shown in Table 3, and the experiment was repeated three times.

TABLE 3 primer sequences

Gene name	Forward primer 5'-3'	Reverse primer 5'-3'
			OsUBC45	CTGTTCCTCAGCTGCTGACA	AGGATTCTGTGGCGTTGGAG
OsActin1	ACCATTGGTGCTGAGCGTTT	CGCAGCTTCCATTCCTATGAA

As a result, it was found that the expression of OsUBC45 gene in transgenic rice was significantly up-regulated as shown in FIG. 1.

2. Detection of resistance of OsUBC45 overexpressed rice lines to rice blast

The rice blast resistance was tested and the scratch inoculation observation phenotype was performed as follows:

1. seeds of wild type middle flower No. 11 and three over-expressed transgenic lines (OsUBC 45-OE2, osUBC45-OE3, osUBC45-OE 8) were germinated with water in an incubator at 37℃for two days, then transferred to a 9cm diameter cuvette, and cultured for about 20 days to four leaves and one heart during culture at 30 ℃. The greenhouse was kept at a relative humidity of 70%, illuminated for 14 hours daily and dark for 10 hours.

2. Pyricularia oryzae (Magnaporthe oryzae) RB22 strain, SZ3005-2 strain, SZ3005-4 strain and SZ3005-5 strain were activated, respectively, and grown in dishes in an incubator at 28℃for about 10 days.

3. Taking the second leaf of the four-leaf one-heart period rice in the step 1, and taking at least 5 leaves for each strain. Cutting into 6cm-7cm length, and lightly drawing about 1mm with insect needle ² Three wounds were made on each leaf main vein. The treated scratched leaves are placed in a culture dish with the thickness of 9cm multiplied by 9cm, and wet filter paper is placed in the culture dish in advance to play a role in moisturizing.

4. Spores of RB22 strain, SZ3005-2 strain, SZ3005-4 strain and SZ3005-5 strain on the dishes of step 2 were rinsed with 0.025% Tween respectively, and the spore liquid was adjusted to 1.5X10 ⁵ The concentration of each mL gave RB22 spore suspension, SZ3005-2 spore suspension, SZ3005-4 spore suspension and SZ3005-5 spore suspension.

5. Spraying tween water 0.025% on the surface of the leaf after the treatment in step 3 to form mist and increase the adhesion of spore suspension.

6. The leaves treated in step 5 were then subjected to 10. Mu.L of spore suspension (RB 22 spore suspension, SZ3005-2 spore suspension, SZ3005-4 spore suspension or SZ3005-5 spore suspension) per wound (see step 4). The inoculated leaves were kept moist in a petri dish and were left to stand in a dark environment for 24 hours to 36 hours.

7. After dark treatment, dishes were moved to light conditions, plaques were observed after 4-5 days and photographed, the phenotypes of wild type strain Nos. 11 (WT), osUBC45-OE2, osUBC45-OE3 and OsUBC45-OE8 after the inoculation of RB22 strain were shown in panel A of FIG. 2, and the phenotypes of wild type strain Nos. 11 (WT), osUBC45-OE2 (labeled 2) and OsUBC45-OE8 (labeled 8) after the inoculation of strain SZ3005-2 (SZ 3005-2), strain SZ3005-4 (SZ 3005-4) and strain SZ3005-5 (SZ 3005-5) were shown in panel D of FIG. 2.

The disease length statistics is carried out, and the specific steps are as follows:

the length of each lesion after infection of different strains in different OsUBC45 over-expressed plants was measured separately, about 15 lesion lengths were counted, the average value was calculated and the significance difference was calculated by student t-test, and the results are shown in fig. 2B and fig. 2E.

Quantitative determination of bacterial biomass in rice leaves is carried out:

specific methods are described in the text "Yoji Kawano, akira Akamatsu, keiko Hayashi, yueuke Housen, jun Okuda, ai Yao, ayako Nakashima, hiroki Takahashi, hitoshi Yoshida, hann Ling Wong, tsutomu Kawasaki, ko shimamoto. Activate of a Rac GTPase by the NLR family disease resistance protein Pit plays a critical role in rice innate immunity, cell Host Microbe,2010,7 (5): 362-75".

