CN1172006C - Y-chromosome compound-enlarging silver-dyeing reagent box - Google Patents
Y-chromosome compound-enlarging silver-dyeing reagent box Download PDFInfo
- Publication number
- CN1172006C CN1172006C CNB031174264A CN03117426A CN1172006C CN 1172006 C CN1172006 C CN 1172006C CN B031174264 A CNB031174264 A CN B031174264A CN 03117426 A CN03117426 A CN 03117426A CN 1172006 C CN1172006 C CN 1172006C
- Authority
- CN
- China
- Prior art keywords
- locus
- primer
- ypa
- ypb
- long primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a Y-chromosome compound-amplifying silver-dyeing reagent box which is characterized in that the box is composed of a short primer YPA, a short primer YPB, a buffer solution (without Mgcl2), DNA pclymerase, Mgcl2, an A gene base long primer YPA-A-P1 and an A gene base long primer YPB-A-P2, a B gene base long primer YPA-B-P1 and a B gene base long primer YPB-B-P2, a C gene base long primer YPA-C-P1 and a C gene base long primer YPB-C-P2, a D gene base long primer YPA-D-P1 and a D gene base long primer YPB-D-P2, and an artificial allele typing standard substance, which are packed separately. The primers in the reagent box are designed in the present invention, so multiplex amplification can be carried out to any four STR gene bases in Y-chromosome simultaneously and effectively, and the amplified result can be detected in a mode of silver nitrate dyeing. The requirements to the cost of the experimental equipment are not high, and accord with the requirements of majority laboratories of molecular biology. The present invention has a Chinese characteristic.
Description
Technical field
The present invention relates to a kind of segmental test kit of a plurality of DNA purposes that is used on the external disposable amplification Y chromosome.
Background technology
In 23 pairs of karyomit(e)s of human body, decisive other karyomit(e) is called sex chromosome.Sex chromosome is divided into two kinds of X, Y.Y chromosome is that the male sex is distinctive, and the male sex has two kinds of chromosomal sperms of band X, Y, and the women has only the ovum of band X chromosome.Become pregnant when the sperm of being with Y chromosome combines with the ovum of X chromosome, the individuality of generation is exactly the male sex; And X-bearing sperm combines with the ovum of band X chromosome, and the individuality of generation then is the women.So Y chromosome can only be by holandric inheritance, the genetic marker of Y chromosome also just is handed down from age to age with paternal line.Compare with euchromosome, the genetic marker on the Y chromosome does not exist reorganization and exchange.The characteristics of Y chromosome genetic marker can apply in the detection of criminal case.Advantage for individual's identification is:
1. to the mixed stain of vaginal secretions and seminal fluid formation, the analysis of Y-chromosomal genetic marker can not be subjected to the interference of women's composition.Vaginal secretions is the modal forensic sample of sexual crime case with the spot (hereinafter to be referred as mixed stain) that mixes that seminal fluid constitutes.Mixed stain is made of two people even a plurality of people's body fluid, and the amount of mixed stain medial vagina secretory product is higher than the seminal fluid composition far away.Both at home and abroad the genetic marker that adopts of DNA laboratory is positioned euchromosome mostly, and during with euchromatic dna genetic marker somatotype, a large amount of vaginal secretions compositions usually disturb and cover detection to the seminal fluid composition.Therefore, the individual of mixed stain identification is the difficult problem that medical jurisprudence presses for solution.By contrast, when detecting the special genetic marker of Y chromosome, epithelial cell does not contain this class genetic marker because vagina comes off, and the vagina epithelial cell content that comes off will can not influence detected result.The more important thing is that the special genetic marker of Y chromosome only can realize that to seminal fluid composition somatotype, the result can directly compare with the suspect, explanation results is more simple.
2. detect the mixed stain of gang-rape case with the Y chromosome genetic marker, can know criminal's minimum number by inference, for scouting is given a clue.
3. the fugitive case of male sex suspect can utilize suspect paternal relative's DNA to carry out the analysis of Y chromosome genetic marker.
The Y chromosome genetic marker is for the advantage of paternity identification:
1. father is dead or missing, can carry out patriarchy by paternal relative's Y chromosome genetic marker and identify
2. can identify brother, uncle and nephew and grandfather grandson's throwback relation.
Yet, the non-recombination zone genetic marker of human Y chromosome seldom, this is the major cause of Y chromosome genetic marker not seen widespread use.Fortunately, found that a class has the specific DNA STR of Y chromosome (hereinafter to be referred as the special str locus seat of Y chromosome) in " Human Genome Project " research, for medical jurisprudence individual identification has brought new hope with paternity identification, can provide new technical solution and new detection means.Recognize the importance of the special str locus seat of Y chromosome, 1996 and 2000 have been held first and the coordination committee of second the special str locus seat of international legal medical expert's Y chromosome somatotype respectively at Berlin, Germany.At present, the special str locus seat of Y chromosome is one of emphasis of the U.S. and European countries' medical jurisprudence research.Yet, to compare with euchromosome, the commercially available reagent of the special str locus seat of little Y chromosome somatotype occurs.Reason is in the structure of Y chromosome that long-armed DNA has a large amount of big fragments to repeat, and requires the PCR reaction conditions more much higher than euchromosome; With autosomal method being carried out very difficulty of the special STR composite amplification of Y chromosome.On the other hand, except that intending often dying the district, some locus and X chromosome in the non-recombination zone of Y chromosome still have the portion homologous sequence, and these locus are not had male sex's specificity under certain PCR reaction conditions, have further increased the difficulty of the special STR composite amplification system of design Y chromosome.
Polymerase chain reaction (PCR) technology is an external DNA cloning technology at present commonly used.
When PCR reacts, the oligonucleotide fragment that at first needs surplus base of the about 17-20 of a segment length is as primer (primer), this primer is that the specificity of pcr amplification depends on the specific combination of primer and template according to the base sequence synthetic of two 5 ' end of the dna fragmentation of desire detection.Whole amplification procedure divided for three steps: (1) sex change: heating makes the two interchain hydrogen bond ruptures of template DNA and forms two strands; Characteristics such as (2) annealing: suddenly alternating temperature rear pattern plate DNA combines by the basepairing rule complementation with primer, also has two combinations between the template strand, but owing to the high density of primer, and is simple in structure, main combination occurs between template and the primer; (3) extend: under the condition that archaeal dna polymerase and magnesium ion etc. exist,,, form and the new DNA chain of template strand complementary in conjunction with mononucleotide from 3 of primer ' end.Above-mentioned three steps are a circulation, and are every through a circulation theoretically, and the DNA amount in the sample should double, and the new chain that forms can become new round round-robin template again, can increase 2 through n circulation back DNA
n-2n doubly.
