CN117187294A

CN117187294A - Application of BnaC5.ACBP4 gene in improving flooding resistance of plants

Info

Publication number: CN117187294A
Application number: CN202311395853.5A
Authority: CN
Inventors: 刘唤唤; 刘建全; 郭孟芸; 尹康群
Original assignee: Sichuan University
Current assignee: Sichuan University
Priority date: 2023-10-26
Filing date: 2023-10-26
Publication date: 2023-12-08
Anticipated expiration: 2043-10-26
Also published as: CN117187294B

Abstract

The invention relates to the field of biotechnology, in particular to application of BnaC5.ACBP4 gene in improving flooding resistance of plants. The invention provides an application of BnaC5.ACBP4 gene in improving flooding resistance of plants. The invention carries out flooding treatment on wild type and BnaC5.ACBP4 over-expressed strain rape. The test result shows that compared with a wild type, the BnaC5.ACBP4 over-expression strain endows rape with stronger flooding resistance, which proves that the BnaC5.ACBP4 gene has a positive regulation effect on crops in response to flooding stress, and provides theoretical support in the principle of molecular biology for improving the flooding resistance of plants by constructing transgenic plants, namely, the flooding resistance of the rape is improved, and a flooding-resistant rape variety is cultivated.

Description

Application of BnaC5.ACBP4 gene in improving flooding resistance of plants

Technical Field

The invention relates to the field of biotechnology, in particular to application of BnaC5.ACBP4 gene in improving flooding resistance of plants.

Background

Rape (Brassica napus) belongs to Brassica of cruciferae and is one of four oil crops in the world. Besides being used for squeezing edible oil and feed, rape can also be used for preparing margarine and artificial protein in the food industry. The rubber has wide application in metallurgy, machinery, rubber, medicine and other fields, and has important economic value.

A large amount of continuous rainfall in a short period can cause partial or complete flooding of plants, and as the diffusion speed of oxygen in water is slower than that in air, and the consumption of oxygen by soil microorganisms, the damage to the plants caused by the flooding disaster is indirect, namely, when the plants are flooded for a long time, a large amount of mineral elements and main intermediate metabolites in the root systems of the plants are dissolved and lost; second, anaerobic respiration produces toxic secondary metabolites such as ethanol, acetaldehyde, etc. that are detrimental to plant growth. In addition, when the soil is excessively hydrated, the gas phase replaces the liquid phase, ethylene released by soil anaerobic microorganisms is absorbed by plants, and finally the roots of the plants, even the whole plant cells, are anoxic, and the plants die when serious.

The waterlogging caused by flooding has a plurality of adverse effects on the growth and development of plants, limits the growth of the plants and reduces the productivity and quality. Molecular regulation mechanisms of plants responding to waterlogging hypoxia stress are revealed through a large number of researches in rice and model plant Arabidopsis thaliana, and good research progress is achieved. However, they have been rarely successfully applied to crops such as rape in actual production to improve their water logging tolerance.

The escape strategy that plants evolved in response to flooding stress is also driven by ethylene, but there are different downstream signals in different plants. Transcription Factors (TFs) integrate signals and activate hypoxia-related genes, which are a family of group VII ethylene response factors (VII-ERFs) in rice. The stability of the oxygen sensing mechanism of Arabidopsis depends on the oxidation of the N-terminal cysteines (Cys) of VII-ERFs, which requires mediation of the Plant Cysteine Oxidase (PCO), which requires molecular oxygen as co-substrate. Oxidized Cys can convert RAP2.12 to the target of proteolytic enzymes, which are proteolytically performed by ubiquitin-mediated N-terminal regulated pathways. Under aerobic conditions, RAP2.12 localizes on the plasma membrane by interacting with plasma membrane anchored acyl-coa binding protein 1 (ACBP 1) and ACBP2, and RAP2.12 is released and transported to the nucleus during hypoxia, activating the expression of downstream hypoxia responsive genes (e.g. ADH1, SUS 4). In restoring aerobic processes, RAP2.12 rapidly degrades through N-terminal pathways and protease mediated proteolysis, terminating the hypoxia response.

Transgenic technology (transgenic technology) is a method for altering the genome of an organism. By transgenic techniques, genes of one species can be excised from its native genome and inserted into the genome of another species, effecting trans-species transfer of the genes. Doing so may result in the target species acquiring or altering a particular trait or function.

