CN113817762A - Recombinant escherichia coli for producing pentamethylene diamine and application thereof - Google Patents

Recombinant escherichia coli for producing pentamethylene diamine and application thereof Download PDF

Info

Publication number
CN113817762A
CN113817762A CN202111110911.6A CN202111110911A CN113817762A CN 113817762 A CN113817762 A CN 113817762A CN 202111110911 A CN202111110911 A CN 202111110911A CN 113817762 A CN113817762 A CN 113817762A
Authority
CN
China
Prior art keywords
gene
escherichia coli
plasmid
cada
recombinant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202111110911.6A
Other languages
Chinese (zh)
Other versions
CN113817762B (en
Inventor
王昕�
廖杨
陈可泉
王静
朱强强
王静雯
徐双
欧阳平凯
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing Tech University
Original Assignee
Nanjing Tech University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing Tech University filed Critical Nanjing Tech University
Priority to CN202111110911.6A priority Critical patent/CN113817762B/en
Publication of CN113817762A publication Critical patent/CN113817762A/en
Application granted granted Critical
Publication of CN113817762B publication Critical patent/CN113817762B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C07K14/245—Escherichia (G)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/001—Amines; Imines
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/01—Phosphotransferases with an alcohol group as acceptor (2.7.1)
    • C12Y207/01018—Phosphoribokinase (2.7.1.18)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/01—Carboxy-lyases (4.1.1)
    • C12Y401/01018—Lysine decarboxylase (4.1.1.18)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/01—Carboxy-lyases (4.1.1)
    • C12Y401/01039—Ribulose-bisphosphate carboxylase (4.1.1.39)
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The invention discloses recombinant escherichia coli for producing pentamethylene diamine and application thereof. The invention synthesizes ribulose diphosphate carboxylase gene in rhodospirillum, phosphoribosyl kinase gene and lysine decarboxylase gene in spinach from head, copies escherichia coli molecular chaperone gene by PCR, constructs plasmid pTrc99a-cadA-cbbM and plasmid pCWJ-prkA-GroEL/GroES, and the double-plasmid recombinant bacteria grow well in a specific culture medium, and the glucose is efficiently utilized. The induction agents arabinose and IPTG are respectively added in different time periods, the heterologous gene expression is stable, the reaction system is simple, the condition is mild, the period is short, the byproducts are few, the method is clean and pollution-free, the method is a simple, rapid and efficient production way, and the fermentation result shows that the yield of the recombinant Escherichia coli KACCPG is obviously improved.