At present both at home and abroad pcr amplification is still carried out to its single str locus seat to the topmost method that Y chromosome STR genetic marker is adopted in the laboratory, for example the method introduced in interim " the Allele sequencesof six new Y-STR loci and haplotypes in the Chinese Han population " article delivered of " ForensicScience Internetional " calendar year 2001 the 118th (2-3) of we laboratory marquis one equality people.The more a plurality of Y chromosome str locus seats of single Y chromosome str locus seat amplification increase (composite amplification) easily simultaneously, and condition is simpler.But composite amplification has the individual gene seat not available advantage that increases, and a plurality of locus that once can increase simultaneously simultaneously save time, economy.So the composite amplification of Y chromosome str locus seat is the emphasis of domestic and international related experiment chamber research always.At present, be among the exploration both at home and abroad for the research of the composite amplification of Y chromosome str locus seat always, though abroad the test kit of existing Y chromosome str locus seat is sold and is used, but they are based on fluoroscopic examination is basic, promptly adopts fluorescent dye primer, advances the mode that detects by automatic sequencer by automatic dna sequencer.What for example, Bulter JM etc. was introduced in interim " A novel multiplex for simultaneousamplification of 20 Y chromosome STR markers " article of delivering at " Forensic Science Internetional " in 2002 the 129th (1) promptly is this method.And the detection principle of our test kit is different with them, and we are basic design with the argentation.What they detected is the single-stranded structure (chain of mark fluorescent) of DNA, is the duplex structure of DNA and we detect, does not report correlation technique and product at present both at home and abroad as yet.
Summary of the invention
The purpose of this invention is to provide a kind of four locus that can increase simultaneously, amplification efficiency height, be convenient to laboratory operation and be convenient to detect the Y chromosome composite amplification silver transfection reagent box of expanding effect.
Y chromosome composite amplification silver transfection reagent box of the present invention is by short primer YPA, the short primer YPB, damping fluid (the no Mgcl that separate packing
2), archaeal dna polymerase, Mgcl
2, A locus long primer YPA-A-P1 and A locus long primer YPB-A-P2, B locus long primer YPA-B-P1 and B locus long primer YPB-B-P2, C locus long primer YPA-C-P1 and C locus long primer YPB-C-P2, D locus long primer YPA-D-P1 and D locus long primer YPB-D-P2 and artificial allelic ladder constitute, wherein:
Short primer YPA is inhuman genome sequence:
(5′--ATTTAGGTGACACTATAGAATAC-3′);
Short primer YPB is inhuman genome sequence:
(5′--TAATACGACTCACTATAGGGAGAC-3′);
A locus long primer YPA-A-P1 and A locus long primer YPB-A-P2 are for adding the genome sequence that the above short primer YPA, YPB obtain with 5 ' end of genome sequence specificity bonded Oligonucleolide primers P1, the P2 of the mankind's A locus respectively;
B locus long primer YPA-B-P1 and B locus long primer YPB-B-P2 are for adding the genome sequence that the above short primer YPA, YPB obtain with 5 ' end of genome sequence specificity bonded Oligonucleolide primers P1, the P2 of the mankind's B locus respectively;
C locus long primer YPA-C-P1 and C locus long primer YPB-C-P2 are for adding the genome sequence that the above short primer YPA, YPB obtain with 5 ' end of genome sequence specificity bonded Oligonucleolide primers P1, the P2 of the mankind's C locus respectively;
D locus long primer YPA-D-P1 and D locus long primer YPB-D-P2 are for adding the genome sequence that the above short primer YPA, YPB obtain with 5 ' end of genome sequence specificity bonded Oligonucleolide primers P1, the P2 of the mankind's D locus respectively;
Artificial allelic ladder has comprised A locus somatotype standard substance, B locus somatotype standard substance, C locus somatotype standard substance and D locus somatotype standard substance altogether:
A locus somatotype standard substance be long primer YPA-A-P1, the YPB-A-P2 of A locus through the polymerase chain reaction products therefrom, and long primer YPA-A-P1, YPB-A-P2 respectively account for 1/2nd of its gross weight through the pcr amplification products therefrom.
B locus somatotype standard substance be long primer YPA-B-P1, the YPB-B-P2 of B locus through the polymerase chain reaction products therefrom, and long primer YPA-B-P1, YPB-B-P2 respectively account for 1/2nd of its gross weight through the pcr amplification products therefrom.
C locus somatotype standard substance be long primer YPA-C-P1, the YPB-C-P2 of C locus through the polymerase chain reaction products therefrom, and long primer YPA-C-P1, YPB-C-P2 respectively account for 1/2nd of its gross weight through the pcr amplification products therefrom.
D locus somatotype standard substance be long primer YPA-D-P1, the YPB-D-P2 of D locus through the polymerase chain reaction products therefrom, and long primer YPA-D-P1, YPB-D-P2 respectively account for 1/2nd of its gross weight through the pcr amplification products therefrom.
The amount ratio of each component is: short primer YPA0.25~0.35ml (400nM), short primer YPB0.25~0.35ml (400nM), damping fluid (no Mgcl
2) 3.5~4.0ml, archaeal dna polymerase 3000u (3u/ μ l), Mgcl
22.5~3.5ml (2.25mM), each 0.25~0.35ml (40nM) of A locus long primer YPA-A-P1 and A locus long primer YPB-A-P2, each 0.25~0.35ml (40nM) of B locus long primer YPA-B-P1 and B locus long primer YPB-B-P2, each 0.25~0.35ml (40nM) of C locus long primer YPA-C-P1 and C locus long primer YPB-C-P2, each 0.25~0.35ml (40nM) of D locus long primer YPA-D-P1 and D locus long primer YPB-D-P2, artificial allelic ladder 4ml (40nM), in artificial allelic ladder, A locus somatotype standard substance 1ml (40nM), B locus somatotype standard substance 1ml (40nM), C locus somatotype standard substance 1ml (40nM), D locus somatotype standard substance 1ml (40nM).
In test kit of the present invention, primer design is extremely crucial, its basic ideas are: choose the genomic short dna fragment of a pair of non-human as above-mentioned short primer YPA and YPB, and can add this respectively to short primer, thereby obtain long primer YPA-P1 and YPB-P2 with 5 of human genomic sequence specificity bonded Oligonucleolide primers (P1, P2) ' end.Herein, can with human genomic sequence specificity bonded Oligonucleolide primers P1, P2 that is be can with the original primer of human genome bonded of locus to be amplified.Because the composite amplification reaction is the pcr amplification that simultaneously four locus A, B, C, D is carried out, with respect to the different genes seat, can be different with human genomic sequence specificity bonded Oligonucleolide primers P1, the P2 of this locus, corresponding with it, the long primer YPA-P1 of four locus A to be amplified, B, C, D and YPB-P2 be different and inequality because of P1, P2 also.When carrying out the composite amplification reaction, can in the PCR reaction system, add short primer YPA, short primer YPB, damping fluid (the no Mgcl that separates packing in this test kit simultaneously
2), archaeal dna polymerase, Mgcl
2, somatotype standard substance and respectively at long primer YPA-P1, the YPB-P2 of four locus A to be amplified, B, C, D, and add the required mononucleotide of conventional PCR reaction.Owing to do not contain the pairing sequence of short primer YPA, YPB in the human genomic sequence of each locus A to be amplified, B, C, D, so when this reaction system is carried out first round PCR reaction (experiencing a working cycle of aforementioned sex change, annealing, extension), short primer YPA, YPB can't combine with human genomic sequence, and the dna fragmentation that is increased is still determined P1, P2 by original primer contained among long primer YPA-P1, the YPB-P2.But, after first round reaction finishes, will produce the amplified production that has target gene fragment and non-human genome sequence YPA, YPB simultaneously at locus to be amplified.Carry out second when taking turns PCR reaction (promptly experiencing the working cycle second time of sex change, annealing, extension) in the PCR reaction system, the above-mentioned product that has target gene fragment and non-human genome sequence YPA, YPB is simultaneously further increased, the amplification the primer remains long primer YPA-P1, YPB-P2, the reaction finish after, resulting product have simultaneously target gene fragment and with short primer to YPA, YPB paired non-human genome sequence.In the present invention, we take turns reaction that PCR reaction be referred to as fs, i.e. in the composite amplification process polymerase chain reaction of fs with long primer as the first round and second of reaction primer with above-mentioned.In other words, the polymerase chain reaction of fs has comprised that the above-mentioned first round and second takes turns reaction in the composite amplification process.The resulting amplified production of this elementary reaction have simultaneously target gene fragment and with short primer to (YPA, YPB) paired non-human genome sequence, it is referred to as the product of composite amplification fs herein.React from third round PCR, owing to had the product of above-mentioned fs for each locus, like this, short primer YPA, YPB just can be used as the primer of above-mentioned each amplification gene seat, and the PCR reaction just can be that template increases with the product of above-mentioned fs.Similar therewith, respectively taking turns in the PCR reaction after third round all can be served as the primer of each amplification gene seat with short primer to (YPA, YPB).After the many wheels of experience (taking turns as 30) PCR circulating reaction, the product of above-mentioned fs will be expanded to up to a million times.In the present invention, we react the reaction that be referred to as subordinate phase, i.e. in the composite amplification process polymerase chain reaction of subordinate phase with short primer as the PCR that reacts primer with above-mentioned.Need to prove that in above-mentioned mentality of designing of the present invention, the reaction of fs and subordinate phase is carried out in same reaction system, rather than completely be divided into two secondary responses.In fact, even in the reaction of the PCR after third round and third round, still exist the reaction of above-mentioned fs, just its proportion is extremely low.In addition, when carrying out the pcr amplification reaction of fs, have many to primer participate in simultaneously the reaction, promptly long primer is participated in reaction (as previously mentioned simultaneously with respect to different many of a plurality of locus to be amplified and sequence, the long primer YPA-P1 of each locus to be amplified and YPB-P2 are also inequality), reaction between primer and primer is unavoidable with competition, thereby greatly reduce the efficient of pcr amplification, mentioned when this drawback is discussed prior art in front.But, with regard to the present invention, the purpose of the pcr amplification of fs is not to wish to obtain a large amount of amplified fragments, and only be to make to have target gene fragment simultaneously and produce with the product (product of fs) of YPA, YPB paired non-human genome sequence get final product, therefore above-mentioned drawback is extremely faint to the influence of whole composite amplification reaction process generation.And after the pcr amplification of fs, need 5 ' end of each target gene fragment of amplification all to have and YPA, YPB paired non-human genome sequence, so add a pair of short primer (YPA, YPB) afterwards, just can increase simultaneously to a plurality of locus.Because in the subordinate phase amplification of after this carrying out, the primer that participates in reacting has only a pair of, promptly short primer does not exist competition and reaction between primer to YPA, YPB, need not to adjust the concentration between primer yet, thereby has improved the amplification efficiency of each locus greatly.Therefore we can say that the PCR reaction of fs is only need amplify a small amount of template, and the amplification of subordinate phase to be high-level efficiency increase all locus.With regard to its essence, in the PCR of subordinate phase reaction, be many in the existing composite amplification method to primer a plurality of locus that increase simultaneously, change a pair of primer (YPA, YPB) a plurality of locus that increase simultaneously into; Simultaneously, with respect to each DNA fragment specific that is amplified, YPA, YPB are not to be special primer, therefore, said process also by in the existing composite amplification method by many to special primer a plurality of specific gene fragments that increase simultaneously, be transformed into by a pair of non-special primer a plurality of specific gene fragments that increase simultaneously.
1., it must be non-human genomic sequence in test kit of the present invention, above-mentioned short primer YPA, YPB choose the key element of having considered the following aspects:, promptly its sequence can be not identical with human genomic sequence or complementary.2., choose suitable primer length.A large amount of experimental results show that when the design primer, primer length is a very crucial parameter, and the oligonucleotide chain of 18~24 base formations is primer lengths of relatively optimizing; Primer is too short, will cause specific reduction; Primer is long, the template that when annealing amplification is initiated very little, in the index amplification phase, even the little error of each step annealing step all will enlarge, consequently cause the obvious minimizing of amplified production.3., choose the content of bases G C in the primer and the annealing temperature Tm of primer.The primer of PCR reaction should keep rational GC content.Article two, the GC content of primer should be consistent with the Tm value, and amplification efficiency that the primer of poor compatibility is right and specificity are all relatively poor.Lower Tm value can cause specific forfeiture, if adopt too high annealing temperature, the efficient of amplification will be very low; If annealing temperature is too low, primer will produce non-specific annealing, thereby cause the amplification of non-specific dna fragmentation.The temperature that the present invention selects when the Tm value of design primer is 55 ℃, because under this temperature, PCR reactions most in the composite amplification can both be carried out, this temperature will make the back of PCR reaction first a large amount of non-specific assorted bands occur simultaneously, and we just must reduce assorted band by the concentration that reduces long primer.After reducing long primer concentration, the interaction between each primer reduces, and nonspecific product reduces, and meanwhile, we also reduce by required specific product, but this can't influence whole amplification efficiency.Before address, preceding two-wheeled PCR reaction only is the beginning of above-mentioned composite amplification process, this is taken turns the product of PCR reaction and is not required bigger amount, only need to produce the dna fragmentation that has non-human genome sequence and goal gene on a small quantity simultaneously, promptly generate the template of the PCR reaction that is used for subordinate phase on a small quantity, just can high-volume increase by this template of PCR reaction pair thereafter.After the PCR of fs reaction, the primer that participates in reaction just no longer be long primer to (YPA-P1, YPB-P2), but short primer is to (YPA, YPB).
By retrieval Human genome database, in human genome, do not exist and above-mentioned short primer YPA, the corresponding sequence of YPB, thereby guaranteed that this short primer does not combine with human genomic sequence.
Test kit of the present invention is to prepare, so comprised four pairs of long primers in the test kit at locus A, B on four Y chromosomes to be amplified, C, D.In the above-mentioned long primer contained can with human genomic sequence specificity bonded Oligonucleolide primers P1, P2 in fact be exactly can with four locus A, B to be amplified, the original primer of Human genome group-specific bonded of C, D, they can obtain by the disclosed on the internet Human genome database of retrieval.Herein, the sequence of primer P1, P2 determined by the human genomic sequence of locus A to be amplified, B, C, D, and because of the difference of the sequence of locus to be amplified different.And when specifically making the test kit product, can according to this test kit at four concrete locus A, B, C, D to be amplified, retrieve disclosed on the internet Human genome database, obtain and four locus A, B, corresponding four the concrete primer sequences of C, D.Also that is to say, when product at four locus A, B, C, D when being certain, Dui Ying four concrete primer sequences are exactly what determine to (P1, P2) with it, and are known.At this moment, the above-mentioned short primer that provides in according to the present invention just can be produced the long primer at four locus A, B, C, D.In addition, above-mentioned damping fluid (the no Mgcl that is adopted in the test kit of the present invention
2), archaeal dna polymerase and Mgcl
2All can directly adopt existing commercially available prod Deng reagent, as the product that the magnificent company of China produces, the corresponding production domesticization that can realize reagent.
The artificial allelic ladder that is comprised in the test kit of the present invention is the contrast that carries out result's somatotype when detecting, and it is an important component of test kit of the present invention.
In existing test kit, be equipped with allelic ladder usually.Allelic ladder is meant the dna fragmentation group of the known array that is used for the STR somatotype.In order to realize somatotype stdn and the quality control between the laboratory, international legal medical expert's blood genetics meeting (international medicolegal genetics meeting of existing name, International Society of Forensic Genetics, ISFG) recommended in 1994 to repeat the allelic principle of copy number name euchromosome, emphasized the meaning of this nomenclature mo in 1997 once more based on sequential analysis by the core sequence series connection.In sequential analysis is under the human allelic ladder contrast of fundamental construction, can avoid calculating the error that dna fragmentation length is produced by the molecule measuring definite value.The more important thing is, the position that primer is attached on the genomic dna can change, the same str locus seat of same individuality will produce the dna fragmentation of different length with different primer amplifications, and the series connection of the core sequence of these different length dna fragmentations to repeat copy number be identical.Obviously, it is the feature that individuality has that the core sequence series connection repeats copy number, is the basis of population data comparability, is the key that identical somatotype result is obtained in the different experiments chamber.This nomenclature mo euchromosome str locus seat that becomes commercialized already adopts, and also is familiar with by domestic and international legal medical expert scholar.Domestic and international repeatable analytical results shows: as long as with allelic ladder and the synchronous electrophoresis of sample pcr amplification product, and different laboratories, different equipment, different electrophoresis methods all can obtain consistent repeatable result.
Artificial allelic ladder in this patent is with the difference of allelic ladder: in the series sequence of dna fragmentation and human DNA sequence to have only part be identical, and another part is different (difference has been that one section non-human genome sequence is therein).This not to be both the special str locus seat of the described composite amplification of this patent and somatotype Y chromosome institute essential, also is one of key of this patent therefore.
Utilize molecule clone technology can prepare the artificial allelic ladder of the special str locus seat of Y chromosome related in this patent.Basic step is: the composite amplification system amplification different genotype individuality that elder generation designs with this patent, collect each allelotrope fragment of the special str locus seat of Y chromosome, be inserted in the pUC recombinant plasmid, through the dna sequencing analysis, confirm to insert segmental structure and size, name the allelotrope fragment of inserting by the special str locus seat of the Y chromosome somatotype standard that international medicolegal genetics can be announced calendar year 2001, after transfection, enlarged culturing, amplification and identify again after prepare artificial allelic ladder.
In sum, because the primer of announcing in the gene database on primer in the test kit of the present invention and the internet (being P1, P2) is inconsistent, long primer among the present invention is to have added short primer on the basis of the primer (P1, P2) announced in the gene database on the internet, therefore can not adopt the amplified production of protogene database primer to make somatotype standard substance among the present invention again.So, in test kit of the present invention, provide artificial allelic ladder respectively at each locus to be amplified, promptly the pairing somatotype standard substance of PCR product that is increased out by each long primer compares thing for the laboratory of using test kit of the present invention.With regard to the concrete formation of artificial allelic ladder, the two ends of pcr amplification product that it is actually the primer sequence of the locus of announcing on the internet to be amplified add that the short primer sequence forms, and it is different because of the difference of selected locus to be amplified.
Compare with aforementioned prior art, the present invention designs the primer in the test kit, thereby can carry out composite amplification to any four the str locus seats on the Y chromosome simultaneously expeditiously, amplify a large amount of target gene fragment, the reproducibility of experimental result is high, need not in experimentation, to adjust each concentration to primer loaded down with trivial detailsly, simplified whole experiment, simultaneously, the artificial allelic ladder of distinctive Y chromosome composite amplification is provided, can have detected amplification easily.In addition, adopt test kit of the present invention to carry out after the composite amplification reaction, can adopt cma staining mode detected result, cost requirement to experimental installation is not high, and the mode that only can adopt fluorescent dye primer in the aforementioned prior art, detect by automatic sequencer, it is to the requirement height of experimental installation, and therefore product of the present invention more meets the needs of the most of Molecular Biology Labs of current China, is with Chinese characteristics.
Content of the present invention further illustrates with the following Examples, but content of the present invention is not limited only to content related among the embodiment.
Embodiment
Embodiment 1: the test kit in the present embodiment at locus to be amplified be respectively DYS434, DYS438, DYS439 and C4, below represent above-mentioned four locus with A, B, C, D respectively.
In the present embodiment, given Y chromosome composite amplification silver transfection reagent box is by short primer YPA, the short primer YPB, damping fluid (the no Mgcl that separate packing
2), archaeal dna polymerase, Mgcl
2, A locus long primer YPA-A-P1 and A locus long primer YPB-A-P2, B locus long primer YPA-B-P1 and B locus long primer YPB-B-P2, C locus long primer YPA-C-P1 and C locus long primer YPB-C-P2, D locus long primer YPA-D-P1 and D locus long primer YPB-D-P2 and artificial allelic ladder constitute, wherein:
Short primer YPA is inhuman genome sequence:
(5′--ATTTAGGTGACACTATAGAATAC-3′);
Short primer YPB is inhuman genome sequence:
(5′--TAATACGACTCACTATAGGGAGAC-3′)。
A locus long primer YPA-A-P1 and A locus long primer YPB-A-P2 are for adding the genome sequence that the above short primer YPA, YPB obtain with 5 ' end of genome sequence specificity bonded Oligonucleolide primers P1, the P2 of the mankind's A locus respectively.In the present embodiment, primer P1, the P2 of the A locus DYS434 that announces in the gene database on the internet are
P1:5’CACTCCCTGAGTGCTGGATT?3’
P2:5’GGAGATGAATGAATGGATGGA?3’
Corresponding with it, the A locus long primer in the present embodiment is
YPA-P1:5’ATTTAGGTGACACTATAGAATAC-CACTCCCTGAGTGCTGGATT?3’
YPB-P2:5’TAATACGACTCACTATAGGGAGAC-GGAGATGAATGAATGGATGGA?3’
Equally, B locus long primer YPA-B-P1 and B locus long primer YPB-B-P2 are for adding the genome sequence that the above short primer YPA, YPB obtain with 5 ' end of genome sequence specificity bonded Oligonucleolide primers P1, the P2 of the mankind's B locus respectively.In the present embodiment, primer P1, the P2 of the B locus DYS438 that announces in the gene database on the internet are
P1:5’TGGGGAATAGTTGAACGGTAA?3’
P2:5’GTGGCAGACGCCTATAATCC?3’
Corresponding with it, the B locus long primer in the present embodiment is
YPA-P1:5’ATTTAGGTGACACTATAGAATAC-TGGGGAATAGTTGAACGGTAA?3’
YPB-P2:5’TAATACGACTCACTATAGGGAGAC-GTGGCAGACGCCTATAATCC?3’
C locus long primer YPA-C-P1 and C locus long primer YPB-C-P2 are for adding the genome sequence that the above short primer YPA, YPB obtain with 5 ' end of genome sequence specificity bonded Oligonucleolide primers P1, the P2 of the mankind's C locus respectively.In the present embodiment, primer P1, the P2 of the C locus DYS439 that announces in the gene database on the internet are
P1:5’TCCTGAATGGTACTTCCTAGGTTT?3’
P2:5’GCCTGGCTTGGAATTCTTTT?3’
Corresponding with it, the C locus long primer in the present embodiment is
YPA-P1:5’ATTTAGGTGACACTATAGAATAC-TCCTGAATGGTACTTCCTAGGTTT?3’
YPB-P2:5’TAATACGACTCACTATAGGGAGAC-GCCTGGCTTGGAATTCTTTT?3’
D locus long primer YPA-D-P1 and D locus long primer YPB-D-P2 are for adding the genome sequence that the above short primer YPA, YPB obtain with 5 ' end of genome sequence specificity bonded Oligonucleolide primers P1, the P2 of the mankind's D locus respectively.In the present embodiment, primer P1, the P2 of the D locus C4 that announces in the gene database on the internet are
P1:5’GTGGAACCAGCCCAAATATC?3’
P2:5’AATGCTCTCTTGGCTTCTCACT?3’
Corresponding with it, the D locus long primer in the present embodiment is
YPA-P1:5’ATTTAGGTGACACTATAGAATAC-GTGGAACCAGCCCAAATATC?3’
YPB-P2:5’TAATACGACTCACTATAGGGAGAC-AATGCTCTCTTGGCTTCTCACT?3’
Artificial allelic ladder has comprised A locus somatotype standard substance, B locus somatotype standard substance, C locus somatotype standard substance and D locus somatotype standard substance altogether:
A locus somatotype standard substance be long primer YPA-A-P1, the YPB-A-P2 of A locus through the polymerase chain reaction products therefrom, and long primer YPA-A-P1, YPB-A-P2 respectively account for 1/2nd of its gross weight through the pcr amplification products therefrom.Specifically, in the present embodiment, the sequence of A locus somatotype standard substance is
The product that long primer YPA-A-P1 reacts through PCR:
ATTTAGGTGACACTATAGAATAC-(X)-GTCTCCCTATAGTGAGTCGTATTA
The product that long primer YPB-A-P2 reacts through PCR:
TAATACGACTCACTATAGGGAGAC-(X)-GTATTCTATAGTGTCACCTAAAT
(X) representative is carried out sequence behind the pcr amplification with the original primer of this locus (DYS434), with consistent in the Human genome database on the internet.
In like manner, B locus somatotype standard substance be long primer YPA-B-P1, the YPB-B-P2 of B locus through the polymerase chain reaction products therefrom, and long primer YPA-B-P1, YPB-B-P2 respectively account for 1/2nd of its gross weight through the pcr amplification products therefrom.Specifically, in the present embodiment, the sequence of B locus somatotype standard substance is
The product that long primer YPA-B-P1 reacts through PCR:
ATTTAGGTGACACTATAGAATAC-(X)-GTCTCCCTATAGTGAGTCGTATTA
The product that long primer YPB-B-P2 reacts through PCR:
TAATACGACTCACTATAGGGAGAC-(X)-GTATTCTATAGTGTCACCTAAAT
(X) representative is carried out sequence behind the pcr amplification with the original primer of this locus (DYS438), with consistent in the Human genome database on the internet.
C locus somatotype standard substance be long primer YPA-C-P1, the YPB-C-P2 of C locus through the polymerase chain reaction products therefrom, and long primer YPA-C-P1, YPB-C-P2 respectively account for 1/2nd of its gross weight through the pcr amplification products therefrom.Specifically, in the present embodiment, the sequence of C locus somatotype standard substance is
The product that long primer YPA-C-P1 reacts through PCR:
ATTTAGGTGACACTATAGAATAC-(X)-GTCTCCCTATAGTGAGTCGTATTA
The product that long primer YPB-C-P2 reacts through PCR:
TAATACGACTCACTATAGGGAGAC-(X)-GTATTCTATAGTGTCACCTAAAT
(X) representative is carried out sequence behind the pcr amplification with the original primer of this locus (DYS439), with consistent in the Human genome database on the internet.
D locus somatotype standard substance be long primer YPA-D-P1, the YPB-D-P2 of D locus through the polymerase chain reaction products therefrom, and long primer YPA-D-P1, YPB-D-P2 respectively account for 1/2nd of its gross weight through the pcr amplification products therefrom.Specifically, in the present embodiment, the sequence of D locus somatotype standard substance is
The product that long primer YPA-D-P1 reacts through PCR:
ATTTAGGTGACACTATAGAATAC-(X)-GTCTCCCTATAGTGAGTCGTATTA
The product that long primer YPB-D-P2 reacts through PCR:
TAATACGACTCACTATAGGGAGAC-(X)-GTATTCTATAGTGTCACCTAAAT
(X) representative is carried out sequence behind the pcr amplification with the original primer of this locus (C4), with consistent in the Human genome database on the internet.
In the present embodiment, the amount ratio of above-mentioned each component is: short primer YPA0.3ml (400nM), short primer YPB0.3ml (400nM), damping fluid (no Mgcl
2) 3.75ml, archaeal dna polymerase 3000u (3u/ μ l), Mgcl
23ml (2.25mM), A locus long primer YPA-A-P1 and A locus long primer each 0.3ml of YPB-A-P2 (40nM), B locus long primer YPA-B-P1 and B locus long primer each 0.3ml of YPB-B-P2 (40nM), C locus long primer YPA-C-P1 and C locus long primer each 0.3ml of YPB-C-P2 (40nM), D locus long primer YPA-D-P1 and D locus long primer each 0.3ml of YPB-D-P2 (40nM), artificial allelic ladder 4ml, in artificial allelic ladder, A locus somatotype standard substance 1ml, B locus somatotype standard substance 1ml, C locus somatotype standard substance 1ml, D locus somatotype standard substance 1ml.
In the present embodiment, damping fluid (no Mgcl
2), archaeal dna polymerase, Mgcl
2These three kinds of reagent are produced by the magnificent company of China.Wherein, the component of damping fluid is:
500mM KCl
100mM Tris-HCl
1.0%Triton X-100
In addition, the test kit in the present embodiment is made at 1000 samples.
Embodiment 2: the test kit in the present embodiment at locus to be amplified be respectively DYS456, DYS443, DYS444 and DYS448, below still represent above-mentioned four locus with A, B, C, D respectively.
In the present embodiment, except that different with the formation of above-mentioned four corresponding long primers of locus and somatotype standard substance, all the other compositions of test kit and the amount ratio of each composition are all identical with embodiment 1.In this example, primer P1, the P2 of the A locus DYS456 that announces in the gene database on the internet are
P1:5’cccatcaactcagcccaaaac 3’
P2:5’ggaccttgtgataatgtaagata 3’
Corresponding with it, the A locus long primer in the present embodiment is
YPA-A-P1:
5’ATTTAGGTGACACTATAGAATAC-cccatcaactcagcccaaaac?3’
YPB-A-P2:
5’TAATACGACTCACTATAGGGAGAC-ggaccttgtgataatgtaagata?3’
Primer P1, the P2 of the B locus DYS443 that announces in the gene database on the internet are
P1:5’tctttagctttttgcagccc?3’
P2:5’tcattggccacctgcatta?3’
Corresponding with it, the B locus long primer in the present embodiment is
YPA-B-P1?5’ATTTAGGTGACACTATAGAATAC-tctttagctttttgcagccc?3’
YPB-B-P2?5’TAATACGACTCACTATAGGGAGAC-tcattggccacctgcatta?3’
Primer P1, the P2 of the C locus DYS444 that announces in the gene database on the internet are
P1:5’tttctctcttcccactttaaccag?3’
P2:5’ctcacgttgttcaagggtca?3’
Corresponding with it, the C locus long primer in the present embodiment is
YPA-C-P1:
5’ATTTAGGTGACACTATAGAATAC-tttctctcttcccactttaaccag?3’
YPB-C-P2:
5’TAATACGACTCACTATAGGGAGAC-ctcacgttgttcaagggtca?3’
Primer P1, the P2 of the D locus DYS448 that announces in the gene database on the internet are
P1:5’tcttccttacgtgaatttcctc?3’
P2:5’tgtcaaagagcttcaatggaga?3’
Corresponding with it, the D locus long primer in the present embodiment is
YPA-D-P1:5’ATTTAGGTGACACTATAGAATAC-tcttccttacgtgaatttcctc?3’
YPB-D-P2:5’TAATACGACTCACTATAGGGAGAC-tgtcaaagagcttcaatggaga?3’
In the present embodiment, the sequence of A locus somatotype standard substance is
The product that long primer YPA-A-P1 reacts through PCR:
ATTTAGGTGACACTATAGAATAC-(X)-GTCTCCCTATAGTGAGTCGTATTA
The product that long primer YPB-A-P2 reacts through PCR:
TAATACGACTCACTATAGGGAGAC-(X)-GTATTCTATAGTGTCACCTAAAT
(X) representative is carried out sequence behind the pcr amplification with the original primer of this locus (DYS456), with consistent in the Human genome database on the internet.
The sequence of B locus somatotype standard substance is
The product that long primer YPA-B-P1 reacts through PCR:
ATTTAGGTGACACTATAGAATAC-(X)-GTCTCCCTATAGTGAGTCGTATTA
The product that long primer YPB-B-P2 reacts through PCR:
TAATACGACTCACTATAGGGAGAC-(X)-GTATTCTATAGTGTCACCTAAAT
(X) representative is carried out sequence behind the pcr amplification with the original primer of this locus (DYS443), with consistent in the Human genome database on the internet.
The sequence of C locus somatotype standard substance is
The product that long primer YPA-C-P1 reacts through PCR:
ATTTAGGTGACACTATAGAATAC-(X)-GTCTCCCTATAGTGAGTCGTATTA
The product that long primer YPB-C-P2 reacts through PCR:
TAATACGACTCACTATAGGGAGAC-(X)-GTATTCTATAGTGTCACCTAAAT
(X) representative is carried out sequence behind the pcr amplification with the original primer of this locus (DYS444), with consistent in the Human genome database on the internet.
The sequence of D locus somatotype standard substance is
The product that long primer YPA-D-P1 reacts through PCR:
ATTTAGGTGACACTATAGAATAC-(X)-GTCTCCCTATAGTGAGTCGTATTA
The product that long primer YPB-D-P2 reacts through PCR:
TAATACGACTCACTATAGGGAGAC-(X)-GTATTCTATAGTGTCACCTAAAT
(X) representative is carried out sequence behind the pcr amplification with the original primer of this locus (DYS448), with consistent in the Human genome database on the internet.
Embodiment 3: the test kit in the present embodiment at locus to be amplified be respectively DYS458, A10, DYS455 and DYS457, below still represent above-mentioned four locus with A, B, C, D respectively.
In the present embodiment, except that different with the formation of above-mentioned four corresponding long primers of locus and somatotype standard substance, all the other compositions of test kit and the amount ratio of each composition are also identical with embodiment 1.In this example, primer P1, the P2 of the A locus DYS458 that announces in the gene database on the internet are
P1:5’agcaacaggaatgaaactccaat?3’
P2:5’ccaccacgcccaccctcc?3’
Corresponding with it, the A locus long primer in the present embodiment is
YPA-A-P1:5’ATTTAGGTGACACTATAGAATAC-agcaacaggaatgaaactccaat?3’
YPB-A-P2:5’TAATACGACTCACTATAGGGAGAC-ccaccacgcccaccctcc?3’
Primer P1, the P2 of the B locus A10 that announces in the gene database on the internet are
P1:5’ATAAATGGAGATAGTGGGTGGATT?3’
P2:5’CCTGCCATCTCTATTTATCTTGCATATA?3’
Corresponding with it, the B locus long primer in the present embodiment is
YPA-B-P1:
5’ATTTAGGTGACACTATAGAATAC-ATAAATGGAGATAGTGGGTGGATT?3’
YPB-B-P2:
5’TAATACGACTCACTATAGGGAGAC-CCTGCCATCTCTATTTATCTTGCATATA?3’
Primer P1, the P2 of the C locus DYS455 that announces in the gene database on the internet are
P1:5’ggggtggaaacgagtgtt?3’
P2:5’atctgagccgagccgagagaatgata?3’
Corresponding with it, the C locus long primer in the present embodiment is
YPA-C-P1:
5’ATTTAGGTGACACTATAGAATAC-ggggtggaaacgagtgtt?3’
YPB-C-P2:
5’TAATACGACTCACTATAGGGAGAC-atctgagccgagccgagagaatgata?3’
Primer P1, the P2 of the D locus DYS457 that announces in the gene database on the internet are
P1:5’tgcagcctcaatttcctggt?3’
P2:5’tatagatagatagataaccacag?3’
Corresponding with it, the D locus long primer in the present embodiment is
YPA-D-P1:5’ATTTAGGTGACACTATAGAATAC-tgcagcctcaatttcctggt?3’
YPB-D-P2:5’TAATACGACTCACTATAGGGAGAC-tatagatagatagataaccacag?3’
In the present embodiment, the sequence of A locus somatotype standard substance is
The product that long primer YPA-A-P1 reacts through PCR:
ATTTAGGTGACACTATAGAATAC-(X)-GTCTCCCTATAGTGAGTCGTATTA
The product that long primer YPB-A-P2 reacts through PCR:
TAATACGACTCACTATAGGGAGAC-(X)-GTATTCTATAGTGTCACCTAAAT
(X) representative is carried out sequence behind the pcr amplification with the original primer of this locus (DYS458), with consistent in the Human genome database on the internet.
The sequence of B locus somatotype standard substance is
The product that long primer YPA-B-P1 reacts through PCR:
ATTTAGGTGACACTATAGAATAC-(X)-GTCTCCCTATAGTGAGTCGTATTA
The product that long primer YPB-B-P2 reacts through PCR:
TAATACGACTCACTATAGGGAGAC-(X)-GTATTCTATAGTGTCACCTAAAT
(X) representative is carried out sequence behind the pcr amplification with the original primer of this locus (A10), with consistent in the Human genome database on the internet.
The sequence of C locus somatotype standard substance is
The product that long primer YPA-C-P1 reacts through PCR:
ATTTAGGTGACACTATAGAATAC-(X)-GTCTCCCTATAGTGAGTCGTATTA
The product that long primer YPB-C-P2 reacts through PCR:
TAATACGACTCACTATAGGGAGAC-(X)-GTATTCTATAGTGTCACCTAAAT
(X) representative is carried out sequence behind the pcr amplification with the original primer of this locus (DYS455), with consistent in the Human genome database on the internet.
The sequence of D locus somatotype standard substance is
The product that long primer YPA-D-P1 reacts through PCR:
ATTTAGGTGACACTATAGAATAC-(X)-GTCTCCCTATAGTGAGTCGTATTA
The product that long primer YPB-D-P2 reacts through PCR:
TAATACGACTCACTATAGGGAGAC-(X)-GTATTCTATAGTGTCACCTAAAT
(X) representative is carried out sequence behind the pcr amplification with the original primer of this locus (DYS457), with consistent in the Human genome database on the internet.
Claims (1)
1, a kind of Y chromosome composite amplification silver transfection reagent box is characterized in that by short primer YPA, the short primer YPB, the no Mgcl that separate packing
2Damping fluid, archaeal dna polymerase, Mgcl
2, A locus long primer YPA-A-P1 and A locus long primer YPB-A-P2, B locus long primer YPA-B-P1 and B locus long primer YPB-B-P2, C locus long primer YPA-C-P1 and C locus long primer YPB-C-P2, D locus long primer YPA-D-P1 and D locus long primer YPB-D-P2 and artificial allelic ladder constitute, wherein:
Short primer YPA, YPB are inhuman genome sequence:
YPA:5/--ATTTAGGTGACACTATAGAATAC-3/;
YPB:5/--TAATACGACTCACTATAGGGAGAC-3/;
A locus long primer YPA-A-P1 and A locus long primer YPB-A-P2 are for adding the genome sequence that the above short primer YPA, YPB obtain with 5 ' end of genome sequence specificity bonded Oligonucleolide primers P1, the P2 of the mankind's A locus respectively;
B locus long primer YPA-B-P1 and B locus long primer YPB-B-P2 are for adding the genome sequence that the above short primer YPA, YPB obtain with 5 ' end of genome sequence specificity bonded Oligonucleolide primers P1, the P2 of the mankind's B locus respectively;
C locus long primer YPA-C-P1 and C locus long primer YPB-C-P2 are for adding the genome sequence that the above short primer YPA, YPB obtain with 5 ' end of genome sequence specificity bonded Oligonucleolide primers P1, the P2 of the mankind's C locus respectively;
D locus long primer YPA-D-P1 and D locus long primer YPB-D-P2 are for adding the genome sequence that the above short primer YPA, YPB obtain with 5 ' end of genome sequence specificity bonded Oligonucleolide primers P1, the P2 of the mankind's D locus respectively;
Artificial allelic ladder has comprised A locus somatotype standard substance, B locus somatotype standard substance, C locus somatotype standard substance and D locus somatotype standard substance altogether:
A locus somatotype standard substance be long primer YPA-A-P1, the YPB-A-P2 of A locus through the polymerase chain reaction products therefrom, and long primer YPA-A-P1, YPB-A-P2 respectively account for 1/2nd of its gross weight through the pcr amplification products therefrom;
B locus somatotype standard substance be long primer YPA-B-P1, the YPB-B-P2 of B locus through the polymerase chain reaction products therefrom, and long primer YPA-B-P1, YPB-B-P2 respectively account for 1/2nd of its gross weight through the pcr amplification products therefrom;
C locus somatotype standard substance be long primer YPA-C-P1, the YPB-C-P2 of C locus through the polymerase chain reaction products therefrom, and long primer YPA-C-P1, YPB-C-P2 respectively account for 1/2nd of its gross weight through the pcr amplification products therefrom;
D locus somatotype standard substance be long primer YPA-D-P1, the YPB-D-P2 of D locus through the polymerase chain reaction products therefrom, and long primer YPA-D-P1, YPB-D-P2 respectively account for 1/2nd of its gross weight through the pcr amplification products therefrom;
The amount ratio of each component is: concentration is short primer YPA0.25~0.35ml of 400nM, short primer YPB0.25~0.35ml, the no Mgcl that concentration is 400nM
2Damping fluid 3.5~4.0ml, concentration be that archaeal dna polymerase 3000u, the concentration of 3u/ μ l is the Mgcl of 2.25mM
22.5~3.5ml, concentration is A locus long primer YPA-A-P1 and each 0.25~0.35ml of A locus long primer YPB-A-P2 of 40nM, concentration is B locus long primer YPA-B-P1 and each 0.25~0.35ml of B locus long primer YPB-B-P2 of 40nM, concentration is C locus long primer YPA-C-P1 and each 0.25~0.35ml of C locus long primer YPB-C-P2 of 40nM, concentration is D locus long primer YPA-D-P1 and each 0.25~0.35ml of D locus long primer YPB-D-P2 of 40nM, concentration is the artificial allelic ladder 4ml of 40nM, in artificial allelic ladder, concentration is the A locus somatotype standard substance 1ml of 40nM, concentration is the B locus somatotype standard substance 1ml of 40nM, concentration is the C locus somatotype standard substance 1ml of 40nM, concentration is the D locus somatotype standard substance 1ml of 40nM.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CNB031174264A CN1172006C (en) | 2003-03-10 | 2003-03-10 | Y-chromosome compound-enlarging silver-dyeing reagent box |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CNB031174264A CN1172006C (en) | 2003-03-10 | 2003-03-10 | Y-chromosome compound-enlarging silver-dyeing reagent box |
Publications (2)
Publication Number | Publication Date |
---|---|
CN1438329A CN1438329A (en) | 2003-08-27 |
CN1172006C true CN1172006C (en) | 2004-10-20 |
Family
ID=27674178
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CNB031174264A Expired - Fee Related CN1172006C (en) | 2003-03-10 | 2003-03-10 | Y-chromosome compound-enlarging silver-dyeing reagent box |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN1172006C (en) |
-
2003
- 2003-03-10 CN CNB031174264A patent/CN1172006C/en not_active Expired - Fee Related
Also Published As
Publication number | Publication date |
---|---|
CN1438329A (en) | 2003-08-27 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN1896284A (en) | Method for identifying allelic gene type | |
CN1696311A (en) | Biochip for detecting pathogenesis fungus | |
CN1690218A (en) | PCR amplification reaction apparatus and method for PCR amplification reaction using apparatus | |
CN1977050A (en) | Determination of hepatitis c virus genotype | |
CN1856579A (en) | Methods of synthesizing polynucleotides using thermostable enzymes | |
CN1798974A (en) | Comparative genomic hybridization | |
CN1202935A (en) | Method of detecting telomerase activity | |
CN1303216C (en) | Multiplex PCR primer set for human glucokinase gene amplification | |
CN1724689A (en) | Strain specificity PCR detection method of heredity modified corn strain MON863 | |
CN1834258A (en) | Primer design method of multiple PCR for discriminating vaccine of tubercle branch bacillus | |
CN1550555A (en) | PCR amplification method, PCR primer set, PCR amplification product, and method for detection of nucleic acid using the amplification method | |
CN1283807C (en) | Method of efficiently detecting double-stranded nucleic acid | |
CN1800388A (en) | Eight human miRNAs | |
CN1172006C (en) | Y-chromosome compound-enlarging silver-dyeing reagent box | |
CN1243106C (en) | Y chromosome multi colour fluorescence combined amplification reagent box | |
CN1934275A (en) | Detection method of DNA amplification using probe labeled with intercalating dye | |
CN1754001A (en) | Method of detecting chlamydia trachomatis and kit therefor | |
CN100351395C (en) | Norwalk virus expression detecting kit and its special primer and probe | |
CN1845991A (en) | Primers for nucleic acid amplification and method of examining colon cancer using the same | |
CN1289669C (en) | Design process for compound amplifying primer | |
CN1218048C (en) | Multicolour fluorescent substance composit amplification STR primer designing method | |
CN1809638A (en) | Method of detecting beta 3 adrenaline receptor mutant gene and nucleic acid probe and kit therefor | |
CN1247796C (en) | Quantitative measuring transgene component in transgene rapeseed and processed product | |
CN1904064A (en) | Star shaped nocardia multiple PCR fast detection kit and detection method | |
CN1810988A (en) | Method and kit for detecting ox and sheep components in feed |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
C19 | Lapse of patent right due to non-payment of the annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |