CN112359007B - Exogenous introduction edd gene bacillus licheniformis for producing bacitracin and application - Google Patents

Abstract

The invention provides exogenously introduced edd gene bacillus licheniformis for producing bacitracin and application thereof, wherein the exogenously introduced edd gene bacillus licheniformis is as follows: the existing method for introducing exogenous gene into host cell is adopted to introduce exogenous gene into host celleddThe gene is introduced into the bacillus licheniformis through an overexpression plasmid to obtain a recombinant strain; the recombinant strain is used for fermentation production of bacitracin, and the aim of improving the fermentation yield of bacitracin can be achieved.

Description

Exogenous introduction edd gene bacillus licheniformis for producing bacitracin and application

Technical Field

The invention belongs to the technical field of genetic engineering bacteria modification, and particularly relates to exogenously introduced edd gene bacillus licheniformis for producing bacitracin and application thereof.

Background

Bacitracin (English name: bacitracin), subtilin, and Bacitracin. It is an unstable polypeptide formed by combining various amino acids, and contains A and B ₁ 、B ₂ 、B ₃ 、D ₁ 、D ₂ 、D ₃ And E a plurality of components having the following chemical structures:

wherein, the component A has the highest activity and the most abundant content, and the molecular formula is C ₆₆ H ₁₀₃ N ₁₇ O ₁₆ And S. It is a dodecapeptide containing a seven-membered ring. It contains a thiazoline ring formed from L-isoleucine and L-cysteine, an epsilon-NH in lysine ₂ A cyclic heptapeptide structure formed by the linkage between the side chain and the C-terminus of asparagine, and four D-amino acids (D-glutamic acid, D-ornithine, D-phenylalanine, and D-aspartic acid).

Bacitracin is odorless, bitter, white or light yellow powder, is easily soluble in water, soluble in ethanol, methanol and glacial acetic acid, insoluble in acetone, chloroform or diethyl ether, has hygroscopicity, is easily destroyed by oxidant, and can be precipitated by various heavy metal salts in solution. The unique composition and structure of the compound make it have great resistance to various proteolytic enzymes such as trypsin, pepsin, papain and the like, and simultaneously, the compound is not influenced by protease inhibitors. Bacitracin is used in medicine mainly for treating acne, purulent dermatosis, amebic dysentery, gonococcus and meningococcus infection.

The ED pathway, i.e. intracellular entry from glucoseForming glucose-6-phosphate (G-6-P) after phosphorylation, catalyzing by G-6-P deoxyenzyme to generate 6-phosphogluconic acid, and then generating by 6-phosphogluconate dehydratase (G-6-P)eddGene coding) to produce 2-keto-3-deoxy-6-phosphogluconic acid (KDPG) followed by aldolase (KDPG)edaGene-encoded) to catalyze the production of pyruvate. This pathway is mainly present in certain microorganisms lacking the entire EMP pathway, and is unique to the microorganism as an alternative pathway to the EMP pathway. Is characterized in that the glucose can quickly obtain the pyruvic acid which can be formed by the EMP route through 10 steps of reactions only through 4 steps of reactions. The energy production level of the ED path is low, and only 1 molecule of ATP and 1 molecule of NADH are obtained when 1 molecule of glucose is decomposed into 2 molecules of pyruvic acid. The bacteria having ED pathway include Escherichia coli, zymomonas mobilis, pseudomonas saccharophila, pseudomonas aeruginosa, pseudomonas fluorescens, pseudomonas linnaeus, alcaligenes eutrophus, etc. Whereas bacillus licheniformis does not have an ED pathway.

Bacitracin is synthesized by non-ribosomal synthetase using amino acids as precursor substances. In terms of strategies for increasing the production of bacitracin from B.licheniformis, current research has focused primarily on increasing the production of bacitracin by increasing the supply of several precursor amino acids of bacitracin. And, at present, has not been concerned witheddThe related report of the relationship between the gene and bacitracin production, meanwhile, the Bacillus licheniformis has a lot of genes closely related to the synthesis of strain metabolites, the yield of bacitracin is still unknown related to which gene, and the engineering bacteria for obtaining high yield bacitracin by which gene modification mode is needed to be further researched.