Description

Recombinant escherichia coli for producing pentamethylene diamine and application thereof
Technical Field
The invention belongs to the field of preparation of pentamethylene diamine, and particularly relates to recombinant escherichia coli for producing pentamethylene diamine and application thereof.
Background
The industrial production has been achieved by modifying bacteria of the genus Corynebacterium and Escherichia having the ability to produce L-lysine by DNA recombination technology. Lysine decarboxylase can remove one carboxyl group from L-lysine to generate 1, 5-pentanediamine and CO2. For example, in e.coli, 1, 5-pentanediamine is directly biosynthesized from L-lysine by two lysine decarboxylase polypeptides, CadA and LdcC. The 1, 5-pentanediamine is used as an important chemical intermediate, is used for preparing various novel materials and high polymers, and has high application value in industrial production.
However, in the current route for producing 1, 5-pentanediamine by L-lysine fermentation, the yield of 1, 5-pentanediamine is limited and low, and CO generated in the process of biologically producing the pentanediamine2Not only greatly reduces the atom economy of the product, but also increases the pollution to the environment. Therefore, there is a need to develop a method for producing pentamethylene diamine (cadaverine) with higher yield.
Research shows that the ribulose diphosphate carboxylase gene cbbM and the phosphoribosyl kinase gene prkA of the Karlvin circulation pathway are expressed in escherichia coli in a heterologous mode, so that the growth of engineering bacteria can be promoted, and the yield can be improved.
Disclosure of Invention
Aiming at the defects of the prior art, the invention aims to provide the recombinant escherichia coli for producing the pentamethylene diamine and the application thereof.
A recombinant Escherichia coli for producing pentamethylene diamine comprises the following steps:
step 1, synthesizing a lysine decarboxylase gene cadA, and constructing a plasmid pTrc99 a-cadA; synthesizing a ribulose diphosphate carboxylase gene cbbM, connecting the ribulose diphosphate carboxylase gene cbbM with a plasmid pTrc99a-cadA to obtain a plasmid pTrc99a-cadA-cbbM, finally transferring the plasmid pTrc 99-cadA-cbbM into a cloning vector Trans1-T1, primarily screening by an LB (Langmuir-Blodgett) flat plate, selecting a single colony growing on the flat plate for PCR (polymerase chain reaction) verification, and then sending a positive strain to test;
step 2, synthesizing phosphoribosyl kinase gene prkA, and constructing plasmid pCWJ-prkA; then, taking commercial plasmid pGRO7 as a source, copying escherichia coli molecular chaperone gene GroEL/GroES, connecting the molecular chaperone gene GroEL/GroES with plasmid pCWJ-prkA to obtain plasmid pCWJ-prkA-GroEL/GroES, finally transferring into a cloning vector Trans1-T1, primarily screening by an LB plate, selecting a single colony growing on the plate for PCR verification, and sending a positive strain to test;
step 3, transferring the recombinant plasmids pTrc99a-cadA-cbbM and pCWJ-prkA-GroEL/GroES into Escherichia coli KA30 with high lysine yield to obtain recombinant Escherichia coli KACCPG; the nucleotide sequence of the gene cadA is shown as SEQ NO. 1; the nucleotide sequence of the gene cbbM is shown as SEQ NO. 2; the nucleotide sequence of the gene prkA is shown in SEQ NO. 3; the nucleotide sequence of the gene GroEL/GroES is shown in SEQ NO. 4.
As an improvement, the upstream primer of the cadA gene in the primer is provided withNdeICleavage site, downstream primer withBamHIA restriction enzyme site; cbbM geneThe upstream primer hasBamHICleavage site, downstream primer withHindIII enzyme digestionA site.
As an improvement, the upstream primer of the synthetic prkA gene is provided withNcoICleavage site, downstream primer withEcoRIA restriction enzyme site; the GroEL/GroES gene was ligated to the vector by homologous recombination.
The improvement is that pTrc99a-cadA-cbbM and pCWJ-prkA-GroEL/GroES double plasmids are transferred into Escherichia coli KA30 with high lysine yield by a chemical method to obtain the recombinant Escherichia coli KACCPG.
All the sites are single enzyme cutting sites in the target gene and the vector, and the price is low, thereby being beneficial to industrialization and cost reduction.
The application of the recombinant Escherichia coli KACCPG in synthesizing pentanediamine.
The application steps are as follows, the recombinant Escherichia coli KACCPG is inoculated into a culture medium containing Amp and CmR, the culture is carried out for 60 h under the conditions of 37 ℃ and 200 rpm, and then the fermentation liquor is centrifuged to take the supernatant fluid, thus obtaining the target product pentanediamine.
As a modification, the speed of the centrifugation is 12000 rpm, and the centrifugation time is 2 min.
As an improvement, the specific steps for culturing the recombinant Escherichia coli KACCPG are as follows: shake tube to culture first seed liquid to OD600When the temperature is 0.8-1, switching to a secondary seed shake flask, and controlling the initial OD6000.1, OD was cultured6004-5, transferring to a fermentation liquor shake flask, and controlling initial fermentation OD6000.05, adding an inducer arabinose to a final concentration of 30 mM at the beginning of fermentation, carrying out induction culture at 37 ℃ for 12 h, then adding IPTG to a final concentration of 0.5-1 per mill, and carrying out induction culture at 37 ℃ for 48 h.
The design principle is as follows:
it has been reported in the literature that heterologous expression of ribulose diphosphate carboxylase and phosphoribosyl kinase in calvin cycle in escherichia coli can improve glucose utilization rate of bacterial cells and promote growth of bacterial cells. This pathway was now constructed in E.coli producing pentamethylene diamine to obtain more pentamethylene diamine than the original yield.
Has the advantages that:
compared with the prior art, the recombinant escherichia coli for producing the pentamethylene diamine and the application thereof have the following specific advantages:
1. the method for producing the pentanediamine has the advantages that the heterogenous route has the promotion effect on the growth of engineering bacteria and the final OD600Higher than the original strain.