The leaf blade of 3X 1cm size including the lesion after inoculation of RB22 strain was extracted with DNA by conventional CTAB method, and 1. Mu.L of RNase (RNase concentration 10mg mL ^-1 ) The DNA is treated to remove RNA.

By using a real-time fluorescent quantitative PCR technology, SYBR green I fluorescent dye is added into a PCR system according to a using method provided by a manufacturer (Genestar), and the expression condition of the Magnaporthe grisea MoPot2 gene is detected by a fluorescent quantitative PCR instrument (ABI 7500, USA) by taking the rice Ubiquitin gene as an internal reference. The primer sequences used are shown in Table 4. The experiment was repeated three times and the results are shown in figure 2, panel C.

TABLE 4 primer sequences

Gene name	Forward primer 5'-3'	Reverse primer 5'-3'
			MoPot2	ACGACCCGTCTTTACTTATTTGG	AAGTAGCGTTGGTTTTGTTGGAT
OsUbiqintin	TTCTGGTCCTTCCACTTTCAG	ACGATTGATTTAACCAGTCCATGA

The results in FIG. 2 show that the OsUBC45 over-expressed rice line inoculated with the rice blast pathogen has an enhanced resistance to rice blast, which is characterized by a shortened length of rice blast lesions on rice leaves and a reduced biomass of rice blast bacteria, as compared with the wild type inoculated with the rice blast pathogen.

EXAMPLE 3 activation level of MAPKs in OsUBC45 overexpressing Rice lines upon chitin treatment

The activation level of MAPKs in OsUBC45 over-expressed rice lines is detected by the following specific method:

1. seeds of wild type medium flower 11 (WT) and OsUBC45 overexpressing plants (OE 2) were surface sterilized with 30% bleach solution and then washed 3 times with sterile water.

2. Spreading the sterile seeds on a 1/2MS plate, culturing at 28deg.C for 5-7 days, and transplanting into liquid 1/2MS for 2-3 days.

3. Seedlings of different genotypes were treated with ultrapure water and 10. Mu.g/mL chitin suspension (10. Mu.g/mL chitin suspension was prepared with water, sonicated and stored in a negative 20 refrigerator) and sampled at 0, 15, 30, 60 minutes, respectively.

4. And (3) extracting total protein from the sample obtained in the step (3).

5. Detection of the protein content of MAPK3 and MAPK6 and of the internal reference protein Actin in the protein samples by Western immunoblotting, using a Phospho-p44/42 antibody (for detecting the level of phosphorylated MAPKs) and an Actin antibody (both commercial antibodies, phospho-p44/42 antibody cat# Cell Signaling Technology 4370; actin antibody cat# EASYBIO BE 0027-100), it was found that the level of activation of MAPK3 and MAPK6 in OsUBC45 overexpressing transgenic lines of rice was significantly higher than that in wild-type, see in particular FIG. 3.

Example 4 identification of Gene expression levels involved in the disease Process in OsUBC45 overexpressing Rice plants

The expression level of the disease course related gene in the OsUBC45 over-expressed rice strain after chitin treatment is detected, and the specific steps are as follows:

3. Seedlings of different genotypes were treated with ultrapure water and 10. Mu.g/mL chitin suspension (chitin suspension concentration 10. Mu.g/mL was prepared with water, sonicated and stored in a negative 20 refrigerator) for 6 hours and sampled.

4. And (3) extracting total RNA from the sample obtained in the step (3), and carrying out reverse transcription to obtain cDNA.

5. The expression levels of the disease-associated genes OsPR4-1 (labeled PR 4-1), osPR4-2 (labeled PR 4-2), osPR5-1 (labeled PR 5-1) and OsPR10 (labeled PR 10) in the cDNA samples were detected by a fluorescent quantitative PCR instrument (ABI 7500, USA) (the detection genes and primer sequences are shown in Table 5), and OsActin1 was used as an internal reference gene, and the sequences are shown in Table 3.