Disclosure of Invention

The invention aims to provide a bacillus licheniformis for exogenously introducing edd gene for producing bacitracin (Latin name:Bacillus licheniformis) The coding gene of 6-phosphogluconate dehydratase is introduced into the genome of Bacillus licheniformis at internal and external sourceseddThereby achieving the purpose of improving the yield of bacitracin.

Exogenously introduced edd gene bacillus licheniformis for producing bacitracinThe bacillus is: the existing method for introducing exogenous gene into host cell is adopted to introduce exogenous gene into host celleddThe gene is introduced into a recombinant strain obtained from original bacillus licheniformis through an overexpression plasmid; the original bacillus licheniformis is bacillus licheniformis for producing bacitracin.

The application is carried out for the first time by overexpression in the original Bacillus licheniformiseddThe gene is used for improving the yield of bacitracin, and provides a new strategy for improving the yield of bacitracin. Compared with the original bacillus licheniformis, the bacillus peptide yield of the recombinant strain constructed by the invention is greatly improved. The research result of the invention shows that: by overexpressioneddThe gene is a very effective method for improving the yield of bacitracin.

Preferably, theeddThe nucleotide Sequence of the gene is shown in Sequence Listing 1.0.

Preferably, the original bacillus licheniformis is bacillus licheniformis DW2 (C) ((C))Bacillus licheniformis DW 2), wherein the original Bacillus licheniformis DW2 is preserved in China center for type culture Collection in Wuhan in 2011, 10 months and 12 days, and the preservation number is CCTCC NO: m2011344. Preferably, the overexpression plasmid adopts an overexpression plasmid pHY300PLK. The over-expression plasmid pHY300PLK is not only mature in application, but also belongs to a prokaryotic cell expression vector, and the vector has strong replication capacity, can meet the requirement of being transmitted to a newborn daughter cell along with cytoplasm during host cell division, and can ensure thateddStable expression of the gene.

Preferably, the edd gene introduced from the outside of Bacillus licheniformis is used for producing bacitracin by fermentation, which comprises the following steps: 30 to 50 g/l of corn starch, 50 to 100 g/l of soybean meal, 0.5 to 2 g/l of ammonium sulfate, 4 to 8 g/l of calcium carbonate and the balance of water. The formula of the culture medium is suitable for bacillus licheniformis to produce bacitracin.

Preferably, the construction method of the bacillus licheniformis for exogenously introducing the edd gene comprises the following steps:

(1) For obtaining external sourceseddA gene fragment;

(2) By overlappingExtend PCR willeddThe gene fragment is connected with a P43 promoter and an amylase terminator to construct a complete geneeddAn expression element;

(3) By usingEcoRI andXbai restriction enzyme paireddCarrying out double enzyme digestion on the expression element to obtain an enzyme digestion gene fragment, and simultaneously adoptingEcoRI andXbacarrying out double enzyme digestion on a plasmid pHY300PLK by using restriction endonuclease I to obtain a linear plasmid fragment;

(4) Connecting the restriction enzyme gene fragment and the linear plasmid fragment obtained in the step (3) by DNA ligase to obtain an enzyme-linked product, transferring the enzyme-linked product into Escherichia coli DH5 alpha, taking ampicillin as a resistance selection marker, obtaining a positive transformant by colony PCR, and obtaining an over-expression plasmid pHY-edd；

(5) The over-expression plasmid pHY-eddTransferring into Bacillus licheniformis DW2, screening to obtain positive transformant, i.e. recombinant strain Bacillus licheniformis DW2/pHY-edd。

Drawings

FIG. 1 shows a result obtained in step (1) of example 1eddGene fragment and P43 promoter, amylase terminator and of step (2)eddAgarose gel image of the expression element, lane 1eddExpression elements, lane 2eddGene fragment, amylase terminator TamyL in lane 3, P43 promoter in lane 4, and DNA marker in lane 5;

FIG. 2 is the overexpression plasmid pHY-eddThe colony PCR verification plot was performed, wherein lane 1 is the overexpression plasmid pHY-eddA band for colony PCR validation, lane 2 DNA marker;

FIG. 3 is a diagram showing colony PCR verification of positive transformants obtained in step (5) of example 1,

wherein, lane 1 is the band for colony PCR verification of positive transformants, lane 2 is DNA marker;

wherein, the corresponding molecular weights of the bands from top to bottom in the DNA marker lane in any of the above-mentioned FIGS. 1 to 3 are: 5000 bp,3000 bp,2000 bp,1500 bp,1000 bp,750bp,500 bp,250 bp and 100 bp.