2. The recombinant strain has good heterologous gene expression, sectional induction promotes correct folding of enzyme protein, and the content of the end product pentanediamine is improved to a certain extent compared with that of a control group.
3. The cell catalytic reaction process is mild and harmless to the environment, equipment and operators.
Drawings
FIG. 1 is a metabolic scheme of the recombinant strain KACCPG.
FIG. 2 is a physical diagram of the plate growth pattern of the recombinant strain KACCPG.
FIG. 3 is a graph comparing the growth of different strains.
FIG. 4 is a graph comparing the amounts of pentamethylenediamine produced by different strains under the same conditions.
Detailed Description
The present invention is further described in the following description of the specific embodiments, which is not intended to limit the invention, but various modifications and improvements can be made by those skilled in the art according to the basic idea of the invention, within the scope of the invention, as long as they do not depart from the basic idea of the invention.
The techniques not mentioned in the examples are conventional in the art, and the materials used in Escherichia coli Trans1-T1, pTrc99a, pCWJ, pGRO7, etc. are commercial products and can be purchased directly.
Example 1 construction of pTrc99a-cadA-cbbM recombinant plasmid
Synthesizing a lysine decarboxylase gene cadA, wherein the nucleotide coding sequence is shown as SEQ NO. 1:
ATGAACGTTATTGCAATATTGAATCACATGGGGGTTTATTTTAAAGAAGAACCCATCCGTGAACTTCATCGCGCGCTTGAACGTCTGAACTTCCAGATTGTTTACCCGAACGACCGTGACGACTTATTAAAACTGATCGAAAACAATGCGCGTCTGTGCGGCGTTATTTTTGACTGGGATAAATATAATCTCGAGCTGTGCGAAGAAATTAGCAAAATGAACGAGAACCTGCCGTTGTACGCGTTCGCTAATACGTATTCCACTCTCGATGTAAGCCTGAATGACCTGCGTTTACAGATTAGCTTCTTTGAATATGCGCTGGGTGCTGCTGAAGATATTGCTAATAAGATCAAGCAGACCACTGACGAATATATCAACACTATTCTGCCTCCGCTGACTAAAGCACTGTTTAAATATGTTCGTGAAGGTAAATATACTTTCTGTACTCCTGGTCACATGGGCGGTACTGCATTCCAGAAAAGCCCGGTAGGTAGCCTGTTCTATGATTTCTTTGGTCCGAATACCATGAAATCTGATATTTCCATTTCAGTATCTGAACTGGGTTCTCTGCTGGATCACAGTGGTCCACACAAAGAAGCAGAACAGTATATCGCTCGCGTCTTTAACGCAGACCGCAGCTACATGGTGACCAACGGTACTTCCACTGCGAACAAAATTGTTGGTATGTACTCTGCTCCGGCAGGCAGCACCATTCTGATTGACCGTAACTGCCACAAATCGCTGACCCACCTGATGATGATGAGCGATGTTACGCCAATCTATTTCCGCCCGACCCGTAACGCTTACGGTATTCTTGGTGGTATCCCACAGAGTGAATTCCAGCACGCTACCATTGCTAAGCGCGTGAAAGAAACACCAAACGCAACCTGGCCGGTACATGCTGTAATTACCAACTCTACCTATGATGGTCTGCTGTACAACACCGACTTCATCAAGAAAACACTGGATGTGAAATCCATCCACTTTGACTCCGCGTGGGTGCCTTACACCAACTTCTCACCGATTTACGAAGGTAAATGCGGTATGAGCGGTGGCCGTGTAGAAGGGAAAGTGATTTACGAAACCCAGTCCACTCACAAACTGCTGGCGGCGTTCTCTCAGGCTTCCATGATCCACGTTAAAGGTGACGTAAACGAAGAAACCTTTAACGAAGCCTACATGATGCACACCACCACTTCTCCGCACTACGGTATCGTGGCGTCCACTGAAACCGCTGCGGCGATGATGAAGGGTAATGCTGGTAAGCGTCTGATCAACGGTTCCATTGAACGTGCGATCAAATTCCGTAAAGAGATCAAACGTCTGAGAACGGAATCTGATGGCTGGTTCTTTGATGTTTGGCAGCCGGATCATATCGATACGACTGAATGCTGGCCGCTGCGTTCTGACAGCACCTGGCACGGCTTCAAAAACATCGATAACGAGCACATGTATCTTGACCCGATCAAAGTCACCCTGCTGACTCCGGGGATGGAAAAAGACGGCACCATGAGCGACTTTGGTATTCCGGCCAGCATCGTGGCGAAATACCTCGACGAACATGGCATCGTTGTTGAGAAAACCGGTCCGTATAACCTGCTGTTCCTGTTCAGCATCGGTATCGATAAGACCAAAGCACTGAGCCTGCTGCGTGCTCTGACTGACTTCAAACGTGCGTTCGACCTGAACCTGCGTGTGAAAAACATGCTGCCGTCTCTGTATCGTGAAGATCCTGAATTCTATGAAAACATGCGTATTCAGGAACTGGCTCAAAATATCCACAAACTGATTGTTCACCACAATCTGCCGGATCTGATGTATCGCGCATTTGAAGTGCTGCCGACGATGGTAATGACTCCGTATGCTGCGTTCCAGAAAGAGCTGCACGGTATGACCGAAGAAGTTTACCTCGACGAAATGGTAGGTCGTATTAACGCCAATATGATCCTTCCGTATCCGCCGGGAGTTCCTCTGGTAATGCCGGGTGAAATGATCACCGAAGAAAGCCGTCCGGTTCTGGAGTTCCTGCAGATGCTGTGTGAAATCGGCGCTCACTATCCGGGCTTTGAAACCGATATTCACGGTGCATACCGTCAGGCTGATGGCCGCTATACCGTTAAGGTATT。
the upstream primer used hasNdeIThe sequence of the restriction enzyme site is shown as SEQ NO. 5:
CATGCCATGGGAAGGAGATATACATATGAACG
the downstream primer hasBamHIThe sequence of the restriction enzyme site is shown as SEQ NO. 6:
CGCGGATCCAGGGTACCTTAGTGGTGGTGGTGGTGGTGTTTTTTGCTTTC
the reaction conditions are as follows: 30 cycles of 95 ℃ for 2 min, 95 ℃ for 20 s, 50 ℃ for 20 s, and 72 ℃ for 30 s; 5 min at 72 ℃. The resulting sequence was electrophoresed through a 1% agarose gel and the corresponding fragment was recovered. The sequence and expression vector pTrc99a were obtained from TakaraNdeIAndBamHIenzyme digestion, wherein the enzyme digestion reaction system is as follows: 10 × 1 μ L of buffer, NdeI 1 μL，BamHI1 μ L, gene fragment or pTrc99a vector 7 μ L. Reacting the enzyme digestion system at 37 ℃ for 1 h, and connecting enzyme digestion products, wherein the reaction system is as follows: 10 XLigase buffer 1. mu.L, T4 DNA Ligase (Takara) 1. mu.L, gene fragment 7. mu.L, vector 1. mu.L. The reaction was carried out at 25 ℃ for 3 hours. The ligation product was transformed into E.coli Trans 1-T1. Positive strain Trans1-T1-pTrc99a-cadA is screened by PCR, DNA sequencing is carried out, and the construction of the recombinant plasmid is verified to be correct.
The positive strain Trans1-T1-pTrc99a-cadA was inoculated into 5 ml LB/Amp liquid medium composed of peptone 10 g/L, yeast powder 5 g/L, sodium chloride 5 g/L, and cultured with shaking at 37 ℃ and 200 rpm overnight. After 24 h, the plasmid pTrc99a-cadA was extracted according to the instructions of the Tiangen plasmid extraction kit.
The ribulose diphosphate carboxylase coding gene cbbM of the rhodospirillum is found by NCBI and sent to the Scophiosphaera sp.
gagctcaacaaccagggcatgggcgatgtggaatatgcaaaaatgcatgaattttatgtgccggaagcatatcgcgcactgtttgatggtccgtccgtgaatattagcgcactgtggaaagtgctgggtcgtccggaagttgatggtggtctggttgttggtaccattattaaaccgaaactgggtctgcgtccgaaaccgtttgcagaagcgtgtcatgccttttggctgggtggtgattttattaaaaatgatgaaccgcagggtaatcagccgtttgcaccgctgcgtgatacaattgcactggttgccgatgcaatgcgtcgtgcacaggatgaaaccggtgaagcaaaactgtttagcgcaaacattaccgcagatgatccgtttgaaattattgcacgtggtgaatatgtgctggaaacctttggtgaaaacgcaagccatgttgcgtttctggttgatggttatgttgcaggtgcagcggcaattacaaccgcacgtcgtcgttttccggataattttctgcattatcatcgtgcaggtcatggtgcagttacgagcccgcagaccaaacgtggttataccgcgtttgttcattgtaaaatggcacgtctgcagggtgcatctggtattcataccggtaccatgggttttggtaaaatggaaggtgaaagctctgatcgtgccattgcctatatgctgacccaggatgaagcgcagggtccgttttatcgtcagagttggggtggtatgaaagcatgtaccccgCACCACCACCACCACCACtaaAAGCTT；
Then the plasmid pTrc99a-cadA is connected with the enzyme by the conventional enzyme digestion and enzyme connection method.
The upstream primer used hasBamHIThe sequence of the restriction enzyme site is shown as SEQ NO. 7:
CGCGGATCCaggaaacagaccatggaattcg
the downstream primer hasHindIIIThe sequence of the restriction enzyme site is shown as SEQ NO. 8:
CCCAAGCTTttaGTGGTGGTGGTGGTGGTGcggggtacatgctttcata