The use of transgenic technology in agriculture, such as transgenic crops, refers to conferring some new traits to crops or improving existing traits by inserting exogenous genes into their genome. These exogenous genes may be from other individuals of the same species or from different species. Through the transgenic technology, the characters of disease resistance, insect resistance, drought resistance, salt and alkali resistance and the like can be added for crops, and the yield and quality of the crops are improved. The transgenic technology is used in laboratory to improve the hypoxia tolerance property of rape, so as to raise its yield and quality.

The specific steps include the following aspects:

gene selection: the specific genes that need to be transferred are determined. Selecting proper gene for transfer according to target character

Cloning of the genes: the target gene is amplified and purified from the DNA by a molecular biological method to obtain a sufficient amount of DNA.

And (3) constructing a carrier: a suitable vector (e.g., a plasmid or virus) is selected and the gene of interest is inserted into the appropriate position of the vector to allow stable expression in the cell of interest.

Gene transfer: and introducing the constructed vector into target cells. This can be achieved by different methods, such as gene gun methods, agrobacterium-mediated transformation, electroporation, etc.

Gene integration: after obtaining the transgenic cells, the target genes are successfully integrated into the genome of the target cells and become permanent genetic features.

Selection markers and screening: to determine which cells successfully transferred the gene of interest, a selectable marker or screening method is typically included in the transgene. These methods may vary depending on the purpose of the transgene.

And (3) authentication and verification: multiple levels of molecular biology and physiology, etc., are identified and validated for transgenic cells or tissues to ensure proper expression of the target gene in the target cell without adversely affecting the cell or tissue.

Before plant transgenic manipulation can be performed, a comprehensive safety assessment must be made. This includes analysis and assessment of genomic structure, function, expression and transmission of transgenic plants to ensure that the transgenic plants do not negatively impact the environment and human health. In addition, toxicity, sensitization, anaphylaxis and the like of the transgenic plants need to be evaluated to ensure the edible safety of the transgenic plants.

The darkness flooding treatment (dark submergence treatment) is a method for simulating a hypoxia environment caused by flood disasters, which is commonly used in laboratories, is commonly applied to arabidopsis and other mode plants, and aims to simulate and monitor a series of responses of plants after suffering hypoxia in flooding stress by establishing a darkness hypoxia environment with controllable conditions.

Therefore, how to discover more kinds of flood resistance related genes, providing a theoretical basis for cultivating and improving flooding tolerant oilseed rape and other crop varieties, and is a problem to be solved by the skilled person.

Disclosure of Invention

The invention aims to provide an application of BnaC5.ACBP4 gene in improving flooding resistance of plants.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides an application of BnaC5.ACBP4 gene in improving flooding resistance of plants; the nucleotide sequence of the BnaC5.ACBP4 gene is shown in SEQ ID NO: 1.

The invention also provides a biological material containing BnaC5.ACBP4 gene; the biological material is an expression vector or a strain.

The invention also provides application of the biological material in cultivation of flooding-resistant plants.

Compared with the prior art, the invention has the following beneficial effects:

compared with wild type, the BnaC5.ACBP4 over-expression strain endows rape with stronger flooding resistance, which shows that the BnaC5.ACBP4 gene has positive regulation effect on improving the flooding stress resistance of crops, and provides a support in principle of molecular biology for improving the flooding stress resistance of plants by constructing transgenic plants, namely, the flooding resistance of rape can be improved, and the variety of the flooding-resistant rape can be cultivated.

Drawings

In order to more clearly illustrate the present embodiment or the technical solutions in the prior art, the drawings that are required to be used will be briefly described below. The figures in the following description are merely examples of the present embodiment, and other workers may repeat experiments according to existing results and methods, verifying the results of the figures. Further research is carried out with the aid of existing results, and other workers are likely to obtain new findings.

FIG. 1 is a map of pBWA (V) BS-BnACBP4-OSGFP vector of example 1 (Gname (Gene name), foreign gene BnaC5.ACBP 4); the vector sequence is shown in SEQ ID NO: shown at 9.

Fig. 2 shows that the BnaC5.ACBP4 overexpressing canola of example 1 can significantly improve flooding resistance.

FIG. 3 shows that BnaC5.ACBP4 overexpressing canola of example 1 has significantly up-regulated expression of hypoxia response gene ADH1 and cysteine oxidase PCO1 compared to wild-type canola.

Detailed Description

The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.

Example 1

1. Selection and localization of major genes for flooding

Previous laboratory studies have shown that the arabidopsis thaliana chromosome 3 gene ACBP4 (AT 3G 05420) is capable of interacting with WRKY70, erfviii, directly or indirectly modulating the downstream hypoxia response gene ADH1 through cystine oxidase (PCO 1) -mediated proteolysis, enhancing plant flooding resistance. In order to further study the flooding resistance in rape, the homologous gene BnaC5.ACBP4 is obtained and is over-expressed in rape. Homologous gene Bnac5.ACBP4 of ACBP4 can be obtained from website https: the// bioinformation. The nucleotide sequence of the BnaC5.ACBP4 gene is shown in SEQ ID NO: 1.

Construction of Bnac5.ACBP4 transgenic vector

(1) Obtaining the target fragment

Carrying out PCR amplification on a target fragment of the gene BnaC5.ACBP4, and recovering a product to obtain the target fragment; specifically, primers are synthesized, in order to add a FLAG tag (which is convenient for carrying out other experiments unrelated to the patent, the existence of the FLAG tag has no direct influence on the experiment), the invention carries out sectional amplification, the first pair of primers is a primer (48766_0 primer) added with the FLAG tag, and the second pair of primers is a target gene sequencing primer.

48766_0 primer

48766_0(+):aacacgggggactttgcaacatggctatggctagagcaacatctgg

48766_0(-):tcctcgcccttcacgatacatggcgaatcatctttctcctgaggg

Target gene sequencing primer

M48766(500C):caccaaggtaacggccatt

M48766(1000C):caagagttgacatgtttagtacaacac

M48766(1500C):gcgttcattgcggcttgtt

As set forth in SEQ ID NO:2 to 6

(2) 1 50. Mu.L of the system was prepared and the amplification reaction was performed according to the following procedure:

TABLE 1PCR System

Composition of the components	Volume of
		Ultrapure water	20μL
Primary high-fidelity enzyme Pfu	25μL
		Sense primer (100 mu M)	2μL
Antisense primer (100. Mu.M)	2μL
		Template	1μL
Total volume of	50μL

TABLE 2PCR procedure

(3) After amplification, the electrophoresis fragment of Gname (Gene name, gene BnaC5.ACBP4, 1998 bp) was excised under an ultraviolet lamp, put in a system for sol recovery, and the recovered DNA was dissolved in water in a total volume of 40. Mu.L (recovered product: rDNAG 1) for 20 minutes, and then recombined with the vector after detection.

2. Enzyme cutting carrier

The BsaI/Eco31I double-restriction plasmid pBWA (V) BS-ccdB is adopted, and the double-restriction empty vector is recovered and obtained; tables 3 and 4 show the cleavage reaction system and conditions

TABLE 3 cleavage reaction System

Composition of the components	Volume of
		Ultrapure water	13μL
Buffer 10	2μL
		Restriction enzymes BsaI or Eco31I	1μL
Vector pBWA (V) BS-ccdB-OSGFP	4μL
		Total volume of	20μL

TABLE 4 cleavage reaction conditions

Temperature (temperature)	Time
		37℃	1hour

The vector enzyme cut was purified using a PCR purification kit (the purified product was labeled pBWA (V) BS-ccdB-OSGFP (D)) for the next step of in vitro or in vivo recombination reactions

3. Vector construction

Constructing a pBWA (V) BS-Bn ACBP4-OSGFP vector (figure 1) by adopting a homologous recombination and golden gate seamless cloning method, wherein the vector sequence of the pBWA (V) BS-Bn ACBP4-OSGFP vector is shown as SEQ ID NO: shown as 9; tables 5 and 6 show pBWA (V) BS-Bn ACBP4-OSGFP vector recombination systems and conditions;

TABLE 5 recombination reaction System

TABLE 6 recombinant reaction conditions

Temperature (temperature)	Time
		37℃	30hours

And 8 mu L of the connection product is transformed into escherichia coli competent, a (kanamicin) resistant culture medium is coated after transformation and recovery, the culture is carried out for 12 hours at 37 ℃, and plaque PCR identification is carried out to obtain the monoclonal antibody.

4. Plaque PCR identification

10 bacterial plaques were picked and simultaneously subjected to 1.5ml EP tube-connected bacteria and PCR identification,

the primers were as follows:

HS)35seq:tTCATTTGGAGAGAACACGGGggac(2303bp)

M48766(500C):caccaaggtaacggccatt(2945bp)；

as set forth in SEQ ID NO:7 to 8

10 PCR reactions were performed in a 25. Mu.L system, and the PCR reaction system and the procedure are shown in Table 7 and Table 8.

TABLE 7PCR reaction System

Composition of the components	Volume of
		Ultrapure water	9.5μL
Primary PCRMix	12.5μL
		Upstream primer (100. Mu.M)	1μL
Downstream primer (100. Mu.M)	1μL
		Template	1μL
Total volume of	25μL

TABLE 8PCR reaction procedure

The target band is a fragment of about 662 bp. Taking bacterial solutions corresponding to 2 positive strips, taking 100 mu L of bacterial solutions, carrying out sample feeding and sequencing, inoculating the rest 400 mu L of bacterial solutions into 8ml (kanamicin) resistant LB, shaking a test tube, and taking a tube for extracting plasmids corresponding to correct sequencing after the result of the sequencing is obtained.

5. Agrobacterium transformation

1. Mu.g of pBWA (V) BS-BnACBP4-OSGFP vector was transformed into Agrobacterium competent, transformed with (kanamycin, rifampin) resistant medium, incubated at 28℃for 48 hours, and colony PCR was identified, and the PCR reaction system and procedure were as in tables 7 and 8.

6. Agrobacterium-mediated genetic transformation of rape

(1) Preparation before sowing

Cleaning a square box with a cover for sowing, preparing 1000ml of blue gun heads, a 50ml centrifuge tube, preparing an M0 culture medium, preparing deionized water, sending the deionized water to high-temperature high-pressure sterilization, and pouring the sterile M0 culture medium into the square box with the cover for later use.

(2) Sowing seeds

Soaking rape seed (variety Zhongshuang 11) with appropriate amount of 75% alcohol for 1min, and pouring out alcohol; washing with sterile water once, and pouring out water; sterilizing with 50% 84 disinfectant for 10min, and washing the seeds with appropriate amount of sterile water for 5 times; the treated seeds were sown to M0 medium with sterile forceps, 25 seeds were sown per dish, and then the dishes were placed in a sterile incubator and incubated for 6d at 24℃in the dark.

(3) Preparation before dip dyeing

Cleaning a large square dish for dip dyeing, a glass dish, a 50ml centrifuge tube, a 200ml gun head, preparing a culture medium, sending the culture medium to high-temperature high-pressure sterilization, pouring the culture medium into the glass dish, and sealing for standby.

(4) Activation and preparation of Agrobacterium

The day before the dip-dyeing, 100mL of the sterilized liquid LB medium is added with antibiotics (corresponding antibiotics are added according to the resistance of the agrobacterium strain), and the agrobacterium strain is inoculated and cultured for 16h at 28 ℃ under 200rpm in a shaking way.

(5) Dip-dyeing and co-culturing of explants

When the OD value of the agrobacterium tumefaciens bacteria liquid cultured in the step (4) is 0.8, equally dividing the bacteria liquid into two 50mL sterile centrifuge tubes (operation of an ultra-clean workbench), centrifuging at 3000rpm for 20min after balancing, pouring out supernatant, lightly washing thalli with 1mL suspension (DM) (AS acetosyringone is added), pouring out, adding 1mL DM, sucking and suspending by a pipetting gun, shaking uniformly, and placing on ice for standby after configuration;

simultaneously, cutting the hypocotyl of the seedling under dark culture vertically by using sterile forceps and a scalpel, and cutting in DM liquid, wherein the optimal length of the explant is 1.0cm; placing the cut explants into the dish containing the agrobacterium liquid for dip-dyeing for 15min, wherein the number of the explants in each dish is preferably 150, and shaking for 5 times at intervals of 10 min;

after the dip-dyeing, the explant is gently clamped by using sterile forceps, the surface excess bacterial liquid is removed by placing sterile filter paper, the explant is placed on an M1 culture medium by using the sterile forceps, and the explant is co-cultured for 48 hours at 24 ℃ under the dark condition.

(6) Selective culture

After co-cultivation, the explants were transferred to M2 medium for selection for 18d under the following conditions: culturing at 24deg.C with light, 16 hr/8 hr in daytime. The conditions of differentiation culture and rooting culture are the same as in this stage.

(7) Differentiation culture

Transferring the explants after selective culture to M3 culture medium for differentiation culture, and repeating the culture every 20d until bud formation.

(8) Rooting culture

After differentiation and budding, the shoots were excised from the calli using sterile forceps and a scalpel and transferred to M4 medium for rooting. Vitrified shoots will not be transformed to normal until they are cultured for a period of time and then will be rooted.

(9) Transplanting and soil cultivation

Transplanting the rooted rape plants into sterilized soil (Pinshi substrate soil), transferring the rape plants into an incubator under the illumination condition of 2000lux at 4 ℃ for vernalization for 15 days, transferring the rape plants into an illumination environment greenhouse at 22 ℃ for 13000lux (16-hour illumination/8-hour dark circulation), and culturing the rape plants. Obtaining the rape BnaC5.ACBP4 over-expression transgene line.

7. Treatment of darkness and flooding

(1) Preparing a plant sample:

full fresh seeds (Zhongshuang 11) are selected, placed in a culture dish lined with two layers of sterile wet filter paper, germinated for 60 hours at 25 ℃, the seedlings growing out cotyledons are transplanted into sterile soil, and transferred into a light environment of 22 ℃ and 13000lux (16-hour light/8-hour dark cycle) for greenhouse culture for 2 weeks, and a wild type strain is obtained without vernalization.

Selecting proper samples of 20 pots of rape BnaC5.ACBP4 over-expression transgenic strain and wild control strain (Zhongshuang 11) with similar growth conditions, placing the samples in a heat-insulating foam box with an inner size of 440 x 320 x 220cm, and fixing the flowerpot and soil by using long bamboo sticks or steel balls;

(2) Flooding operation:

the plant samples in the containers were completely soaked in water for 48 hours, ensuring that the water level was 3cm higher after all leaves of the samples were adequately covered. The flooding device can be directly arranged in a greenhouse for planting rape, so that the water temperature is ensured to be matched with the rape growth condition;

(3) Establishing a dark environment:

covering the foam box cover, and pressing the gaps by using a heavy object to simulate the hypoxia condition of plants in flood disasters;

(4) Monitoring and recording:

during the experiment, physiological and morphological changes of the plant samples were noted. After flooding is completed, the plants are moved into the original growth environment for 4 days to recover, and further evaluation of key indexes such as plant survival rate, plant dry weight and the like is carried out.

(5) Analysis data:

data analysis was performed on the experimental results, comparing the differences between the treatment group and the control group to understand the adaptation of bnac5.Acbp4 to the hypoxic environment.

As shown in FIG. 2, after flooding was completed and plants were subjected to a 4-day primary growth environmental reoxygenation treatment (culture conditions of step (1) above), the wilting of wild-type (WT) leaves was more severe than that of BnaC5.ACBP4 overexpressing rape line (BnaC 5.ACBP 4-OE). Furthermore, the survival rate and dry weight of the flooded wild type and BnaC5.ACBP4 overexpressing canola lines were examined and found to be significantly higher for the latter than for the former.

As shown in fig. 3, wild-type and bnac5.acbp4 overexpressing lines were sampled for flooding 0h (Air) and 20h (Submergence) and expression of the rape homologous genes ADH1 and PCO1 after flooding treatment was examined for wild-type and bnac5.acbp4 overexpressing lines, resulting in stronger flooding response for ADH1 and PCO1 in the bnac5.acbp4 overexpressing lines than in the wild-type plants.

Compared with the wild type, the BnaC5.ACBP4 overexpression line is endowed with stronger flooding resistance of the rape, which indicates the conservation of functions.

The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Claims

The BnaC5.ACBP4 gene is applied to improving the flooding resistance of plants.
2. The use according to claim 1, wherein the plant is canola.
3. The use according to claim 1 or 2, wherein the nucleotide sequence of the bnac5.Acbp4 gene is as set forth in SEQ ID NO: 1.
4. A biological material containing the bnac5.Acbp4 gene, characterized in that the biological material is an expression vector or strain.
5. Use of the biological material according to claim 4 for cultivating flooding-resistant plants.
6. The use according to claim 5, wherein the plant is canola.