TABLE 5

Gene name	Forward primer 5'-3'	Reverse primer 5'-3'
			OsPR4-1	TCGTGGCGTCAGAAGTATGG	ACGGTGTCCCAGTCCAGG
OsPR4-2	TGGCACAAGAGGCGTCCAA	CCACAGAAGGCGGTCCATC
			OsPR5-1	CGGCAGCCAGGACTTCTA	GCAGAAGACGACTTGGTAG
OsPR10	GTCTGCGCCGGATTCATC	AACCTCCAACACCTCAACCT

As a result, it was found that the induction of the disease course-related gene in OsUBC45 overexpressing transgenic line rice was significantly higher than that in wild-type.

Example 5 production assay of OsUBC45 overexpressing Rice Strain

Counting the length of the spike:

wild type medium flower No. 11 (WT) and rice ears of OsUBC45 over-expressed lines (OsUBC 45-OE2, osUBC45-OE3, osUBC45-OE 8) were taken for photographs, see FIG. 5A. The lengths of rice ears of the wild-type and three over-expressed transgenic lines were measured, five rice ears were measured separately and the average value was calculated. The results show that the ear length of the three over-expressed transgenic lines is significantly greater than that of the wild-type line, as shown in panel B of fig. 5.

And (5) counting the yield of the single plant:

taking rice ears of wild medium flower No. 11 (WT) and OsUBC45 over-expression strains (OsUBC 45-OE2, osUBC45-OE3 and OsUBC45-OE 8), threshing all seeds on the rice ears, and weighing the weight of the seeds of the single plant. The seed weights of the five rice ears were weighed separately and the average value was calculated. The results show that the individual yield of the three over-expressed transgenic lines is significantly greater than that of the wild-type line, see in particular figure 5, panel C.

Comparing seed length:

10 seeds of wild type medium flower No. 11 (WT) and OsUBC45 over-expressed strain (OE 2, OE3, OE 8) were each taken, placed end to end and photographed. The seed length of the three over-expressed transgenic lines was longer than that of the wild type, see in particular figure 5, panel D.

Measuring thousand seed weight:

seeds of wild type medium flower 11 (WT) and OsUBC45 over-expressed strain (OE 2, OE3, OE 8) were weighed 1000 pieces each, three times each and seed weight average was calculated. The results show that the thousand kernel weight of the seeds of the three over-expressed transgenic lines is significantly greater than that of the wild-type seeds, see in particular figure 5, panel E.

By combining the results, the overexpression of the OsUBC45 gene can obviously improve the rice blast resistance of the rice, and meanwhile, the rice yield is increased.

The present application is described in detail above. It will be apparent to those skilled in the art that the present application can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the application and without undue experimentation. While the application has been described with respect to specific embodiments, it will be appreciated that the application may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the application following, in general, the principles of the application and including such departures from the present disclosure as come within known or customary practice within the art to which the application pertains. The application of some of the basic features may be done in accordance with the scope of the claims that follow.

Sequence listing

<110> Chinese university of agriculture

<120> OsUBC45 protein related to plant disease resistance and yield increase, related biological material and application thereof