the sequence was ligated with the existing plasmid pTrc99a-cadA by TakaraBamHIAndHindIIIenzyme digestion, wherein the enzyme digestion reaction system is as follows: 10 × 1 μ L of buffer, BamHI 1 μL，HindIII1 μ L, gene fragment or plasmid pTrc99a-cadA 7 μ L. The enzyme was reacted at 37 ℃ for 1 hour. Connecting the enzyme digestion products, wherein the reaction system is as follows: 10 XLigase buffer 1. mu.L, T4 DNA Ligase (Takara) 1. mu.L, gene fragment 7. mu.L, vector 1. mu.L. The ligation product was transformed into E.coli Trans 1-T1. Positive strain Trans1-T1-pTrc99a-cadA-cbbM is screened by PCR, DNA sequencing is carried out, and the construction of recombinant plasmid is verified to be correct.
The positive strain Trans1-T1-pTrc99a-cadA-cbbM was inoculated into 5 ml LB/Amp liquid medium consisting of peptone 10 g/L, yeast powder 5 g/L, sodium chloride 5 g/L, and cultured with shaking at 37 ℃ and 200 rpm overnight. After 24 h, the plasmid pTrc99a-cadA-cbbM was extracted according to the protocol of the Tiangen plasmid extraction kit.
Example 2 construction of pCWJ-prkA-GroEL/GroES recombinant plasmid
The phosphoribosyl kinase gene prkA of spinach is found by NCBI and is sent to a Protecoraceae biological company for synthesis, and the sequence is shown as SEQ number 3:
atggcagtttgtaccgtttatacgattccgaccaccacccatctgggcagcagctttaatcagaataacaaacaggttttttttaactataaacgtagcagcagcagcaacaacaccctgtttaccacccgcccgagctatgttattacctgtagccagcagcagaccattgttatcggtctggccgcagattctggttgtggtaaaagcacctttatgcgtcgtctgacctccgtttttggcggcgcagcagaaccgccgaaaggcggtaatccggatagcaacaccctgattagcgataccaccaccgttatttgtctggatgattttcattcactggatcgtaacggtcgtaaagtagaaaaagttaccgcactggatcctaaagccaatgattttgatctgatgtatgaacaggttaaagccctgaaagaaggtaaagcagtggataaaccgatttataatcatgttagcggtctgctggatccgccggaactgatccagccgccgaaaattctggttattgaaggtctgcatccgatgtatgatgcacgtgtgcgtgaactgctggatttttctatctatctggatattagcaacgaagttaaatttgcctggaaaattcagcgtgatatgaaagaacgtggtcattccctggaaagcattaaagcaagtattgaaagccgtaaaccggattttgatgcatatattgatccacagaaacagcatgcagatgtggttattgaagtactgccgacagaactgattcctgatgatgatgaaggcaaagttctgcgtgttcgtatgattcagaaagaaggtgtgaaattttttaacccggtttatctgtttgatgaaggcagcaccatctcctggattccttgtggccgtaaactgacgtgtagctatcctggcattaaatttagctatggcccggataccttttatggtaatgaagttaccgttgttgaaatggatggtatgtttgatcgtctggatgaactgatttatgttgaatctcatctgagcaatctgagcacgaaattttatggtgaagttacccagcagatgctgaaacatcagaattttccgggtagcaacaatggtaccggtttttttcagaccattattggtctgaaaatccgtgatctgtttgaacagctggttgcgagccgtagcacagcaacagcaaccgcagcaaaagcc。
the upstream primer used hasNcoI The sequence of the restriction enzyme site is shown as SEQ NO. 9:
CATGCCATGGCAatggcagtttgtaccgtttat
the downstream primer hasEcoRIThe sequence of the restriction enzyme site is shown as SEQ NO. 10:
CCGGAATTCttaGTGGTGGTGGTGGTGGTGggcttttgctgcggttg
the sequence was ligated with plasmid pCWJ by TakaraNcoIAndEcoRIenzyme digestion, wherein the enzyme digestion reaction system is as follows: 10 × 1 μ L of buffer, NcoI 1 μL，EcoRI1 μ L, gene fragment or plasmid pTrc99a-cadA 7 μ L. The enzyme was reacted at 37 ℃ for 1 hour. Connecting the enzyme digestion products, wherein the reaction system is as follows: 10 XLigase buffer 1. mu.L, T4 DNA Ligase (Takara) 1. mu.L, gene fragment 7. mu.L, vector 1. mu.L. The ligation product was transformed into E.coli Trans 1-T1. Positive strain Trans1-T1-pCWJ-prkA is screened by PCR, DNA sequencing is carried out, and the construction of recombinant plasmid is verified to be correct.
The positive strain Trans1-T1-pCWJ-prkA was inoculated into 5 ml LB/CmR liquid medium consisting of peptone 10 g/L, yeast powder 5 g/L, sodium chloride 5 g/L, and shake-cultured overnight at 37 ℃ and 200 rpm. After 24 h, plasmid pCWJ-prkA was extracted according to the protocol of the Tiangen plasmid extraction kit.
A GroEL/GroES gene preservation plasmid is used as a template, and the nucleotide coding sequence of the molecular chaperone is amplified by conventional PCR, and the sequence is shown as SEQ number 4:
ATGAATATTCGTCCATTGCATGATCGCGTGATCGTCAAGCGTAAAGAAGTTGAAACTAAATCTGCTGGCGGCATCGTTCTGACCGGCTCTGCAGCGGCTAAATCCACCCGCGGCGAAGTGCTGGCTGTCGGCAATGGCCGTATCCTTGAAAATGGCGAAGTGAAGCCGCTGGATGTGAAAGTTGGCGACATCGTTATTTTCAACGATGGCTACGGTGTGAAATCTGAGAAGATCGACAATGAAGAAGTGTTGATCATGTCCGAAAGCGACATTCTGGCAATTGTTGAAGCGTAATCCGCGCACGACACTGAACATACGAATTTAAGGAATAAAGATAATGGCAGCTAAAGACGTAAAATTCGGTAACGACGCTCGTGTGAAAATGCTGCGCGGCGTAAACGTACTGGCAGATGCAGTGAAAGTTACCCTCGGTCCAAAAGGCCGTAACGTAGTTCTGGATAAATCTTTCGGTGCACCGACCATCACCAAAGATGGTGTTTCCGTTGCTCGTGAAATCGAACTGGAAGACAAGTTCGAAAATATGGGTGCGCAGATGGTGAAAGAAGTTGCCTCTAAAGCAAACGACGCTGCAGGCGACGGTACCACCACTGCAACCGTACTGGCTCAGGCTATCATCACTGAAGGTCTGAAAGCTGTTGCTGCGGGCATGAACCCGATGGACCTGAAACGTGGTATCGACAAAGCGGTTACCGCTGCAGTTGAAGAACTGAAAGCGCTGTCCGTACCATGCTCTGACTCTAAAGCGATTGCTCAGGTTGGTACCATCTCCGCTAACTCCGACGAAACCGTAGGTAAACTGATCGCTGAAGCGATGGACAAAGTCGGTAAAGAAGGCGTTATCACCGTTGAAGACGGTACCGGTCTGCAGGACGAACTGGACGTGGTTGAAGGTATGCAGTTCGACCGTGGCTACCTGTCTCCTTACTTCATCAACAAGCCGGAAACTGGCGCAGTAGAACTGGAAAGCCCGTTCATCCTGCTGGCTGACAAGAAAATCTCCAACATCCGCGAAATGCTGCCGGTTCTGGAAGCTGTTGCCAAAGCAGGCAAACCGCTGCTGATCATCGCTGAAGATGTAGAAGGCGAAGCGCTGGCAACTCTGGTTGTTAACACCATGCGTGGCATCGTGAAAGTCGCTGCGGTTAAAGCACCGGGCTTCGGCGATCGTCGTAAAGCTATGCTGCAGGATATCGCAACCCTGACTGGCGGTACCGTGATCTCTGAAGAGATCGGTATGGAGCTGGAAAAAGCAACCCTGGAAGACCTGGGTCAGGCTAAACGTGTTGTGATCAACAAAGACACCACCACTATCATCGATGGCGTGGGTGAAGAAGCTGCAATCCAGGGCCGTGTTGCTCAGATCCGTCAGCAGATTGAAGAAGCAACTTCTGACTACGACCGTGAAAAACTGCAGGAACGCGTAGCGAAACTGGCAGGCGGCGTTGCAGTTATCAAAGTGGGTGCTGCTACCGAAGTTGAAATGAAAGAGAAAAAAGCACGCGTTGAAGATGCCCTGCACGCGACCCGTGCTGCGGTAGAAGAAGGCGTGGTTGCTGGTGGTGGTGTTGCGCTGATCCGCGTAGCGTCTAAACTGGCTGACCTGCGTGGTCAGAACGAAGACCAGAACGTGGGTATCAAAGTTGCACTGCGTGCAATGGAAGCTCCGCTGCGTCAGATCGTATTGAACTGCGGCGAAGAACCGTCTGTTGTTGCTAACACCGTTAAAGGCGGCGACGGCAACTACGGTTACAACGCAGCAACCGAAGAATACGGCAACATGATCGACATGGGTATCCTGGATCCAACCAAAGTAACTCGTTCTGCTCTGCAGTACGCAGCTTCTGTGGCTGGCCTGATGATCACCACCGAATGCATGGTTACCGACCTGCCGAAAAACGATGCAGCTGACTTAGGCGCTGCTGGCGGTATGGGCGGCATGGGTGGCATGGGCGGCATGATGTAA；
this was integrated into plasmid pCWJ-prkA by homologous recombination.
The sequence of the used upstream homology arm is shown as SEQ NO. 11:
CTGCATTAGGAAATACTAGAAGTAACAGAAGTGTCTATAACTATGGCTGG
the sequence of the downstream homologous arm is shown in SEQ NO. 12:
tgattaattgtcaaACTAGTCAAGAAGATCATCTTATTAATCAGATAAATATTTCTAGATTTCAGTGCAA
the GroEL/GroES gene was ligated by homologous recombination with the plasmid pCWJ-prkA at 37 ℃ for 0.5 h, and the ligation product was transformed into E.coli Trans 1-T1. Positive strain Trans1-T1-pCWJ-prkA-GroEL/GroES was PCR-screened and DNA sequencing was performed to verify that the recombinant plasmid was constructed correctly.
