CN117070640A - Tridacna microsatellite DNA molecular marker - Google Patents

Abstract

The invention discloses a tridacna lepidoptera microsatellite DNA molecular marker. The microsatellite molecular markers comprise TS101, TS102 and TS103, and nucleotide sequences of the microsatellite molecular markers TS101, TS102 and TS103 are respectively shown in SEQ ID NO. 1-3. The invention provides 3 microsatellite loci of giant clams, a primer sequence for amplifying the 3 microsatellite loci and an amplification method for the first time, can be applied to research in the fields of population genetic structure analysis, paternity test, molecular marker assisted breeding and the like of giant clams, has good repeatability, and is a reliable and effective molecular marker.

Description

Tridacna microsatellite DNA molecular marker

Technical Field

The invention belongs to the technical field of molecular biology DNA (deoxyribonucleic acid) markers, and particularly relates to a tridacna microsatellite DNA molecular marker, a detection primer, a kit and application thereof.

Background

Microsatellites, also known as simple repeats (simple sequence repeat, SSR), are 5-40 simple tandem repeats (short tandem repeat) consisting of 1-6 nucleotide bases (bp) as repeat units (motif). Microsatellites consist of a core sequence that makes the microsatellite polymorphic due to the number of repeat units and flanking sequences, which are typically specific single copy sequences that are conserved. Microsatellite markers are primers designed based on the high variability of the core sequence and conservation of flanking sequences, and correlation analysis is performed according to the difference in the number of repetitions of the core sequence of a specific species (polymorphism). The microsatellite marker has the advantages of wide distribution, high polymorphism information capacity, co-dominance, accordance with Mendelian separation rule, easiness in PCR amplification and the like, and has been widely applied to the fields of population genetic structure analysis, paternity test, genetic linkage map construction, functional gene positioning, genetic breeding and the like of marine organisms.

The tridacna (Tridacna squamosa) is a medium-sized tridacna species, can grow to 30-40cm at maximum, has obvious tridacna on the shell, grows straight from the edge of the shell until the tridacna extends to the bottom of the shell, and is one of main key frame organisms of the coral reef ecosystem. Tridacna has been listed as a first class of national protective animals and listed as an easily-dangerous species by the world natural protection alliance red directory. In order to protect wild resources of tridacna, a corresponding protection strategy is formulated, and related works such as population genetic diversity, population genetic structure analysis and the like are urgent. Up to now, there is no report and formal publication of microsatellite marker development for the species tridacna. Therefore, there is a need to develop microsatellite markers with high polymorphism, stable amplification and strong specificity for genetic analysis related to population genetic structure and protection.

Disclosure of Invention

The invention aims to provide microsatellite loci and polymorphic primers of tridacna, namely 3 polymorphic microsatellite loci of tridacna with high stability and strong specificity and corresponding polymorphic microsatellite primers, and provides an effective tool for genetic structure analysis, paternity test and molecular marker assisted breeding of tridacna population.

The invention constructs the tridacna microsatellite (CA) ₁₆ 、(GA) ₁₆ Enriching the library, screening tridacna polymorphism microsatellite primers, and carrying out genetic polymorphism detection on the microsatellite loci by using 20 tridacna wild individuals to determine 3 microsatellite markers with abundant polymorphism: the nucleotide sequences of TS101, TS102 and TS103 are respectively shown in SEQ ID NO. 1-3.

Therefore, the first object of the invention is to provide a tridacna microsatellite DNA molecular marker, which comprises TS101, TS102 and TS103 with nucleotide sequences shown in SEQ ID NO. 1-3 respectively.

The second object of the present invention is to provide an amplification primer set of the tridacna microsatellite DNA molecular marker, which comprises: primer pairs for amplifying the microsatellite molecular marker TS101 shown in SEQ ID NO. 4-5, primer pairs for amplifying the microsatellite molecular marker TS102 shown in SEQ ID NO. 6-7 and primer pairs for amplifying the microsatellite molecular marker TS103 shown in SEQ ID NO. 8-9.

The third object of the invention is to provide a kit comprising the amplification primer set, an enzyme for PCR amplification, a buffer solution, dNTPs and sterile water.

The fourth object of the invention is to provide the application of the microsatellite molecular marker, the amplification primer set or the kit in tridacna scale genetic analysis.

Preferably, the genetic analysis comprises one or more of genetic diversity analysis, population genetic structure analysis, genetic flow analysis, cluster analysis and construction of molecular fingerprints.

The fifth object of the invention is to provide the application of the microsatellite molecular marker, the amplification primer set or the kit in the paternity test of tridacna.

The sixth object of the invention is to provide the application of the microsatellite molecular marker, the amplification primer set or the kit in the tridacna scale molecular marker assisted breeding.

Preferably, the application comprises the following steps:

(1) Extracting genome DNA of tridacna;

(2) Taking genomic DNA of tridacna as a template, and carrying out PCR amplification by using the amplification primer group to obtain an amplification product;

(3) Detecting the amplified product, and evaluating the polymorphism of the microsatellite loci according to the detection result.

The detection in step (3) comprises clone sequencing, capillary fluorescence electrophoresis or polyacrylamide gel electrophoresis.

The invention provides 3 microsatellite loci of giant clams, a primer sequence for amplifying the 3 microsatellite loci and an amplification method for the first time, can be applied to research in the fields of population genetic structure analysis, paternity test, molecular marker assisted breeding and the like of giant clams, has good repeatability, and is a reliable and effective molecular marker.

Drawings

FIG. 1 is a silver-stained PAGE diagram of 20 tridacna individuals amplified by a specific primer at the TS101 site.

FIG. 2 is a silver-stained PAGE chart of 20 tridacna individuals amplified by a specific primer at the TS102 locus.

FIG. 3 is a silver-stained PAGE chart of 20 tridacna individuals amplified by specific primers at TS103 locus.

Detailed Description

The following examples are further illustrative of the invention and are not intended to be limiting thereof.

Example 1

1. Construction of tridacna microsatellite DNA enrichment library

1.1 extraction and cleavage of genomic DNA

And shearing 25mg of tridacna adductor muscle tissue fixed by absolute ethyl alcohol, soaking for 3 times by distilled water, and changing water after 30 minutes each time to thoroughly remove the residual ethyl alcohol in the adductor muscle. The adductor muscle is fully sheared by scissors, the water is absorbed by clean filter paper and then put into a 1.5mL centrifuge tube, 200 mu L of lysate and 10 mu L of proteinase K (10 mg/mL) are added, the mixture is evenly mixed on a shaker, and the mixture is digested for 4 to 5 hours in a water bath at 55 ℃ until the lysate is clarified. Equal volumes of saturated phenol (200. Mu.L), chloroform/isoamyl alcohol (24:1) (200. Mu.L) were added and extracted three times. The DNA was precipitated with 1mL of absolute ethanol, washed with 70% ethanol, dried at room temperature and dissolved in 100. Mu.L of sterilized water. The concentration and purity of the DNA were measured by an ultraviolet spectrophotometer, and the integrity of the DNA was measured by 1% agarose gel electrophoresis. The genome is digested by restriction endonuclease Sau3AI, 1% agarose gel electrophoresis is carried out, and the digested DNA fragment of 500-900bp is purified and recovered by a gel recovery kit.

1.2 ligation adaptors and first PCR amplification

Each 10. Mu.L of the solutions of oligonucleotide A (Sau 3AI-L: 5'-GCGGTACCCGGGAAGCTTGG-3') and B (Sau 3AI-R: 5'-GATCCCAAGCTTCCCGGGTACCGC-3') was mixed in a PCR cuvette, denatured at 95℃for 10min, and then naturally cooled. The ligation of the cleavage product to the double-stranded adaptor was performed using T4 DNA ligase at 16℃overnight. The first PCR amplification was performed using the ligation product as template and Sau 3AI-L as primer, and a 25. Mu.L reaction system was as follows: 12.5 mu LGreen Master Mix (Promega Co.), 2. Mu.L of primer, 2. Mu.L of ligation product, and sterilized water was added to make up to 25. Mu.L. PCR reaction procedure: pre-denaturation at 95℃for 5min, denaturation at 94℃for 45s, annealing at 60℃for 45s, extension at 72℃for 1min, and three steps of denaturation to extension were repeated 30 times and extension at 72℃for 10min. And (3) performing gel recovery on the PCR product, recovering fragments with the length of more than 500bp, removing redundant primers, dNTPs and the like, and obtaining a purified product.

1.3 magnetic bead enrichment and second PCR amplification

Purifying the product and crudeOligonucleotide probe labeled with biotin (CA) ₁₆ 、(GA) ₁₆ Hybridization was performed at 56℃for 2 hours. Magnetic beads coated with Streptavidin (strepitavidins)Paramagnetic Particles (PMPs) (Promega Co.) captured single strands of DNA containing the microsatellite core, followed by multiple elution to remove non-target fragments, and finally by denaturation at 95℃for 5min to collect the microsatellite core-containing fragments. And (3) performing a second PCR amplification by using the magnetic bead enrichment product as a template and Sau 3AI-L as a primer, and performing a first PCR by using a reaction system and a program. The second PCR product was purified using the PCR product purification kit.

1.4 ligation transformation

The second PCR purified product was ligated with pGEM-T Easy vector (Promega Co.) at 4℃overnight. JM109 competent cells were transformed, plated on LB plates, and cultured until single colonies were grown.

1.5 three primer method for detecting Positive clones, sequencing and primer design

Single colonies were picked up in 96 well plates and grown up. With SP6 (CATACGATTTAGGTGACACTATAG), T7 (TAATACGACTCACTATAGGGCGA) and core sequence (CA) ₁₆ Sum (GA) ₁₆ PCR amplification was performed for the primer pair enriched library, the reaction procedure was: pre-denaturation at 94℃for 5min, denaturation at 94℃for 30s, annealing at 50℃for 30s, extension at 72℃for 1min, and three steps of denaturation to extension were repeated 30 times and extension at 72℃for 10min. The PCR products were taken and electrophoresed on a 1.5% agarose gel, two or more positive clones containing microsatellite cores were developed, and two-way sequencing was performed using ABI 310. 15 pairs of microsatellite primers are designed by using Primer5.0 pairs of obtained microsatellite sequences, PCR amplification detection is carried out on the primers, and finally 3 pairs of primers can stably amplify target bands, and 3 pairs of primer sequences are shown in Table 1.

2. Screening and result analysis of tridacna polymorphism microsatellite primers

2.1 screening primers with polymorphism

Genomic DNA of 20 samples of tridacna scale were extracted by the method of 1.1, and then RCR amplification was performed using the resulting 3 pairs of microsatellite primers (Table 1). The amplification reaction system was 25. Mu.L, and the reaction procedure was: pre-denaturation at 94℃for 5min, denaturation at 94℃for 30s, annealing at 50℃for 30s, extension at 72℃for 1min, and three steps of denaturation to extension were repeated 25 times and extension at 72℃for 10min. The PCR products were separated by 6% non-denaturing polyacrylamide gel electrophoresis, stained by silver staining and scanned by UMAX scanner. A total of 3 microsatellite markers with polymorphisms were obtained (see table 1): TS101, TS102, TS103.TS101 is 370 nucleotides, and the sequence is shown as SEQ ID NO. 1; TS102 is 391 nucleotides, and the sequence is shown as SEQ ID NO. 2; TS103 is 415 nucleotides, and the sequence is shown as SEQ ID NO. 3.

TS101(SEQ ID NO.1)：

GATCAAGTGCGGCTTGTGCGACTTGAACCCGATGCCTTCAGATAACGAATCCCAAAATAAGCTAAA

AAGTCACACGCAGGACCCGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGCGCAAAGAAA

AAAACGCAGTTAAGAAGTCAAATAGAAGAATGAAAGTATCGACACGGAACACGATATTGACAAAG

AAGACTCTGCTGATGCTGTTGTTGATGATGTTGCTGCTGCTGCTGATGATGATGATGATGAAGATAAT

GTTGTTGATGATGGTGCTAATTCTCATAATGATGATGATAATAGTTAGAACGACTTTTTCCTTTTGCGATGAGGATAATTAAATTGTCTTCTTTCCGTTCTATTTTCC。

TS102(SEQ ID NO.2)：

GATCTTAGTGAACACAATGTTTCGGGTCACAACAGGTTGTGGGTTCGAATCCCCGGCTGGCCAACT

AAAATTACTAATAGTCTTTCGGATGAGACATTAAACCGAGGTCCCGTGTGACGGTGCTATACGTCGA

GCACGTTAAAGAACCAGGCGAAGCTGTCAGTAGTTTCGACTTGTATCCTTGCCCTATCCCCCGTAAC

AACTAACCGTCTTCTGGGGGCGTCGCTCAGATGGGCAACCGGTAACGACGATAAATAAACGGAAAT

AACCAACCAACCAACACACACATACCACACACACACACACAAAATAGGTCTTACGCATGCGCAGATGTGCAAATCACTGTCCTTTAGCGAACGGTGTAAATCAGAATTCACAGCAAGTGCAGTCC。