<130> GNCSY220206

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 313

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 1

Met Glu Ala Thr Ala Lys Tyr Asn Arg Gly Asn Pro Ala Val Lys Arg

1 5 10 15

Ile Leu Gln Glu Val Lys Glu Met Gln Ser Asn Pro Ser Pro Asp Phe

20 25 30

Met Ala Met Pro Leu Glu Glu Asp Ile Phe Glu Trp Gln Phe Ala Ile

35 40 45

Leu Gly Pro Arg Asp Ser Glu Phe Glu Gly Gly Ile Tyr His Gly Arg

50 55 60

Ile Gln Leu Pro Ser Asp Tyr Pro Phe Lys Pro Pro Ser Phe Met Leu

65 70 75 80

Leu Thr Pro Ser Gly Arg Phe Glu Ile Gln Lys Lys Ile Cys Leu Ser

85 90 95

Ile Ser Asn Tyr His Pro Glu His Trp Gln Pro Ser Trp Ser Val Arg

100 105 110

Thr Ala Leu Val Ala Leu Ile Ala Phe Met Pro Thr Pro Gly Gly Gly

115 120 125

Ala Leu Gly Ser Leu Asp Phe Lys Lys Glu Asp Arg Arg Ala Leu Ala

130 135 140

Ile Lys Ser Arg Glu Thr Pro Pro Lys Phe Gly Ser Ala Glu Arg Gln

145 150 155 160

Lys Val Ile Asp Glu Ile His Glu Gln Met Leu Ser Arg Ala Pro Pro

165 170 175

Val Pro Gln Leu Leu Thr Asn Glu Thr Asn Glu Glu Thr Asn Gln Leu

180 185 190

Pro Ala Ser Asp Ala Ser Asp Glu His Ala His Lys Ala Val Gly Gly

195 200 205

Val Asn Thr Ala Gly Ser Asn Ser Asp Ser Val Asn Asn Asp Leu Pro

210 215 220

Arg Pro Asp Ser Glu Ser Glu Ile Val Gln His Ile Val Glu Gly Arg

225 230 235 240

Thr Glu Gly Val Ser Asn His Ser Arg Ala Asn Leu Ser Arg Glu Asn

245 250 255

Ile Pro Arg Val Ala Pro Thr Pro Gln Asn Pro Val Val Ala Ile Gln

260 265 270

Lys Pro Lys His Asp Arg Leu Leu Thr Leu Ala Ala Phe Gly Leu Thr

275 280 285

Leu Ala Ile Met Ala Leu Val Ile Lys Lys Phe Phe Lys Ile Asn Gly

290 295 300

Leu Ala Gly Tyr Ile Glu Gly Lys Phe

305 310

<210> 2

<211> 5899

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

ttccttcaca ctgcgctacc tcgaccagat cctcgccgtg tccctcgcct ccgtacacta 60

ccctctcgac ccccgccccg gaaacctcag ctccctcctc ctccgacctc cgctacgcgt 120

ccctccctcc cacccacctc ctccgccgcc ccgatcgctt tctccgctgc cgccttctct 180

tccgcttgcc tcgactactt ctccttcgcc ttcgccgcca cctcgctcat tgctctcatg 240

gcggcggcgt gtcgtctcca accgactccg cagcccgcgc gcggcgcgct gcacgcgcgg 300

gttacgccgc cgacacgttc gtggcgtccg cattggccaa gctgtagcct gtacgcttca 360

tgctgtccag aggtgaccac gcacgcaagg tgttcgacac tgtgcagtcg ccggataccg 420

ttatgtggaa cacgctgatg gccggccggg cttcctggtt cggaggccct ggagtcgttc 480

gtgaggatgg cgagtgcaga gtctgttcgg tctgacacaa ccacgctggc aacggtctta 540

ccagcaacag atataacaat ggggaattgg ggaggatgcc tcttgcagag aagagagggt 600

tggcggagta tgagcatgtt ctgaagagag ggttggcgga gtatgagcat gttctgaccg 660

gttgatctcg gtgtatacag cggggatgtg gaattctgca tggcgtctct ttgacttgat 720

ggagaatcca gatttggttg cctacaatgc ttaatctatg tttgctcggc gaattgcatg 780

gttggttcat cagttaatct gtttattggg ttgatggcct tggaattgaa gccaaactcg 840

agcactggca ctgatcccgt atagtctgtt tgggaatgaa ctgcttgatc aatgcttaca 900

tggtcctctc aagtctggat ttactgcgaa ttctccagtg tcgacagcaa ttaccatatt 960

gtactgtagg ttaaatgata tggagtctgc aaggaaggcc ttcaatgcga tgccatagaa 1020

gaccacggaa tcggaatcat ggaaagcaat aataccaggg tatgcctaga atggctggac 1080