The positive strain Trans1-T1-pCWJ-prkA-GroEL/GroES was inoculated into 5 ml LB/CmR liquid medium consisting of peptone 10 g/L, yeast powder 5 g/L, sodium chloride 5 g/L, and shake-cultured overnight at 37 ℃ and 200 rpm. After 24 hours, the plasmid pCWJ-prkA-GroEL/GroES was extracted according to the instructions of the Tiangen plasmid extraction kit.
EXAMPLE 3 construction and inducible expression of recombinant E.coli KACCPG
1. Construction of recombinant Escherichia coli KACCPG
The recombinant plasmids pTrc99a-cadA-cbbM and pCWJ-prkA-GroEL/GroES were transformed into E.coli KA30 producing lysine in high yield and cultured overnight for 24 h. The plate growth diagram is shown in FIG. 1.
The bacterial strain presents a round transparent colony on a solid plate added with sodium pyruvate, the edge is smooth, the bacterial strain has higher requirements on nutrient components, and the colony of the plate is smaller.
The positive strains were inoculated into 5 ml LB/Amp + CmR liquid mediumThe liquid medium consists of 10 g/L peptone, 5 g/L yeast powder and 5 g/L sodium chloride, and is subjected to shaking culture at 37 ℃ and 200 rpm overnight. When OD is reached600When the temperature is 0.6-0.8, the strains are preserved at minus 80 ℃ according to 800 mu L of 30% glycerol and 800 mu L of bacterial liquid.
2. Induced expression of recombinant Escherichia coli KACCPG
First-stage seed liquid: inoculating 10 μ L of glycerol strain to 5 ml LB/Amp + CmR liquid culture medium composed of peptone 10 g/L, yeast powder 5 g/L, and sodium chloride 5 g/L, shake culturing at 37 deg.C and 200 rpm overnight when OD is reached600Switching to the second-stage seed liquid when the temperature is 0.8-1 ℃.
Secondary seed liquid: quantitatively measuring the primary seed liquid and controlling the initial OD of the secondary seed liquid600At 0.1, the liquid medium formulation (Amp + CmR resistance) is shown in table 1 below.
TABLE 1 formulation of liquid culture Medium for second-order seed liquid
(NH4)2SO4 10 g/L Sucrose 5 g/L
Glutamic acid sodium salt 5 g/L MgSO4 .7H2O 1 g/L
Peptone 5 g/L FeSO4 .7H2O 0.032 g/L
Yeast powder 10 g/L MnSO4 .H2O 0.077 g/L
K2HPO4 0.5 g/L Methionine 0.3 g/L
Pyruvic acid sodium salt 0.55 g/L Threonine 0.3 g/L
Fermentation liquor: quantitatively measuring secondary seed liquid, and controlling initial OD of fermentation liquid600At 0.05, the liquid medium formulation (Amp + CmR resistance) is shown in table 2 below.
TABLE 2 liquid culture Medium formulation of fermentation broth
(NH4)2SO4 10 g/L MoPOSNa 100 mM
Peptone 5 g/L Glucose 20 g/L
Yeast powder 2 g/L FeSO4 .7H2O 0.032 g/L
KCl 0.5 g/L Methionine 0.3 g/L
MgSO4 .7H2O 1.6 g/L Threonine 0.3 g/L
ZnSO4 .7H2O 0.086 g/L Vb1 0.06 g/L
CuSO4 0.077 g/L Nicotinamide 0.01 g/L
MnSO4 .H2O 0.032 g/L Biotin 30 μg/L
CaCO3 10 g/L
Adding the inducer arabinose to the final concentration of 30 mM at the initial fermentation stage, carrying out induction culture at 37 ℃ for 12 h, then adding IPTG to the final concentration of 0.5-1 per mill, and carrying out induction culture at 37 ℃ for 48 h. Taking supernatant to perform liquid phase detection, and simultaneously measuring final growth OD600The results are shown in FIG. 3, from which it can be seen that the growth of recombinant E.coli KACCPG is due to the negative control KA30-pTrc99 a-cadA. The growth of the recombinant Escherichia coli KACCPG is superior to that of the negative control KA30-pTrc99a-cadA through calculation. In the fermentation liquor of 20 g/L glucose, the amount of the pentamethylene diamine produced by the original bacteria is 12.8 g/L, the recombinant Escherichia coli KACCPG reaches 13.92 g/L, and the yield is improved by 8.75 percent, particularly shown in figure 4. The above detection method can be referred to patent CN 109055449A.
The above description is only a preferred embodiment of the present invention, and the scope of the present invention is not limited thereto, and any simple modifications or equivalent substitutions of the technical solutions that can be obviously obtained by those skilled in the art within the technical scope of the present invention are within the scope of the present invention.
Sequence listing
<110> Nanjing university of industry
<120> recombinant escherichia coli for producing pentamethylene diamine and application thereof
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 2126
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
atgaacgtta ttgcaatatt gaatcacatg ggggtttatt ttaaagaaga acccatccgt 60
gaacttcatc gcgcgcttga acgtctgaac ttccagattg tttacccgaa cgaccgtgac 120
gacttattaa aactgatcga aaacaatgcg cgtctgtgcg gcgttatttt tgactgggat 180
aaatataatc tcgagctgtg cgaagaaatt agcaaaatga acgagaacct gccgttgtac 240
gcgttcgcta atacgtattc cactctcgat gtaagcctga atgacctgcg tttacagatt 300
agcttctttg aatatgcgct gggtgctgct gaagatattg ctaataagat caagcagacc 360
actgacgaat atatcaacac tattctgcct ccgctgacta aagcactgtt taaatatgtt 420
cgtgaaggta aatatacttt ctgtactcct ggtcacatgg gcggtactgc attccagaaa 480
agcccggtag gtagcctgtt ctatgatttc tttggtccga ataccatgaa atctgatatt 540
tccatttcag tatctgaact gggttctctg ctggatcaca gtggtccaca caaagaagca 600
gaacagtata tcgctcgcgt ctttaacgca gaccgcagct acatggtgac caacggtact 660
tccactgcga acaaaattgt tggtatgtac tctgctccgg caggcagcac cattctgatt 720
gaccgtaact gccacaaatc gctgacccac ctgatgatga tgagcgatgt tacgccaatc 780
tatttccgcc cgacccgtaa cgcttacggt attcttggtg gtatcccaca gagtgaattc 840
cagcacgcta ccattgctaa gcgcgtgaaa gaaacaccaa acgcaacctg gccggtacat 900
gctgtaatta ccaactctac ctatgatggt ctgctgtaca acaccgactt catcaagaaa 960
acactggatg tgaaatccat ccactttgac tccgcgtggg tgccttacac caacttctca 1020
ccgatttacg aaggtaaatg cggtatgagc ggtggccgtg tagaagggaa agtgatttac 1080
gaaacccagt ccactcacaa actgctggcg gcgttctctc aggcttccat gatccacgtt 1140
aaaggtgacg taaacgaaga aacctttaac gaagcctaca tgatgcacac caccacttct 1200
ccgcactacg gtatcgtggc gtccactgaa accgctgcgg cgatgatgaa gggtaatgct 1260
ggtaagcgtc tgatcaacgg ttccattgaa cgtgcgatca aattccgtaa agagatcaaa 1320
cgtctgagaa cggaatctga tggctggttc tttgatgttt ggcagccgga tcatatcgat 1380
acgactgaat gctggccgct gcgttctgac agcacctggc acggcttcaa aaacatcgat 1440
aacgagcaca tgtatcttga cccgatcaaa gtcaccctgc tgactccggg gatggaaaaa 1500
gacggcacca tgagcgactt tggtattccg gccagcatcg tggcgaaata cctcgacgaa 1560
catggcatcg ttgttgagaa aaccggtccg tataacctgc tgttcctgtt cagcatcggt 1620