Detailed Description

Embodiments of the invention will now be described in detail with reference to the accompanying drawings:

exogenously introduced edd gene bacillus licheniformis for producing bacitracin, wherein the exogenously introduced edd gene bacillus licheniformis is: the existing method for introducing exogenous gene into host cell is adopted to introduce exogenous gene into host celleddThe gene is introduced into a recombinant strain obtained from original bacillus licheniformis through an overexpression plasmid; the original bacillus licheniformis is bacillus licheniformis for producing bacitracin.

The specific construction method of the exogenously introduced edd gene bacillus licheniformis provided by the invention comprises the following steps:

1. the specific operation steps of the step (1) are as follows:

according to Escherichia coli str, K-12 substr MG1655 (Escherichia colistr, K-12 substr. MG 1655) in the genomic DNA sequenceeddGene sequence, design of GeneeddUpstream primer of gene: (edd-F) and a downstream primer: (A)edd-R); and are provided withEscherichia coli Genomic DNA of str, K-12 substr MG1655 as templates, respectivelyeddThe upstream primer and the downstream primer of the gene are obtained by PCR amplificationeddGene fragment (1812 bp);

wherein, the first and the second end of the pipe are connected with each other,edd-F andedd-the sequence of R is:

edd-F: TAAGAGAGGAATGTACACATGAATCCACAATTGTTACGCG

edd-R: TCCGTCCTCTCTGCTCTTTTAAAAAGTGATACAGGTTGCG；

2. the specific operation steps of the step (2) are as follows:

taking the genome DNA of Bacillus subtilis 168 as a template, and carrying out PCR amplification to obtain a P43 promoter (the primers are P43-F and P43-R); taking genome DNA of Bacillus licheniformis WX-02 as a template, performing PCR amplification to obtain amylase terminators (primers are TamyL-F and TamyL-R), and then performing amplification on the promoter and the target gene (namely the gene obtained by the amplification in the step (1))eddGene fragment) and terminatorJoined together by SOE-PCR (primers P43-F and TamyL-R used) to form a completeeddExpression element (2618 bp); wherein the sequences of P43-F, P43-R, tamyL-F and TamyL-R are as follows:

P43-F: GCGAATTCTGATAGGTGGTATGTTTTCGCT

P43-R: GAAATGAACCATAGGGTGTCATGTGTACATTCCTCTCTTACCTA

TamyL-F: CTCAGGGAAACTAATACACTAAAAGAGCAGAGAGGACGGATTTC

TamyL-R: GGTCTAGACGCAATAATGCCGTCGCACTGG；

3. the specific operation steps of the step (3) are as follows:

by usingEcoRI andXbai restriction enzyme paireddCarrying out double enzyme digestion on the gene fragment to obtain an enzyme-digested gene fragmentedd(2613 bp) and, at the same time, plasmid pHY300PLK (purchased from Takara Co., ltd.) was prepared and usedEcoRI andXbacarrying out double enzyme digestion on a plasmid pHY300PLK by using a restriction endonuclease I to obtain a linear plasmid fragment (4870 bp); wherein, the restriction endonucleaseEcoRI andXbathe I restriction enzymes are purchased from Beijing Quanjin Biotechnology GmbH;

4. the specific operation steps of the step (4) are as follows:

connecting the enzyme-digested gene fragment and the linear plasmid fragment by using DNA ligase (commercially available DNA ligase can be used, and generally T4 DNA ligase) to obtain a ligation product; the ligation product is transferred into Escherichia coli DH5 alpha by calcium chloride transformation method, screening is carried out by a culture medium containing kanamycin resistance under the condition of 37 ℃, a transformant is obtained by screening, and colony PCR verification is carried out on the selected plasmid of the transformant (the used primers are pHY-F and pHY-R). If the PCR verification result of the transformant is as follows: an electrophoresis band appears at 2884 bp, which indicates that the over-expression construction is successful, and the transformant is a positive transformant (named as an over-expression vector pHY-edd)；

pHY-F：GTTTATTATCCATACCCTTAC

pHY-R：CAGATTTCGTGATGCTTGTC；

5. The specific operation steps of the step (5) are as follows:

the overexpression vector pHY-eddTransferring into Bacillus licheniformis DW2 by electric shock transformation, screening in tetracycline resistant culture medium (common bacterial culture medium can be used, usually LB culture medium) at 37 deg.C, screening to obtain transformant, and performing colony PCR verification on the transformant plasmid (primers: pHY-F and pHY-R). If the PCR verification result of the transformant is: an electrophoretic band appeared at 2884 bp (as shown in FIG. 3), demonstrating that: overexpression vector pHY-eddSuccessfully transferred into Bacillus licheniformis DW2, and the transformant is a positive transformant, namely an overexpression vector pHY-eddThe Bacillus licheniformis DW2 is named as Bacillus licheniformis DW2/pHY-edd。

The 6-phosphogluconate dehydratase coding geneeddPublished in the gene bank of NCBI, the national center for Biotechnology information. For obtaining external sourceseddThe mode of gene fragment may be: using genome DNA of Escherichia coli (such as Escherichia coli str. K-12 substr. MG 1655) as template, and performing PCR amplification to obtain the final product; the following steps are also possible: obtained by a manual synthesis method; and so on. Of course,eddthe gene segment can also be derived from microorganisms with ED path, such as zymomonas mobilis, pseudomonas saccharophila, pseudomonas aeruginosa, pseudomonas fluorescens, pseudomonas linnaeus, alcaligenes eutrophus and the like,eddthe gene fragments are derived from different strains, and the obtained gene fragmentseddThe nucleotide sequence of the gene fragment may differ from base to base, but from these different sourceseddThe gene fragments should have substantially the same function (encoding the functions of 6-phosphogluconate dehydratase and KDPG aldolase).

The original bacillus licheniformis is not limited to bacillus licheniformis DW2, and can also be wild bacillus licheniformis which is obtained by screening from the nature and produces bacitracin, or artificially modified bacillus licheniformis which produces bacitracin.

The source strain of the amylase terminator is not limited to the bacillus licheniformis WX-02, and can be all bio-safe microbial strains with the amylase terminator; similarly, the source strain of the P43 promoter is not limited to Bacillus subtilis 168 described above, and may be any biologically safe microorganism strain having the P43 promoter.

The bacillus licheniformis DW2 is preserved in China center for type culture Collection in Wuhan in 2011, 10 months and 12 days, and the preservation number is CCTCC NO: m2011344.

SaideddThe gene is derived fromEscherichia colistrain MG1655, the nucleotide Sequence of which is shown in Sequence Listing 1.0.

The exogenously introduced edd gene Bacillus licheniformis-Bacillus licheniformis DW2/pHY-eddThe specific steps for the fermentative production of bacitracin are:

1) The seed liquid is obtained by the following specific steps: firstly, bacillus licheniformis DW2/pHY-eddActivating, namely inoculating 1 percent of the strain in volume percentage from a glycerol tube into an LB culture medium filled with 5ml, culturing for 12 hours at the temperature of 37 ℃ at 230r/min, then inoculating the activated strain liquid into a seed culture medium at the volume percentage according to the inoculation amount of 1 percent, and culturing for 12 hours at the temperature of 37 ℃ at 230r/min to obtain the strain liquid for seed culture;

the formula of the seed culture medium is LB (10 g/l peptone, 5 g/l yeast powder, 10 g/l sodium chloride, pH 7.2);

2) 20ml of fermentation media with different formulas are filled into a 250ml triangular flask (the specific formula is shown in table 1, the pH of the fermentation media in table 1 is natural, and the natural pH refers to: acid or alkali is not needed to be added for adjusting the pH, the pH of the fermentation medium is completely determined by the components of the formula), then the bacterial liquid cultured by the seeds is inoculated according to the inoculation amount of 3 percent (volume percentage), the rotating speed is 230r/min, the temperature is 37 ℃, and the fermentation culture is carried out for 28 hours, thus obtaining the microbial liquid.