ggagatggca attgccctct ttgagcaaat gctggtactt agcgtgtgac caaatccaat 1140

catcatttct agctctcttt cagcgtgtgc acagcttgga gctttgtccc tgggaaagtg 1200

gctgcatagg attatcgctg aggaggactt ggggcccaat gtttatgtca tgacagtgct 1260

cattgacatg tatgcatagt gtggaagcat ttccgaagct cggagcatct tcacttcaac 1320

agtatggata gcaagaatgt ggtctcatgg aatgcaatta gctggatatg gccttcatgg 1380

gccaaggtgc tgaggctttg aagctctaca aggacatgct ggatgcaaac cttattccaa 1440

caaacgctac cttcctgttg gtactctatg catgcagcca cataaggttg gctgaggaag 1500

ggcgcaaagt cttccagtca atgaccgatc attttgcaat aattccaagt attgagcatg 1560

cacatgcatg atggacctcc ttggctgagc tggccagctc aaggaggttt ttaagctcat 1620

ttctgaattc cccaagaccg ctgttggacc tggcttaata ttgcttggtg cttgcatggt 1680

ccataaggat agcgatcttg cacaaattgc acccccagaa aacagcggct actatgttct 1740

gctctctaat ttacttgtag tcaagaagca aatctctgaa gcagcggcaa aaggcaggaa 1800

gctggttaaa ctaatcgaga tagttgacaa gccaaacttc ctcatggccg gcgactgtgc 1860

ccatccacag tgtgaggcca tacttggaaa atcttaactt caaagacgat ttgacgctag 1920

gtatcgacct gagacagagc tagcattgta cgatgttgag gaggaagaga aggagcatat 1980

gtttgaaagt gcacagtgaa aagctggcaa ttgccttcgg atttctcagc acagaaccga 2040

gatctgaaat caggataatc aagaatctta gggtgtgcct ggagtgccac aacgccaccc 2100

aagttcatat ccaaggtgac acagagactg attctggtta gggaataggg atgcttcacg 2160

gttttcatca tttcagagat gagtttgctc ctctggagag attactggtg tgattcacct 2220

gaaatgcctc gggtgtctaa gcatatggtg attcaggcct ccactgccgc attgccgcga 2280

tggcttcgtc ccccatctct ccctagaaaa ctatttaaaa aaataaaaat tgtagataat 2340

tttagaaaat gtagaggaaa atcagaaaaa tgtaaaagaa tatgaatcat gtagaaagtt 2400

ttggcatgat atttgctata ttatggacat tgaacaaagt agaaatccat ttccccctca 2460

agtgagccta atggacttaa tgaacagtgc tcactattgg cctagccttt ttgttttttt 2520

ttctatttta agtttcaatt tcggcttgtc tgcaaaatat ggtgttagat tttatttttc 2580

acaaactagt actataaatt aggtactacc tatatgatct ttttttccat tttttacaat 2640

tttgaatttg tccaaactaa atgaatttat ggatagatga tagctcttaa tttgttgatg 2700

gatgacataa attgaaggga aacaaccacc tctattatag aagcttctta ggcccaacat 2760

ttaaggccca gccgcccagc tggcccaacg caccaaacca atcggaatat tccattcact 2820

caccgcacga cctataaaac caatagcgac gtgccacgtt agcccatcca cgtcgccccc 2880

cctcccactc tgccctcgcc gacacgtggg cccaacatag taaccggtcc cacgagccag 2940

ggaaagacca gaaccagctc ttcctccttt ttaatccacc caccgttccc actcctccgc 3000

tccttcctcc cctctcccga ttccccaatt cggaggccaa gcctgcaccg gcaagcggcg 3060

gcggcggcgg cgacgaggcg agagggttcc cttccgcgga gccggcggag atggaggcca 3120

cggcgaagta caaccggggc aacccggcgg tgaagcggat ccttcaggag gtcaaggaga 3180

tgcagtccaa cccgtccccg gacttcatgg ccatgcccct cgaggtcccc gatcctaacc 3240

ctgcatcctg catttacatt cctgcccgat ctggtcttgg ttgtgtccga atcgaacgct 3300

agtggggcga gatctggttt tgatggcgtt tttagggtgc ggaaatttag aggcttgatt 3360

taatgcgttg accttggggg ttcatctgca tttcttcttg atctgattgt gcagtttgtg 3420

caataacgaa atgttgggat gttagcgtat atcaatgttg cgattagatc atcgtatgca 3480

ggatgactct tgatattggg tagtattacg tcatttcgat taactggtgt gtgaatcaag 3540

tgggattcca gtattactta ggccgtttcc atgatatatt ttcggattac aaatttactt 3600