atcgataaga ccaaagcact gagcctgctg cgtgctctga ctgacttcaa acgtgcgttc 1680
gacctgaacc tgcgtgtgaa aaacatgctg ccgtctctgt atcgtgaaga tcctgaattc 1740
tatgaaaaca tgcgtattca ggaactggct caaaatatcc acaaactgat tgttcaccac 1800
aatctgccgg atctgatgta tcgcgcattt gaagtgctgc cgacgatggt aatgactccg 1860
tatgctgcgt tccagaaaga gctgcacggt atgaccgaag aagtttacct cgacgaaatg 1920
gtaggtcgta ttaacgccaa tatgatcctt ccgtatccgc cgggagttcc tctggtaatg 1980
ccgggtgaaa tgatcaccga agaaagccgt ccggttctgg agttcctgca gatgctgtgt 2040
gaaatcggcg ctcactatcc gggctttgaa accgatattc acggtgcata ccgtcaggct 2100
gatggccgct ataccgttaa ggtatt 2126
<210> 4
<211> 798
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
gagctcaaca accagggcat gggcgatgtg gaatatgcaa aaatgcatga attttatgtg 60
ccggaagcat atcgcgcact gtttgatggt ccgtccgtga atattagcgc actgtggaaa 120
gtgctgggtc gtccggaagt tgatggtggt ctggttgttg gtaccattat taaaccgaaa 180
ctgggtctgc gtccgaaacc gtttgcagaa gcgtgtcatg ccttttggct gggtggtgat 240
tttattaaaa atgatgaacc gcagggtaat cagccgtttg caccgctgcg tgatacaatt 300
gcactggttg ccgatgcaat gcgtcgtgca caggatgaaa ccggtgaagc aaaactgttt 360
agcgcaaaca ttaccgcaga tgatccgttt gaaattattg cacgtggtga atatgtgctg 420
gaaacctttg gtgaaaacgc aagccatgtt gcgtttctgg ttgatggtta tgttgcaggt 480
gcagcggcaa ttacaaccgc acgtcgtcgt tttccggata attttctgca ttatcatcgt 540
gcaggtcatg gtgcagttac gagcccgcag accaaacgtg gttataccgc gtttgttcat 600
tgtaaaatgg cacgtctgca gggtgcatct ggtattcata ccggtaccat gggttttggt 660
aaaatggaag gtgaaagctc tgatcgtgcc attgcctata tgctgaccca ggatgaagcg 720
cagggtccgt tttatcgtca gagttggggt ggtatgaaag catgtacccc gcaccaccac 780
caccaccact aaaagctt 798
<210> 7
<211> 1206
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
atggcagttt gtaccgttta tacgattccg accaccaccc atctgggcag cagctttaat 60
cagaataaca aacaggtttt ttttaactat aaacgtagca gcagcagcaa caacaccctg 120
tttaccaccc gcccgagcta tgttattacc tgtagccagc agcagaccat tgttatcggt 180
ctggccgcag attctggttg tggtaaaagc acctttatgc gtcgtctgac ctccgttttt 240
ggcggcgcag cagaaccgcc gaaaggcggt aatccggata gcaacaccct gattagcgat 300
accaccaccg ttatttgtct ggatgatttt cattcactgg atcgtaacgg tcgtaaagta 360
gaaaaagtta ccgcactgga tcctaaagcc aatgattttg atctgatgta tgaacaggtt 420
aaagccctga aagaaggtaa agcagtggat aaaccgattt ataatcatgt tagcggtctg 480
ctggatccgc cggaactgat ccagccgccg aaaattctgg ttattgaagg tctgcatccg 540
atgtatgatg cacgtgtgcg tgaactgctg gatttttcta tctatctgga tattagcaac 600
gaagttaaat ttgcctggaa aattcagcgt gatatgaaag aacgtggtca ttccctggaa 660
agcattaaag caagtattga aagccgtaaa ccggattttg atgcatatat tgatccacag 720
aaacagcatg cagatgtggt tattgaagta ctgccgacag aactgattcc tgatgatgat 780
gaaggcaaag ttctgcgtgt tcgtatgatt cagaaagaag gtgtgaaatt ttttaacccg 840
gtttatctgt ttgatgaagg cagcaccatc tcctggattc cttgtggccg taaactgacg 900
tgtagctatc ctggcattaa atttagctat ggcccggata ccttttatgg taatgaagtt 960
accgttgttg aaatggatgg tatgtttgat cgtctggatg aactgattta tgttgaatct 1020
catctgagca atctgagcac gaaattttat ggtgaagtta cccagcagat gctgaaacat 1080
cagaattttc cgggtagcaa caatggtacc ggtttttttc agaccattat tggtctgaaa 1140
atccgtgatc tgtttgaaca gctggttgcg agccgtagca cagcaacagc aaccgcagca 1200
aaagcc 1206
<210> 10
<211> 1984
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
atgaatattc gtccattgca tgatcgcgtg atcgtcaagc gtaaagaagt tgaaactaaa 60
tctgctggcg gcatcgttct gaccggctct gcagcggcta aatccacccg cggcgaagtg 120
ctggctgtcg gcaatggccg tatccttgaa aatggcgaag tgaagccgct ggatgtgaaa 180
gttggcgaca tcgttatttt caacgatggc tacggtgtga aatctgagaa gatcgacaat 240
gaagaagtgt tgatcatgtc cgaaagcgac attctggcaa ttgttgaagc gtaatccgcg 300
cacgacactg aacatacgaa tttaaggaat aaagataatg gcagctaaag acgtaaaatt 360
cggtaacgac gctcgtgtga aaatgctgcg cggcgtaaac gtactggcag atgcagtgaa 420
agttaccctc ggtccaaaag gccgtaacgt agttctggat aaatctttcg gtgcaccgac 480
catcaccaaa gatggtgttt ccgttgctcg tgaaatcgaa ctggaagaca agttcgaaaa 540
tatgggtgcg cagatggtga aagaagttgc ctctaaagca aacgacgctg caggcgacgg 600
taccaccact gcaaccgtac tggctcaggc tatcatcact gaaggtctga aagctgttgc 660
tgcgggcatg aacccgatgg acctgaaacg tggtatcgac aaagcggtta ccgctgcagt 720
tgaagaactg aaagcgctgt ccgtaccatg ctctgactct aaagcgattg ctcaggttgg 780
taccatctcc gctaactccg acgaaaccgt aggtaaactg atcgctgaag cgatggacaa 840
agtcggtaaa gaaggcgtta tcaccgttga agacggtacc ggtctgcagg acgaactgga 900
cgtggttgaa ggtatgcagt tcgaccgtgg ctacctgtct ccttacttca tcaacaagcc 960
ggaaactggc gcagtagaac tggaaagccc gttcatcctg ctggctgaca agaaaatctc 1020
caacatccgc gaaatgctgc cggttctgga agctgttgcc aaagcaggca aaccgctgct 1080
gatcatcgct gaagatgtag aaggcgaagc gctggcaact ctggttgtta acaccatgcg 1140
tggcatcgtg aaagtcgctg cggttaaagc accgggcttc ggcgatcgtc gtaaagctat 1200
gctgcaggat atcgcaaccc tgactggcgg taccgtgatc tctgaagaga tcggtatgga 1260
gctggaaaaa gcaaccctgg aagacctggg tcaggctaaa cgtgttgtga tcaacaaaga 1320
caccaccact atcatcgatg gcgtgggtga agaagctgca atccagggcc gtgttgctca 1380
gatccgtcag cagattgaag aagcaacttc tgactacgac cgtgaaaaac tgcaggaacg 1440
cgtagcgaaa ctggcaggcg gcgttgcagt tatcaaagtg ggtgctgcta ccgaagttga 1500
aatgaaagag aaaaaagcac gcgttgaaga tgccctgcac gcgacccgtg ctgcggtaga 1560
agaaggcgtg gttgctggtg gtggtgttgc gctgatccgc gtagcgtcta aactggctga 1620
cctgcgtggt cagaacgaag accagaacgt gggtatcaaa gttgcactgc gtgcaatgga 1680
agctccgctg cgtcagatcg tattgaactg cggcgaagaa ccgtctgttg ttgctaacac 1740
cgttaaaggc ggcgacggca actacggtta caacgcagca accgaagaat acggcaacat 1800
gatcgacatg ggtatcctgg atccaaccaa agtaactcgt tctgctctgc agtacgcagc 1860
ttctgtggct ggcctgatga tcaccaccga atgcatggtt accgacctgc cgaaaaacga 1920
tgcagctgac ttaggcgctg ctggcggtat gggcggcatg ggtggcatgg gcggcatgat 1980
gtaa 1984
<210> 2
<211> 32
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
catgccatgg gaaggagata tacatatgaa cg 32
<210> 3
<211> 50
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
cgcggatcca gggtacctta gtggtggtgg tggtggtgtt ttttgctttc 50
<210> 5
<211> 31
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
cgcggatcca ggaaacagac catggaattc g 31
<210> 6
<211> 49
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
cccaagcttt tagtggtggt ggtggtggtg cggggtacat gctttcata 49
<210> 8
<211> 33
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
catgccatgg caatggcagt ttgtaccgtt tat 33
<210> 9
<211> 47
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
ccggaattct tagtggtggt ggtggtggtg ggcttttgct gcggttg 47
<210> 11
<211> 50
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
ctgcattagg aaatactaga agtaacagaa gtgtctataa ctatggctgg 50
<210> 12
<211> 70
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
tgattaattg tcaaactagt caagaagatc atcttattaa tcagataaat atttctagat 60
ttcagtgcaa 70