TS103(SEQ ID NO.3)：

GATCATAGTGACAATCGTGCAAGTCCGTATCAGAATTATATTGTATCGTTAATCAGGTCGGGGTTTCT

TGAATGTTGTAAAATTTCGGTGACGGGGTTACCCCCTGACACGGGCAAGCAGTAGACTGTGAAAAT

CTTTGTCTATTGTTGATGGGAGAGAGAGAGATAGAGAGAGAGAGAGAGAGATGGATGGATGGATGG

GGAGAGAGAGAGAAAGAGAGAGAGAGTGCGGGAGACGGGAGACAACATTTGCTTTCATAATGGT

GTCACGTAGAGTATTCTCTCTTGAGCTTAATCTTCCCATTGAATTATTGTGGCGCCGCATGGGCGGTG

GCACTATATTTTTATTCGTTTTTGAAAAGTACCTTATGGAGGCAGCCATATTGTTTACTCGGCATCCAGTCATTTCGTAATAA。

TABLE 1 characterization of primers

2.2 analysis of results

The 3 giant-scale microsatellite DNA polymorphic sites were characterized by calculating the allele, observing the heterozygosity and the expected heterozygosity using POPGENE software.

As can be seen from FIGS. 1 to 3, the 3 microsatellite sequences of the invention have polymorphism in all the 20 giant tridacna samples to be tested, and have the advantages of high amplification stability and strong specificity. Therefore, the 3 microsatellite markers can be used for the works such as wild population evaluation and genetic linkage map construction of tridacna in future.

The invention provides 3 microsatellite loci of giant clams, a primer sequence for amplifying the 3 microsatellite loci and an amplification method for the first time, can be applied to research in the fields of population genetic structure analysis, paternity test, molecular marker assisted breeding and the like of giant clams, has good repeatability, and is a reliable and effective molecular marker.

The foregoing is merely a preferred embodiment of the present invention, and it should be noted that the above-mentioned preferred embodiment should not be construed as limiting the invention, and the scope of the invention should be defined by the appended claims. It will be apparent to those skilled in the art that various modifications and adaptations can be made without departing from the spirit and scope of the invention, and such modifications and adaptations are intended to be comprehended within the scope of the invention.

Claims (10)

1. The tridacna microsatellite DNA molecular marker is characterized by comprising TS101, TS102 and TS103 with nucleotide sequences shown in SEQ ID NO. 1-3 respectively.

2. An amplification primer set of the giant clam microsatellite DNA molecular marker of claim 1, wherein the amplification primer set comprises: primer pairs for amplifying the microsatellite molecular marker TS101 shown in SEQ ID NO. 4-5, primer pairs for amplifying the microsatellite molecular marker TS102 shown in SEQ ID NO. 6-7 and primer pairs for amplifying the microsatellite molecular marker TS103 shown in SEQ ID NO. 8-9.

3. A kit comprising the amplification primer set of claim 2.

4. The kit of claim 3, further comprising an enzyme for PCR amplification, a buffer, dntps, and sterile water.

5. Use of the microsatellite molecular marker of claim 1, the amplification primer set of claim 2 or the kit of claim 3 in a tridacna genetic analysis.

6. The use of claim 5, wherein the genetic analysis comprises one or more of genetic diversity analysis, population genetic structure analysis, genetic flow analysis, cluster analysis, and construction of molecular fingerprints.

7. Use of the microsatellite molecular marker of claim 1, the amplification primer set of claim 2 or the kit of claim 3 in the paternity test of tridacna.

8. Use of the microsatellite molecular marker of claim 1, the amplification primer set of claim 2 or the kit of claim 3 in molecular marker assisted breeding of tridacna.

9. Use according to any one of claims 5-8, characterized by the steps of:

(1) Extracting genome DNA of tridacna;

(2) Performing PCR amplification by using the amplification primer set of claim 2 by taking genomic DNA of tridacna scale as a template to obtain an amplification product;

(3) Detecting the amplified product, and evaluating the polymorphism of the microsatellite loci according to the detection result.

10. The use according to claim 9, wherein the detection in step (3) comprises clone sequencing, capillary fluorescence electrophoresis or polyacrylamide gel electrophoresis.