CN117143900A - Bacillus coagulans engineering bacterium with ambr gene knocked out as well as preparation method and application thereof - Google Patents

Abstract

The application provides knockoutamtRGene preparation bacitracin engineering bacteria, preparation method and application thereof, wherein the bacitracin engineering bacteria are obtained by knocking out the genome of bacillus licheniformis by adopting genetic engineering meansamtRGene, obtained knockoutamtRPost-gene recombinant strain, saidamtRThe nucleotide sequence of the gene is shown in SEQ ID NO. 1. The application provides a new strategy for improving the yield of bacitracin. And, with Bacillus licheniformis DW2 is the delta of recombinant strain DW2 of Bacillus licheniformis obtained by the construction of the applicationamtRThe yield of bacitracin is improved by more than 18 percent.

Description

Knock-outamtRGene bacitracin engineering bacterium, and preparation method and application thereof

Technical Field

The application relates to the fields of genetic engineering and fermentation engineering, in particular to a bacitracin engineering bacterium for knocking out an amtR gene, a preparation method and application thereof.

Background

Bacillus licheniformis is an internationally accepted industrial microorganism strain with biosafety (GRAS), has the advantages of clear genetic background, strong robustness, stable character and the like, and is widely applied to fermentation production of biochemical products such as poly-gamma-glutamic acid, lichenin, phenethyl alcohol, bacitracin and the like.

Bacitracin is a polypeptide antibiotic synthesized by bacillus subtilis and bacillus licheniformis, can strongly inhibit the growth of gram-positive bacteria and partial gram-negative bacteria, has a synergistic enhancement effect when used in combination with other antibiotics, and is thus widely used in the feed additive and veterinary medicine industries. The bacitracin structure includes 11 amino acids of ornithine (Orn), D-phenylalanine (D-Phe), histidine (His), D-aspartic acid (D-Asp), asparagine (Asn), lysine (Lys), D-glutamic acid (D-Glu), cysteine (Cys), leucine (Leu), isoleucine (Ile) and valine (Val). In recent years, strategies concerning high yield of bacitracin have focused mainly on enhancing the supply level of bacitracin precursor amino acids; there are reports of improving bacitracin production by engineering transcription regulatory factors (e.g., phoP, kipR, lrps), however, the mechanism of action of PhoP, kipR, lrps transcription factors in bacteria is not known, and there is no report on the correlation between these transcription factors and transcription factor AmtR (including transcription factors AmtR, genes encoding AmtR, and regulatory subjects of AmtR).

And, the transcription factor AmtR is composed ofamtRThe coding belongs to the TetR family members, and mainly participates in regulating nitrogen metabolic processes in bacteria, including ammonium utilization, urea metabolism, signal transduction and the like. However, the relationship between the ammonium salt utilization efficiency and the amino acid synthesis level is not known, and because of the large variety of bacitracin synthesis precursors, bacitracin amino acid metabolism has a strict and complex regulatory mechanism, and there is no evidence that there is a close relationship between ammonium utilization and amino acid synthesis and bacitracin yield. In addition, there is no report indicating that AmtR is capable of modulating the growth of bacterial cells. Thus, the relationship between the transcription factor AmtR and the bacitracin synthesis level is not clear nor predictable.

Disclosure of Invention

One of the purposes of the present application is to provide a knockoutamtRThe method for preparing the bacitracin engineering bacteria by the genes has stronger capacity of producing bacitracin by fermenting the bacitracin engineering bacteria.

Knocking outamtRA method for preparing bacitracin engineering bacteria by gene adopts genetic engineering means to knock out the bacillus licheniformis genomeamtRGene, obtain knockoutamtRThe recombinant strain after gene (namely the bacitracin-producing engineering bacterium), theamtRThe nucleotide sequence of the gene is shown in SEQ ID NO. 1.

The application adopts a genetic engineering method to knock out the coding gene of the transcription regulatory factor AmtR in the genome of bacillus licheniformisamtRThe gene provides a new strategy for improving the yield of bacitracin.

Preferably, the bacillus licheniformis is bacillus licheniformis DW2 #Bacillus licheniformis DW 2) which has been preserved in China center for type culture collection (China center for type culture collection) in Wuhan at 10 and 12 days 2011, wherein the preservation number is CCTCC NO: M2011344, and Bacillus licheniformis DW2 is an existing strain with high yield of bacitracin, and the bacitracin yield of the obtained recombinant strain is higher by taking the strain as an original strain.

Preferably, the genetic engineering means is used for knocking out the genome of bacillus licheniformisamtRA gene comprising the steps of:

(1) The genome of bacillus licheniformis DW2 is used as a template to be amplified by PCRamtRAn upstream homology arm and a downstream homology arm of the gene;

(2) Connecting the upstream homology arm and the downstream homology arm of the step (1) together by using overlap extension PCR to obtain a homology arm fusion fragment;

(3) By restriction enzymesBamHI andXbai, carrying out double enzyme digestion on the homology arm fusion fragment obtained in the step (2) to obtain an enzyme digestion fusion fragment A; at the same time adoptBamHI andXbai, carrying out double enzyme digestion on plasmid T2 (2) -ori to obtain a linear plasmid fragment after enzyme digestion;

(4) Connecting the enzyme-digested fusion fragment A obtained in the step (3) and the linear plasmid fragment by using T4-DNA ligase, transferring the enzyme-linked product into escherichia coli DH5 alpha by using a calcium chloride conversion method, taking kanamycin as a resistance screening marker, obtaining a positive transformant by colony PCR, and sequencing to obtainamtRKnockout plasmid T2 (2) -ori-amtR；

(5) T2 (2) -ori-amtRTransferring into bacillus licheniformis DW2, and screening by the resistance of kanapigenin to obtain a positive transformant;

(6) The positive transformant which is verified to be correct by colony PCR in the step (5) is subjected to transfer culture for a plurality of times, colony PCR detection is carried out, and screening is carried out to obtainamtRUpstream arm or geneamtRA positive single-crossover binder strain that generates single crossover with bacillus licheniformis DW2 genomic DNA in the downstream arm of the gene;

(7) Subjecting the positive single exchange binder strain obtained in step (6) to several passesCulturing, and screening by combining PCR method to obtain knockoutamtRThe bacillus licheniformis of gene is named: DW2 deltaamtR。

It is a second object of the present application to provide a knockoutamtRA gene-producing bacitracin engineering bacterium which is said knockdown employing one of the objects of the present applicationamtRRecombinant strain constructed by gene preparation method of bacitracin engineering bacteria.

The third purpose of the application is to provide the application of the bacitracin-producing engineering bacteria in bacitracin production, which comprises seed culture and fermentation culture.

In the application, the formula of the fermentation medium used in the fermentation culture is 60-100 g/L soybean meal; 30-50 g/L corn starch; 4-8 g/L calcium carbonate and 0.5-2 g/L ammonium sulfate.

Compared with the prior art, the application has the following technical effects:

the application firstly uses the knocking out in bacillus licheniformisamtRThe gene can increase the yield of bacitracin, and provides a new strategy for bacitracin high yield. Compared with Bacillus licheniformis DW2, the recombinant strain DW2 delta of Bacillus licheniformis constructed by the applicationamtRThe yield of bacitracin is improved by more than 18 percent. The research result of the application shows that: by knocking outamtRGene enhancement of bacitracin production is a very efficient and viable approach.

Drawings

FIG. 1 shows the result of step (1)amtRUpstream homology arm of geneamtRAgarose gel electrophoresis of the downstream homology arm of the gene, wherein lane M is DNA marker, lane 1 isamtRUpstream homology arm of gene, lane 2amtRDownstream homology arms of the gene;

FIG. 2 is an agarose gel electrophoresis of the homology arm fusion fragment obtained in the step (2), wherein lane M is a DNA marker, and lane 1 is a homology arm fusion fragment;

FIG. 3 shows the knockout vector T2 (2) -ori (II) obtained in the step (4)amtRPerforming colony PCR verification, wherein lane M is a DNA marker, and lane 1 is a knockout vector T2 (2) -ori-amtRColony PCR assay was performedA strip of certificates;

FIG. 4 is a colony PCR verification chart of the positive transformant strain obtained in the step (5), wherein lane M is a DNA marker, and lane 1 is a verification band of the positive transformant strain;

FIG. 5 shows the knockdown obtained in step (7)amtRGenetic bacillus licheniformis DW2 deltaamtRWherein lane M is a DNA marker and lane 1 is Bacillus licheniformis DW2 deltaamtRIs a verification strip of (2);

wherein, the molecular weight corresponding to the bands from top to bottom in the DNA marker lanes is as follows: 5000 bp,3000 bp,2000 bp,1500 bp,1000 bp,750bp,500 bp,250 bp,100 bp.

Description of the embodiments

The following examples are further illustrative of the application and are not intended to be limiting thereof. The technical scheme of the application is a conventional scheme in the field if not specifically described; the reagents or materials, unless otherwise specified, are commercially available.

Example 1

Knocking outamtRA method for preparing bacitracin engineering bacteria by gene adopts genetic engineering means to knock out the bacillus licheniformis genomeamtRGene, obtain knockoutamtRThe recombinant strain after gene, namely the bacitracin-producing engineering bacterium, theamtRThe nucleotide sequence of the gene is shown in SEQ ID NO. 1. The bacillus licheniformis is bacillus licheniformis DW2 which is preserved in China Center for Type Culture Collection (CCTCC) in Wuhan in 2011 for 10 months and 12 days, and the preservation number is M2011344. The genetic engineering method is adopted to knock out the genome of the bacillus licheniformisamtRThe specific steps of the gene are as follows:

(1) According to the DW2 genome DNA sequence of bacillus licheniformisamtRGene sequence of gene, designamtRUpstream homology arm primer of geneamtR-F1、amtRR1) and downstream homology arm primeramtR-F2、amtR-R2); and genome DNA of bacillus licheniformis DW2 is used as a template, and respectivelyamtRUpstream homology arm primer and downstream homology arm primer of genePCR amplification of the productamtRUpstream homology arm fragment of geneamtRDownstream homology arm fragments of the gene (as shown in figure 1,amtRthe upstream homology arm fragment of the gene was 582 bp,amtRthe downstream homology arm fragment of the gene is 585 bp);

wherein,amtR-F1、amtR-R1、amtR-F2、amtRthe sequence of R2 is:

amtR-F1：CGGGATCC TTTCTCATCCTTTGACCACG

amtR-R1：CATCAGAAATCCCCCTTTTGATCATCATTCCTTTTC

amtR-F2：GAAAAGGAATGATGATCAAAAGGGGGATTTCTGATG

amtR-R2：GCTCTAGA ATGTAACGGGATCTGCCG

(2) To be used foramtRUpstream homology arm fragment of geneamtRThe downstream homology arm fragment of the gene is used as a template, and the upstream homology arm primeramtRF1, downstream homology arm primeramtRR2 is a primer, and is amplified by overlap extension PCRamtRUpstream homology arm of geneamtRThe downstream homology arms of the genes are connected together to obtain a homology arm fusion fragment (as shown in figure 2, the homology arm fusion fragment is 1247 bp);

(3) By usingXbaI andBamthe HI restriction endonuclease carries out double enzyme digestion on the homology arm fusion fragment in the step (2) to obtain an enzyme digestion fusion fragment;

(4) Plasmid T2 (2) -ori was prepared (wherein plasmid T2 (2) -ori was constructed by amplifying 194-ori from pE194 plasmid, kanamycin resistance gene from pDG780 plasmid, pUC-ori from plasmid pBluescript II SK (+) -X52328 by PCR reaction, and recovering and digestion. Construction of Bacillus subtilis-E.coli multifunctional shuttle vector was carried out according to 194-ori, kanamycin resistance gene, pUC-ori in the order of ligation, reference was made to Guo Xinghua, xiong Zhan et al (1991) [ J ]]Bioengineering report 7 (3) 224-229 and Peng Qingzhong, zhang Weicai et al (2002) construction of Bacillus pumilus-E.coli shuttle secretion expression vector [ J ]]Bioengineering journal 18 (4): 438-441) and usesXbaI andBamHI restriction endonuclease double-cleaves plasmid T2 (2) -oriObtaining a linear plasmid fragment (4250 bp); wherein the restriction enzymeXbaI andBamHI restriction enzymes were purchased from Beijing full gold Biotechnology Co., ltd;

(5) Connecting the enzyme-cleaved gene fragment in the step (3) and the linear plasmid fragment in the step (4) through T4 DNA ligase to obtain a connection product; the ligation product is transferred into escherichia coli DH5 alpha by a calcium chloride transformation method, and is screened by a culture medium containing kanagacillin resistance at 37 ℃ to obtain transformants, and colony PCR verification is carried out on the transformants by using primers T2-F and T2-R (the primers used are T2-F and T2-R). The PCR verification result of the transformant is as follows: the presence of an electrophoretic band at 1535 bp (as shown in fig. 3) indicates successful knockout vector construction, designated: knockout vector T2 (2) -ori-amtR；

Wherein the sequences of T2-F and T2-R are:

T2-F： ATGTGATAACTCGGCGTA、

T2-R： GCAAGCAGCAGATTACGC；

(6) Knockout of vector T2 (2) -ori-amtRThe transformants obtained by the screening were subjected to colony PCR verification by using primers T2-F and T2-R by transferring the transformants into Bacillus licheniformis DW2 by the method of electric shock conversion, screening the transformants by a medium containing kanagacillin resistance at 37 ℃. If the PCR verification result of the transformant is: the appearance of an electrophoretic band at 1535 bp demonstrates that: knockout vector T2 (2) -ori-kipRSuccessfully transferring into bacillus licheniformis DW2, wherein the transformant is a positive transformant;

(7) Transferring the positive transformant obtained in the step (6) to a medium containing kanagamicin resistance at 45 ℃ for 3 times, culturing 12 h each time, and culturing the positive transformant with T2-F andamtRKYR as primer (or T2-R andamtRKYF as primer) to verify single-crossover strains by colony PCR, if the size of the electrophoresis band is 1479 bp or 2094 bp, the single-crossover strains are proved to be successful (as shown in FIG. 4);

wherein the primeramtRKYF andamtRthe sequence of KYR is:

amtR-KYF：GACGCCGTTGTCGGAAGC

amtR-KYR：TGATTTGCGGAGCGGACT

(8) Inoculating the single-exchange strain obtained in the step (7) into a culture medium which does not contain kanapecillin at 37 ℃ for 3-6 times of transfer culture, picking the transformant, and performing colony PCR verification (the primer isamtRKYF andamtRKYR). If the PCR verification result of the transformant is: when an electrophoresis band appears in 1993, bp, it indicates that the gene is back mutated, and the transformant is Bacillus licheniformis DW2; when an electrophoretic band appears at 1378 and bp, it is explained thatamtRThe gene was successfully knocked out in B.licheniformis DW2, a positive transformant (see FIG. 5). The positive transformant is then further sequenced and verified to obtain a knockoutamtRGenetic bacillus licheniformis DW2 deltaamtR。

Next, the present inventors also used the Bacillus licheniformis DW2 delta obtained by the above constructionamtRTo ferment and produce bacitracin. Wherein, bacillus licheniformis DW2 deltaamtRApplications in bacitracin production include seed culture and fermentation culture.

The specific steps of the seed fermentation are as follows: firstly, the bacillus licheniformis DW2 delta is performedamtRThe method comprises the steps of (1% by volume of glycerol tubes are inoculated into 5mL of LB culture medium, the culture is carried out for 12 hours at the temperature of 37 ℃ at 230r/min, then bacterial liquid after bacterial activation is inoculated into seed culture medium at the inoculum size of 1% by volume and then is cultured for 12 hours at the temperature of 37 ℃ at 230r/min, and seed culture liquid is obtained (the formula of the seed culture medium is 10 g/L peptone, 5 g/L yeast extract, 10 g/L sodium chloride and pH 7.2).

The specific steps of the fermentation culture are as follows: and filling 20mL of fermentation culture mediums with different formulas (the specific formulas are shown in table 1, the pH of the fermentation culture mediums used in each example in table 1 is natural, then inoculating the bacterial liquid for seed culture with the inoculation amount of 3% (volume percent), and fermenting and culturing for 48 hours at the temperature of 37 ℃ at the rotating speed of 230r/min to obtain the fermentation liquid.

The present inventors used a High Performance Liquid Chromatography (HPLC) method to determine the yield of bacitracin in the fermented broth produced in the above examples. The measurement conditions are specifically as follows: detecting by using an Agilent 1200 liquid chromatograph; the column was Hypersil BDS C18 (5 μm, 4.6 mm ×250 mm); mobile phase a: b=35:65 (phase a: 100 mL of phosphate buffer solution ph6.0 to 300 mL water, phase B: 520 mL methanol and 40 mL acetonitrile; flow rate: 1.0 mL/min; column temperature 30 ℃; ultraviolet detector wavelength: 254 nm; the sample injection amount was 20. Mu.L. The yield of bacitracin in the fermentation broth was calculated from the standard curve made of bacitracin standard (see table 2).

TABLE 1

TABLE 2

As can be seen from table 2: under the same fermentation conditions, the Bacillus licheniformis DW2 delta is adopted compared with the Bacillus licheniformis DW2 in the prior artamtRThe yield of bacitracin in the fermentation broth is obviously improved (by more than 18 percent), which shows that: the technical scheme of the application has important application value in improving the yield of bacitracin of bacillus licheniformis.

It should be understood by those skilled in the art that the present application may be embodied in many different forms without departing from the spirit or essential characteristics thereof.

Claims (6)

1. Knocking outamtRA method for preparing bacitracin engineering bacteria by gene is characterized in that the gene engineering means is adopted to knock out the genome of bacillus licheniformisamtRGenes and obtain knockoutsamtRThe recombinant strain after gene, namely the bacitracin-producing engineering bacterium, theamtRThe nucleotide sequence of the gene is shown in SEQ ID NO. 1.

2. The knockout of claim 1amtRMethod for preparing bacitracin-producing engineering bacteria by genesIs characterized in that the bacillus licheniformis is bacillus licheniformis DW2 which is preserved in China Center for Type Culture Collection (CCTCC) in Wuhan in 2011 for 10 months and 12 days, and the preservation number is M2011344.

3. The knockout of claim 2amtRThe method for preparing the bacitracin-producing engineering bacteria by genes is characterized in that the genetic engineering means is adopted to knock out the genome of bacillus licheniformisamtRThe gene specifically comprises the following steps:

(1) The genome of bacillus licheniformis DW2 is used as a template to be amplified by PCRamtRAn upstream homology arm and a downstream homology arm of the gene;

(2) Connecting the upstream homology arm and the downstream homology arm of the step (1) together by using overlap extension PCR to obtain a homology arm fusion fragment;

(3) By restriction enzymesBamHI andXbai, carrying out double enzyme digestion on the homology arm fusion fragment obtained in the step (2) to obtain an enzyme digestion fusion fragment A; at the same time adoptBamHI andXbai, carrying out double enzyme digestion on plasmid T2 (2) -ori to obtain a linear plasmid fragment after enzyme digestion;

(4) Connecting the enzyme-digested fusion fragment A obtained in the step (3) and the linear plasmid fragment by using T4-DNA ligase, transferring the enzyme-linked product into escherichia coli DH5 alpha by using a calcium chloride conversion method, taking kanamycin as a resistance screening marker, obtaining a positive transformant by colony PCR, and sequencing to obtainamtRKnockout plasmid T2 (2) -ori-amtR；

(5) T2 (2) -ori-amtRTransferring into bacillus licheniformis DW2, and screening by the resistance of kanapigenin to obtain a positive transformant;

(6) The positive transformant which is verified to be correct by colony PCR in the step (5) is subjected to transfer culture for a plurality of times, colony PCR detection is carried out, and screening is carried out to obtainamtRUpstream arm or geneamtRA positive single-crossover binder strain that generates single crossover with bacillus licheniformis DW2 genomic DNA in the downstream arm of the gene;

(7) The step (6) is carried outThe positive single exchange binder strain of (2) is subjected to transfer culture for several times and is screened by combining a PCR method to obtain knockoutamtRGene Bacillus licheniformis DW2 deltaamtR。

4. Knocking outamtRA gene producing bacitracin engineering bacterium which is obtained by knocking out the gene according to any one of claims 1 to 3amtRRecombinant strain constructed by gene preparation method of bacitracin engineering bacteria.

5. The knockout of claim 4amtRThe application of the gene bacitracin-producing engineering bacteria in bacitracin production comprises seed culture and fermentation culture.

6. The knockout of claim 5amtRThe application of the gene bacitracin-producing engineering bacteria in bacitracin production is characterized in that: the formula of a fermentation medium used for fermentation culture is 60-100 g/L soybean meal; 30-50 g/L corn starch; 4-8 g/L calcium carbonate and 0.5-2 g/L ammonium sulfate.