Claims (8)

1. The recombinant escherichia coli for producing the pentamethylene diamine is characterized by comprising the following steps:
step 1, synthesizing a lysine decarboxylase gene cadA, and constructing a plasmid pTrc99 a-cadA; synthesizing a ribulose diphosphate carboxylase gene cbbM, connecting the ribulose diphosphate carboxylase gene cbbM with a plasmid pTrc99a-cadA to obtain a plasmid pTrc99a-cadA-cbbM, finally transferring the plasmid pTrc 99-cadA-cbbM into a cloning vector Trans1-T1, primarily screening by an LB (Langmuir-Blodgett) flat plate, selecting a single colony growing on the flat plate for PCR (polymerase chain reaction) verification, and then sending a positive strain to test;
step 2, synthesizing phosphoribosyl kinase gene prkA, and constructing plasmid pCWJ-prkA; then, taking commercial plasmid pGRO7 as a source, copying escherichia coli molecular chaperone gene GroEL/GroES, connecting the molecular chaperone gene GroEL/GroES with plasmid pCWJ-prkA to obtain plasmid pCWJ-prkA-GroEL/GroES, finally transferring into a cloning vector Trans1-T1, primarily screening by an LB plate, selecting a single colony growing on the plate for PCR verification, and sending a positive strain to test;
step 3, transferring the recombinant plasmids pTrc99a-cadA-cbbM and pCWJ-prkA-GroEL/GroES into Escherichia coli KA30 with high lysine yield to obtain recombinant Escherichia coli KACCPG; the nucleotide sequence of the gene cadA is shown as SEQ NO. 1; the nucleotide sequence of the gene cbbM is shown as SEQ NO. 2; the nucleotide sequence of the gene prkA is shown in SEQ NO. 3; the nucleotide sequence of the gene GroEL/GroES is shown in SEQ NO. 4.
2. The recombinant Escherichia coli for producing pentamethylenediamine according to claim 1, wherein: the upstream primer of cadA gene in the primer is provided withNdeICleavage site, downstream primer withBamHIA restriction enzyme site; the cbbM gene upstream primer bandBamHICleavage site, downstream primer withHindIII enzyme digestionA site.
3. The recombinant Escherichia coli for producing pentamethylenediamine according to claim 1, wherein: the synthetic prkA gene upstream primer bandNcoICleavage site, downstream primer withEcoRIA restriction enzyme site; the GroEL/GroES gene was ligated to the vector by homologous recombination.
4. The recombinant Escherichia coli for producing pentamethylenediamine according to claim 1, wherein: the pTrc99a-cadA-cbbM and pCWJ-prkA-GroEL/GroES double plasmids are transferred into Escherichia coli KA30 with high lysine yield by a chemical method, and the recombinant Escherichia coli KACCPG is obtained.
5. Use of the recombinant E.coli KACCPG obtained according to claim 1 for the synthesis of pentamethylenediamine.
6. The application of claim 5, wherein the recombinant Escherichia coli KACCPG is inoculated into a culture medium containing Amp and CmR, cultured for 60 h under the conditions of 37 ℃ and 200 rpm, and then the fermentation liquor is centrifuged to obtain the supernatant, thus obtaining the target product pentanediamine.
7. Use of recombinant E.coli in the synthesis of pentanediamine according to claim 5, wherein the centrifugation speed is 12000 rpm and the centrifugation time is 2 min.
8. The use of recombinant E.coli for the synthesis of pentanediamine according to claim 5, wherein the specific steps for culturing the recombinant E.coli KACCPG are as follows: shake tube to culture first seed liquid to OD600When the temperature is 0.8-1, switching to a secondary seed shake flask, and controlling the initial OD6000.1, OD was cultured6004-5, transferring to a fermentation liquor shake flask, and controlling initial fermentation OD6000.05, adding an inducer arabinose to a final concentration of 30 mM at the beginning of fermentation, carrying out induction culture at 37 ℃ for 12 h, adding IPTG to a final concentration of 0.5-1 per mill, and carrying out induction culture at 37 ℃ for 48 h.
CN202111110911.6A 2021-09-23 2021-09-23 Recombinant escherichia coli for producing pentanediamine and application thereof Active CN113817762B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111110911.6A CN113817762B (en) 2021-09-23 2021-09-23 Recombinant escherichia coli for producing pentanediamine and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111110911.6A CN113817762B (en) 2021-09-23 2021-09-23 Recombinant escherichia coli for producing pentanediamine and application thereof