The specific steps of seed fermentation and production fermentation are the prior art. Bacillus licheniformis DW2 (named as Bacillus licheniformis DW2/pHY 300) transferred into unloaded pHY300PLK is used as a control group for producing bacitracin by fermentation in the same way.

The method adopts High Performance Liquid Chromatography (HPLC) to measure bacitracin yield, and comprises the following specific steps: placing the fermentation liquor in a 10 mL centrifugal tube, centrifuging at 3000 r/min for 10 min, and taking supernatant. Precisely measuring 5mL of supernatant in a 25 mL volumetric flask, diluting to constant volume with 50% ethanol solution, stirring for 5 min on a magnetic stirrer, centrifuging for 5 min at 10000 r/min, collecting supernatant, filtering with 0.22 μm water-based microporous membrane, and measuring the filtrate by HPLC. The yield of bacitracin in the broth of the production fermentation was calculated according to HPLC method (see Table 2).

TABLE 1

TABLE 2

As can be seen from Table 2, under the same fermentation conditions, the Bacillus licheniformis DW2/pHY-eddThe yield of bacitracin in the fermented bacterial liquid is greatly improved (by more than 15%) compared with that of the control bacteria, which indicates that: the technical scheme of the invention has great application value in the aspect of improving the yield of the bacillus licheniformis peptide.

Sequence listing

<110> Lvkang Biochemical Co., ltd

<120> exogenous introduction edd gene bacillus licheniformis for producing bacitracin and application

<130> DS-P20594

<141> 2020-12-03

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1812

<212> DNA

<213> Escherichia coli str. K-12 substr. MG1655 (Escherichia coli str. K-12 substr. MG 1655)

<400> 1

atgaatccac aattgttacg cgtaacaaat cgaatcattg aacgttcgcg cgagactcgc 60

tctgcttatc tcgcccggat agaacaagcg aaaacttcga ccgttcatcg ttcgcagttg 120

gcatgcggta acctggcaca cggtttcgct gcctgccagc cagaagacaa agcctctttg 180

aaaagcatgt tgcgtaacaa tatcgccatc atcacctcct ataacgacat gctctccgcg 240

caccagcctt atgaacacta tccagaaatc attcgtaaag ccctgcatga agcgaatgcg 300

gttggtcagg ttgcgggcgg tgttccggcg atgtgtgatg gtgtcaccca ggggcaggat 360

ggaatggaat tgtcgctgct aagccgcgaa gtgatagcga tgtctgcggc ggtggggctg 420

tcccataaca tgtttgatgg tgctctgttc ctcggtgtgt gcgacaagat tgtcccgggt 480

ctgacgatgg cagccctgtc gtttggtcat ttgcctgcgg tgtttgtgcc gtctggaccg 540

atggcaagcg gtttgccaaa taaagaaaaa gtgcgtattc gccagcttta tgccgaaggt 600

aaagtggacc gcatggcctt actggagtca gaagccgcgt cttaccatgc gccgggaaca 660

tgtactttct acggtactgc caacaccaac cagatggtgg tggagtttat ggggatgcag 720

ttgccaggct cttcttttgt tcatccggat tctccgctgc gcgatgcttt gaccgccgca 780

gctgcgcgtc aggttacacg catgaccggt aatggtaatg aatggatgcc gatcggtaag 840

atgatcgatg agaaagtggt ggtgaacggt atcgttgcac tgctggcgac cggtggttcc 900

actaaccaca ccatgcacct ggtggcgatg gcgcgcgcgg ccggtattca gattaactgg 960

gatgacttct ctgacctttc tgatgttgta ccgctgatgg cacgtctcta cccgaacggt 1020

ccggccgata ttaaccactt ccaggcggca ggtggcgtac cggttctggt gcgtgaactg 1080

ctcaaagcag gcctgctgca tgaagatgtc aatacggtgg caggttttgg tctgtctcgt 1140

tatacccttg aaccatggct gaataatggt gaactggact ggcgggaagg ggcggaaaaa 1200

tcactcgaca gcaatgtgat cgcttccttc gaacaacctt tctctcatca tggtgggaca 1260

aaagtgttaa gcggtaacct gggccgtgcg gttatgaaaa cctctgccgt gccggttgag 1320

aaccaggtga ttgaagcgcc agcggttgtt tttgaaagcc agcatgacgt tatgccggcc 1380

tttgaagcgg gtttgctgga ccgcgattgt gtcgttgttg tccgtcatca ggggccaaaa 1440

gcgaacggaa tgccagaatt acataaactc atgccgccac ttggtgtatt attggaccgg 1500

tgtttcaaaa ttgcgttagt taccgatgga cgactctccg gcgcttcagg taaagtgccg 1560

tcagctatcc acgtaacacc agaagcctac gatggcgggc tgctggcaaa agtgcgcgac 1620

ggggacatca ttcgtgtgaa tggacagaca ggcgaactga cgctgctggt agacgaagcg 1680

gaactggctg ctcgcgaacc gcacattcct gacctgagcg cgtcacgcgt gggaacagga 1740

cgtgaattat tcagcgcctt gcgtgaaaaa ctgtccggtg ccgaacaggg cgcaacctgt 1800

atcacttttt aa 1812

Claims (5)

1. Exogenously introduced edd gene bacillus licheniformis for bacitracin production, wherein the exogenously introduced edd gene bacillus licheniformis is: the existing method for introducing exogenous gene into host cell is adopted to introduce exogenous gene into host celleddThe gene is introduced into the original bacillus licheniformis through an overexpression plasmid to obtain a recombinant strain; the original bacillus licheniformis is bacillus licheniformis for producing bacitracin; wherein saideddThe nucleotide Sequence of the gene is shown in Sequence Listing 1.0; the original bacillus licheniformis is bacillus licheniformis DW2 (DW 2)Bacillus licheniformis DW 2), wherein the original Bacillus licheniformis DW2 is preserved in China center for type culture Collection in Wuhan in 2011, 10 months and 12 days, and the preservation number is CCTCC NO: m2011344.

2. The exogenously introduced edd gene bacillus licheniformis for producing bacitracin according to claim 1, characterized in that the overexpression plasmid employs the overexpression plasmid phyy 300PLK.

3. The exogenously introduced edd gene bacillus licheniformis for bacitracin production according to any of the claims 1 or 2, characterized in that the exogenously introduced edd gene bacillus licheniformis is used for fermentative production of bacitracin.

4. The exogenously introduced edd gene bacillus licheniformis for bacitracin production according to claim 3 comprising fermentation culture with the following medium formulation: 30 to 50 g/l of corn starch, 50 to 100 g/l of soybean meal, 0.5 to 2 g/l of ammonium sulfate, 4 to 8 g/l of calcium carbonate and the balance of water.

5. The exogenously introduced edd gene bacillus licheniformis for bacitracin production according to claim 1, wherein the exogenously introduced edd gene bacillus licheniformis is constructed by the method comprising the steps of:

(1) For obtaining external sourceseddA gene fragment;

(2) By overlap extension PCReddThe gene fragment is connected with a P43 promoter and an amylase terminator to construct a complete gene fragmenteddAn expression element;

(3) By usingEcoRI andXbai restriction enzyme paireddCarrying out double enzyme digestion on the expression element to obtain an enzyme digestion gene fragment, and simultaneously adoptingEcoRI andXbai, carrying out double enzyme digestion on the plasmid pHY300PLK by using restriction endonuclease to obtain a linear plasmid fragment;

(4) Connecting the enzyme digestion gene fragment and the linear plasmid fragment obtained in the step (3) by DNA ligase to obtain an enzyme linked product, transferring the enzyme linked product into Escherichia coli DH5 alpha, using ampicillin as a resistance screening marker, obtaining a positive transformant by colony PCR, and obtaining an over-expression plasmid pHY-edd；

(5) The over-expression plasmid pHY-eddTransferring into Bacillus licheniformis DW2, screening to obtain positive transformant, i.e. recombinant strain Bacillus licheniformis DW2/pHY-edd。

Images