atggtattct gatcgaggct gatgtgtttt ttatgattta aatgtatgta tttgtgtagg 3660

aggacatctt cgagtggcaa tttgcgatcc tggggccacg agacagtgag tttgagggag 3720

gaatctacca tggaaggatc cagctgccat cggactatcc gtttaagcca ccatcattca 3780

tgctgctcac ggtctgtaat ttccctgcgt tagctcacca tgctatttgt gagcccttgc 3840

taaatattgt tttttattat atgtttatct gttattcagc caagtggaag atttgagatt 3900

caaaagaaga tttgtttgag catatccaat taccaccctg agcactggca accatcatgg 3960

agtggtgagt actgagtagc attttgtttc gaaagggatt gttcaagtaa gcccttacgt 4020

tggggtacct aatgcaatga gtagcaccat atttcatagt ccacggtgat ttggtcttgt 4080

gggctatacg agcatggtgc aaaagtaatg ccttcttttt gtattggtct ttgtgatttt 4140

catgggcgag tacttgccct atgaccaggc caaaagaaac atgcacttct ccctgcagtt 4200

cttacaaaac tttgtgttca gcagcttcct ttcaatgctg ctaagataca ataggcagtc 4260

catggtgttc ttgtttttta caatttgctg cttatcatat ccttttgtca gttggtgtat 4320

aatgagagat atatgctaaa gcttgtacac caaattattc aatcttaaaa tacaaccaag 4380

gattggcatg taattttttc tatccattca tatggtgggc accatttttc atagtataca 4440

aatatttact atgtgtacta tacgagcatg gtgccaaatg aaactattct ttggttcttt 4500

caggaatcgt catgtagcaa gtgtttagca catgactgga ccaaaggagg gacatgtgct 4560

ttcccttttt atatctgtcc tgtgcatatc tttttgctgt gaaggaatag tagtactttt 4620

tgtgttttta agacagcgtc atagcctcaa tacggaactt ttgattttat tgcaatttat 4680

catggttggg agtaagttag ataggtagtg agtatatata tgtacagatt cataattctt 4740

tggggaggat attcgtgcta tgtccgcaaa taatatatta gttacccatt gagggattgc 4800

caatttagtg ttagaaacca ttatggcatt gatcctccag ctgataccaa ttcctttttt 4860

tcccgattgt ttgtgttgca gtgcgcacag ctcttgtagc tttgattgca ttcatgccaa 4920

caccaggtgg tggggcattg ggttcgttgg acttcaaaaa ggaagataga cgggcactag 4980

ctatcaaatc acgtgaaaca ccaccaaagt ttggctctgc agaacgccaa aaagtaattg 5040

atgaggtaaa ttcctaacac ttgtttaata agaacaaacg cacacctgtt ctgtttctga 5100

tgcaaagaac tgttgcaatg acagatccat gagcaaatgc tcagtagggc tccccctgtt 5160

cctcagctgc tgacaaatga aactaatgag gagactaacc aattgcctgc atctgatgct 5220

tctgatgagc atgcacacaa ggcagttgga ggcgtgaaca cggctgggtc caactcagac 5280

tctgttaata atgaccttcc aaggcctgat tctgagtcag aaattgtaca acacattgtt 5340

gaaggtcgga cagaaggggt tagcaaccat tcaagggcca acttgagcag agaaaacatt 5400

ccaagagttg ctccaacgcc acagaatcct gttgttgcaa tccagaagcc aaagcatgac 5460

agattattga ccttggctgc atttggactc actcttgcta ttatggccct tgtgatcaag 5520

aagttcttca aaatcaatgg tctggccggt tacattgagg gcaagtttta ggtaggtttg 5580

tgcatagatt tgataagagc tatactaccc cattcggtgt ctgagcggct gctatgctta 5640

ccataagtta taaaccccta agaattgtaa atggctgttt agttatagac gaagttgaat 5700

tggtccattg gtactacccg taccttattg tatatgcagt acacctgatg aaaatcgttc 5760

taaggtctta catgatgtgc acaattgtat atgcggtact catgaaaatc attacaagat 5820

attacatgat gtgcgcaact gcacgtatgt tgtgcaatgg ccagcgatcc gtttgttctt 5880

gacgggcatg aaaattctt 5899

<210> 3

<211> 942

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

atggaggcca cggcgaagta caaccggggc aacccggcgg tgaagcggat ccttcaggag 60

gtcaaggaga tgcagtccaa cccgtccccg gacttcatgg ccatgcccct cgaggaggac 120

atcttcgagt ggcaatttgc gatcctgggg ccacgagaca gtgagtttga gggaggaatc 180

taccatggaa ggatccagct gccatcggac tatccgttta agccaccatc attcatgctg 240

ctcacgccaa gtggaagatt tgagattcaa aagaagattt gtttgagcat atccaattac 300

caccctgagc actggcaacc atcatggagt gtgcgcacag ctcttgtagc tttgattgca 360

ttcatgccaa caccaggtgg tggggcattg ggttcgttgg acttcaaaaa ggaagataga 420

cgggcactag ctatcaaatc acgtgaaaca ccaccaaagt ttggctctgc agaacgccaa 480

aaagtaattg atgagatcca tgagcaaatg ctcagtaggg ctccccctgt tcctcagctg 540

ctgacaaatg aaactaatga ggagactaac caattgcctg catctgatgc ttctgatgag 600

catgcacaca aggcagttgg aggcgtgaac acggctgggt ccaactcaga ctctgttaat 660

aatgaccttc caaggcctga ttctgagtca gaaattgtac aacacattgt tgaaggtcgg 720

acagaagggg ttagcaacca ttcaagggcc aacttgagca gagaaaacat tccaagagtt 780

gctccaacgc cacagaatcc tgttgttgca atccagaagc caaagcatga cagattattg 840

accttggctg catttggact cactcttgct attatggccc ttgtgatcaa gaagttcttc 900

aaaatcaatg gtctggccgg ttacattgag ggcaagtttt ag 942

Claims

1.A protein, characterized in that it is a protein of the following A1), A2) or A3):

a1 Amino acid sequence is protein of SEQ ID No.1 in a sequence table;

2. The protein of claim 1, wherein: the protein is derived from rice.

3. The protein-related biomaterial according to claim 1 or 2, which is any one of the following B1) to B5):

b1 A nucleic acid molecule encoding the protein of claim 1;

b2 An expression cassette comprising the nucleic acid molecule of B1);

4. A biomaterial according to claim 3, wherein: b1 The nucleic acid molecule is a gene as set forth in any one of the following b 1) to b 3):

b1 A cDNA molecule or a DNA molecule of SEQ ID No. 3;

b2 A DNA molecule of SEQ ID No. 3;

b3 Nucleotides 3001 to 5899 of SEQ ID No. 2.

5. Use of a protein according to claim 1 or 2 for regulating plant disease resistance and/or plant yield.

6. Use of a protein according to claim 1 or 2 for the preparation of a product for regulating plant disease resistance and/or plant yield.

7. The use of any one of the following biological materials according to claim 3 or 4:

1) The application in regulating plant disease resistance and/or plant yield;

2) The application of the plant extract in preparing products for regulating and controlling plant disease resistance and/or plant yield.

8. A method for improving disease resistance and/or plant yield in a plant, comprising: the method comprises a step M, wherein the step M is used for enhancing, increasing or up-regulating the activity and/or content of the protein as claimed in claim 1 or 2 in a target plant, or/and enhancing, increasing or up-regulating the expression level of the encoding gene of the protein as claimed in claim 1 or 2, so as to improve the disease resistance and/or yield of the plant.

9. The method according to claim 8, wherein: the plant is rice.

10. A plant agent, characterized in that: the reagent contains the protein according to claim 1 or 2 or/and the protein-related biological material according to claim 3 or 4.