Publications (2)

Publication Number Publication Date
CN113817762A true CN113817762A (en) 2021-12-21
CN113817762B CN113817762B (en) 2023-06-20

Family

ID=78920980

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111110911.6A Active CN113817762B (en) 2021-09-23 2021-09-23 Recombinant escherichia coli for producing pentanediamine and application thereof

Country Status (1)

Country Link
CN (1) CN113817762B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114774472A (en) * 2022-06-10 2022-07-22 南京工业大学 Construction and application of pentanediamine-tolerant recombinant escherichia coli
CN114806996A (en) * 2022-06-09 2022-07-29 南京工业大学 High-yield pentamethylene diamine genetic engineering bacterium and construction method and application thereof

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105316270A (en) * 2014-06-27 2016-02-10 中国科学院微生物研究所 Engineering bacteria for catalytically producing 1,5-pentanediamine and application thereof
CN106148373A (en) * 2016-05-27 2016-11-23 南京工业大学 A kind of genetic engineering bacterium and the purposes in producing 1,5 pentanediamines thereof
CN110699394A (en) * 2019-09-06 2020-01-17 南京工业大学 Biotransformation method for producing 1, 5-pentanediamine

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105316270A (en) * 2014-06-27 2016-02-10 中国科学院微生物研究所 Engineering bacteria for catalytically producing 1,5-pentanediamine and application thereof
CN106148373A (en) * 2016-05-27 2016-11-23 南京工业大学 A kind of genetic engineering bacterium and the purposes in producing 1,5 pentanediamines thereof
CN110699394A (en) * 2019-09-06 2020-01-17 南京工业大学 Biotransformation method for producing 1, 5-pentanediamine

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114806996A (en) * 2022-06-09 2022-07-29 南京工业大学 High-yield pentamethylene diamine genetic engineering bacterium and construction method and application thereof
CN114774472A (en) * 2022-06-10 2022-07-22 南京工业大学 Construction and application of pentanediamine-tolerant recombinant escherichia coli
CN114774472B (en) * 2022-06-10 2023-04-28 南京工业大学 Construction and application of recombinant escherichia coli resistant to pentanediamine

Also Published As

Publication number Publication date
CN113817762B (en) 2023-06-20

Similar Documents

Publication Publication Date Title
Ashiuchi et al. Isolation of Bacillus subtilis (chungkookjang), a poly-γ-glutamate producer with high genetic competence
EP0143195B1 (en) Recombinant dna having a phosphoenol pyruvate carboxylase gene inserted therein, bacteria carrying said recombinant dna and a process for producing amino acids using said bacteria
CN110241061B (en) Method for improving synthesis capacity of lactobacillus brevis gamma-aminobutyric acid and application thereof
CN113817762B (en) Recombinant escherichia coli for producing pentanediamine and application thereof
CN109777763B (en) Genetically engineered bacterium for producing L-theanine and construction and application thereof
JP2020513790A (en) A genetically engineered biosynthetic pathway for the production of tyramine by fermentation
JP2001120269A (en) Method for producing l-lysine by method for fermentation
CN112680484B (en) Method for producing 3, 4-dihydroxybutyric acid by using double-bacterium co-culture system
CN110904126B (en) Transcription regulation factor, mutant thereof and application thereof in preparing vitamin B12
CN100516197C (en) Process for producing d-n-carbamoyl-alpha-amino acids
JP4216719B2 (en) Halogen compound-resistant novel formate dehydrogenase and method for producing the same
Bajaj et al. Sequential optimization Approach for Enhanced production of poly (γ-glutamic acid) from Newly Isolated Bacillus subtilis
CN112359007B (en) Exogenous introduction edd gene bacillus licheniformis for producing bacitracin and application
CN110903358B (en) Ribosomal factor and its mutant and its use in preparing vitamin B12In (1)
CN110904079B (en) β -fructofuranosidase mutant, mutant gene and application thereof in preparation of vitamin B12In (1)
WO2004053111A1 (en) Method of selecting escherichia coli strain overexpressing foreign gene, escherichia coli mutant thus selected and process for producing enzyme and compound using the same
JP4287144B2 (en) Novel formate dehydrogenase and production method thereof
CN1148451C (en) Biosynthesis method enabling preparation of cobalamins
EP0170257B1 (en) Process for producing l-tryptophan
CN110819605A (en) Methionine synthetase mutant, mutant gene and application thereof in preparation of vitamin B12In (1)
JPS58107192A (en) Preparation of l-histidine by fermentation
JP2000333690A (en) Production of gamma-polyglutamic acid
CN114381417B (en) Method for improving tolerance of corynebacterium glutamicum to inhibitor
CN114790436B (en) Gene afsR_4 mutation and application thereof
CN116536231A (en) Escherichia coli tryptophan synthesis strain capable of reducing acetic acid generation

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant