WO2012083845A1

WO2012083845A1 - Methods for removal of vector fragments in sequencing library and uses thereof

Info

Publication number: WO2012083845A1
Application number: PCT/CN2011/084303
Authority: WO
Inventors: 胡帅星; 武靖华; 樊帆; 陈琳; 赵美茹; 王俊; 汪建
Original assignee: 深圳华大基因科技有限公司; 深圳华大基因研究院
Priority date: 2010-12-22
Filing date: 2011-12-20
Publication date: 2012-06-28
Also published as: CN102559856B; HK1169453A1; CN102559856A

Abstract

Methods for removal of vector fragments in sequencing library, methods for sequencing clone library of genomes and kits for sequencing genomes are provided. Wherein methods for removal of vector fragments in sequencing library include: providing labeled probes which are able to hybridize with vector fragments; hybridizing the probes with the sequencing library, so that the probes and the vector fragments form labeled double-stranded nucleic acid; and utilizing labeled molecular entity on specific binding probes to remove labeled double-stranded nucleic acid, accordingly remove vector fragments in sequencing library.

Description

Method for removing carrier fragments in a sequencing library and its use

The present application claims priority to and the benefit of the patent application No. 201010600214.4 filed on Dec. 22, 2010, to the Chinese National Intellectual Property Office, which is hereby incorporated by reference in its entirety. Technical field

The present invention relates to the field of molecular biology, particularly in the field of genome sequencing, and in particular, to methods for removing carrier fragments in sequencing libraries and uses thereof. More specifically, the present invention provides a method for removing a vector fragment in a sequencing library, a method for sequencing a genomic clone library, and a kit for genome sequencing. Background technique

De nove sequencing is also called de novo sequencing. It can sequence the genome of a certain species without any gene sequence information. After sequencing, bioinformatics analysis method can be used to splicing and assembling the sequences obtained by sequencing. A genomic sequence map of the species is obtained, which can be applied to other genomics, genetic studies of the species. Therefore, the e wove sequencing of biological organisms is of great significance.

At this stage, De nove sequencing of organisms is often carried out using Illumina's DNA sequencing platform, specifically, by preparing a sequencing library of the organism and then sequencing it. Among them, according to the size of the sequencing fragment, the sequencing library preparation method based on Illumina's DNA sequencing platform is divided into small-sequence DNA sequencing library preparation and large-segment DNA sequencing library preparation. In order to solve the problem that the heterozygosity of the non-haploid genome sequence is too high and the De novo sequencing sequence is difficult to assemble and assemble, it is common to construct a DNA small fragment sequencing library using the Fosmid clone library as a template (also sometimes referred to as construction in this paper). Method of Fosmid Small Fragment Sequencing Library). Among them, the Fosmid clone library is obtained by transferring the total DNA of a certain organism together with the Fosmid vector into a host cell in a recombinant form, and then forming a plurality of clones by cell proliferation. For Fosmid vectors, a suitable length of the insertable genomic DNA fragment is about 40 kb. Construction of a Fosmid small fragment sequencing library refers to the preparation of a sequencing library by mixing a certain number of Fosmid clones together as a library template.

However, the current method for constructing a Fosmid small fragment sequencing library remains to be improved. Summary of the invention

The present invention has been completed based on the following findings of the inventors:

When the sequencing library established by the Fosmid clone library was sequenced using the Solexa DNA sequencer, the Fosmid vector was also disrupted into a small number of small fragments of DNA below lkb due to disruption of the Fosmid clone during the database construction process. Therefore, the sequencing library contains a large number of Fosmid vector fragments. Therefore, when the entire sequencing library is sequenced, a large amount of unnecessary vector sequence data is generated, and the unnecessary sequence data also affects subsequent data analysis, resulting in Sequencing resources are wasted, sequencing costs are high, and efficiency is low.

The present invention aims to solve at least one of the technical problems existing in the prior art. Thus, the present invention provides methods for removing vector fragments in a sequencing library and uses thereof, so that the Fosmid vector fragment will be removed prior to sequencing the sequencing library using a Solexa DNA sequencer to avoid sequencing the Fosmid vector. Reduce unnecessary data reading and analysis, which can significantly reduce the cost of sequencing and improve sequencing efficiency.

According to one aspect of the invention, the invention provides a method for removing a vector fragment in a sequencing library. According to an embodiment of the invention, the method comprises the steps of:

First, a labeled probe is provided that is capable of hybridizing to a vector fragment. According to an embodiment of the invention, the vector is a Fosmid vector. Wherein, the term "hybridization" as used herein refers to two single-stranded nucleic acid molecules having complementary sequences to each other under certain conditions (suitable temperature and ionic strength, etc.) annealed to form a double strand according to the principle of complementary pairing of bases. The process of nucleic acids, also known as nucleic acid hybridization. The nucleic acid hybridization can be carried out between Li A-Li A or between Li A-RNA or RNA-RNA, and base pairing can be performed as long as there is a complementary sequence in both of the hybrids. Generally, the two sides of the hybrid are the nucleic acid molecule to be tested and the known nucleic acid molecule, and the nucleic acid molecule of the known sequence in the hybrid system is called a probe. In addition, nucleic acid hybridization includes solid-liquid phase hybridization and liquid phase hybridization, wherein liquid phase hybridization is a hybridization reaction carried out in a solution, which means that a nucleic acid molecule to be tested is hybridized with a known nucleic acid molecule (probe) in a solution to form a hybrid. Complex. As used herein, the term "vector fragment" may be the entire Fosmid vector, or a fragment of all vectors formed by disrupting the entire Fosmid vector, whereby the expression "probe" and vector Fragmentation of the fragment "represents that the sequence of the probe can be complementary to the entire Fosmid vector sequence, thereby enabling hybridization with the entire Fosmid vector, or the sequence of the probe can be complementary to the sequence of the fragments of all of the above vectors, thereby enabling fragmentation with all vectors. Hybridization is carried out.

Second, the probe is hybridized to the sequencing library such that the probe and the vector fragment form a labeled double-stranded nucleic acid. When hybridization is carried out using a labeled probe, after hybridization is completed, the hybridized duplex can be isolated and detected using the label on the probe, wherein the label is known in the art and can include, but is not limited to, Radioactive co-location Or a nuclides, biotin, acridinium ester or polyA. Depending on the type of label on the probe, corresponding nucleic acid isolation and detection methods known in the art can be utilized, including but not limited to hydroxyapatite (HAP) or affinity adsorption (see, for example, Henegariu 0 et al. (1999). Custom Fluorescent Deoxyribonucleic Acid-Deoxyribonucleic Acid Hybridization in Microdilution Wells as an Alternative to Membrane Filter Hybridization in which Radioisotopes Are Used To Determine Genetic Relatedness among Bacterial Strains. Int. J. of Systemic Bacteriology 29 (3): 224-229; Herrington C et al. 1998. PCR 3: PCR in situ hybridization: a practical approach, Volume 3. Oxford: Oxford University Press, which is incorporated herein by reference in its entirety, the hybridization product is isolated and tested. As used herein, the expression "probe and vector fragment forms a labeled double-stranded nucleic acid" means that the probe can hybridize with the entire Fosmid vector to form a labeled double-stranded nucleic acid, or it can be a probe and all of the above vectors. The fragment hybridizes to the labeled double-stranded nucleic acid. According to an embodiment of the invention, the probe is subjected to a liquid phase hybridization reaction with a sequencing library. According to some embodiments of the invention, the probe can be hybridized with the sequencing library in a mass ratio of from about 1:1 to about 2:1. According to a specific example of the present invention, before the hybridization reaction is carried out, it may further comprise adding a linker blocking agent to the sequencing library. According to an embodiment of the invention, the ratio of linker blocking agent to sequencing library may range from about 0.3 pM/ng to 0.8 pM/ng. According to a specific example of the invention, the ratio of the linker blocking agent to the sequencing library is 0.5 pM/ng. According to an embodiment of the present invention, the hybridization reaction may take a time of 1, 4, 16, 24 or more hours.

The labeled double-stranded nucleic acid is then removed using the labeled molecular entity on the specific binding probe to remove the vector fragment in the sequencing library. According to an embodiment of the invention, the aforementioned labeled probe may be a biotinylated probe and the molecular entity is avidin. According to some embodiments of the invention, the molecular entity is streptavidin, and according to a specific example of the invention, the molecular entity is formed on the magnetic beads.

The inventors have surprisingly found that the method for removing vector fragments in a sequencing library according to an embodiment of the present invention enables efficient removal of vector fragments in a Fosmid small fragment sequencing library for sequencing based on a high throughput sequencing platform such as Illumina Solexa The platform, after sequencing the processed sequencing library, can effectively avoid waste of sequencing resources and generate unnecessary sequencing data, ultimately reducing the cost of sequencing and improving the sequencing efficiency.

Specifically, according to an embodiment of the present invention, the method for removing a vector fragment in a sequencing library of the present invention may comprise the following steps:

1) preparing a labeled probe that is capable of hybridizing to a vector or a fragment thereof; 2) hybridizing the probe to the sequencing library, thereby forming the labeled double-stranded nucleic acid with the probe or the vector or the fragment thereof;

3) removing the labeled double-stranded nucleic acid by using the labeled molecular entity on the specific binding probe to remove the vector fragment in the sequencing library.

According to an embodiment of the invention, the vector is used to construct a genomic clone library, and is preferably a Fosmid vector. According to a specific example of the invention, the probe is labeled with biotin and the molecular entity that specifically binds to the label is avidin. According to an embodiment of the present invention, preferably the molecular entity is streptavidin, and according to one embodiment of the present invention, streptavidin may be formed on the magnetic beads. According to an embodiment of the invention, the probe is subjected to a liquid phase hybridization reaction with a sequencing library.

According to an embodiment of the invention, the biotinylated probe can be prepared by the following steps:

1) PCR amplification of the vector using biotinylated dNTPs, and purification of the PCR product;

2) The PCR product is fragmented and recovered and purified to obtain a biotin-labeled probe.

According to an embodiment of the invention, the PCR product can be fragmented using a Covaris instrument. The PCR product is specifically fragmented into fragments of about 300 bp according to the present invention.

According to an embodiment of the present invention, the hybridization reaction can be carried out by denaturation of the probe and the sequencing library at 95 °C, followed by annealing at 65 °C. According to a specific example of the present invention, the probe and the sequencing library can be subjected to a hybridization reaction at a mass ratio of about 1:1 to about 2:1.

According to an embodiment of the invention, a linker blocker can optionally be added to the sequencing library prior to hybridization of the probe to the sequencing library. According to a specific example of the present invention, the linker blocking agent is a nucleic acid capable of hybridizing to a linker used in the construction of the sequencing library, and preferably, the nucleotide sequence of the linker blocker is completely complementary to the nucleotide sequence of the linker, thereby When the probe is hybridized to the sequencing library, the linker is hybridized to the linker to avoid hybridization of the linker to the probe and pairing between the linkers. According to an embodiment of the invention, the ratio of the linker blocking agent to the library may be from about 0.3 pM/ng to about 0.8 pM/ng, for example 0.5 pM/ng. When the amount of the linker blocking agent added is too large, the removal efficiency of the vector fragment in the library is lowered. However, when the amount of the linker blocking agent added is too small, a large amount of non-vector library DNA fragments are captured by the probe. Remove. According to an embodiment of the invention, the hybridization can be carried out for 1, 4, 16, 24 or more hours.

According to another aspect of the present invention, the present invention provides a method for sequencing a genomic clone library, comprising the steps of:

First, a sequencing library is constructed using a genomic clone library in which a vector fragment is included in the sequencing library. According to an embodiment of the invention, the genomic clone library is a Fosmid clone library and the vector is a Fosmid vector. According to the invention In some embodiments, the sequencing library can be constructed by: fragmenting the DNA in the genomic clone library to obtain a DNA fragment; ligating the linker to both ends of the DNA fragment to obtain a ligation product; and PCR-amplifying the ligation product , in order to obtain an amplification product; and recovering and purifying the amplification product, the amplification product constituting a sequencing library.

Next, the vector fragment in the sequencing library is removed using a method for removing a vector fragment in a sequencing library according to an embodiment of the present invention. According to an embodiment of the present invention, the vector fragment in the sequencing library may be removed after the sequencing library is constructed, or during the process of constructing the sequencing library; according to a specific example of the present invention, after the DNA in the genomic clone library is fragmented , removing the vector fragment in the sequencing library.

Finally, the sequencing library after removal of the vector fragment was sequenced. According to an embodiment of the present invention, the method of sequencing is not particularly limited. According to one embodiment of the invention, sequencing can be performed using a Solexa sequencer.

The inventors have surprisingly found that the method for sequencing a genomic clone library according to an embodiment of the present invention can efficiently sequence a genomic clone library, that is, a Fosmid small fragment sequencing library, since the method can effectively remove Fosmid small fragments. By sequencing the vector fragments in the library, it is possible to avoid waste of sequencing resources and generate unnecessary sequencing data, thereby reducing the cost of sequencing, improving the sequencing efficiency, and obtaining accurate sequencing results and easy data analysis. Thus, the method can be effectively applied to the centralized commercial multi-species genome sequencing which is carried out on a large scale at present, thereby saving cost and improving efficiency, and further, capable of performing genomic clone library according to an embodiment of the present invention. The method of sequencing is applied to new areas such as analysis, disease diagnosis, and personalized (individualized) medicine.

Specifically, according to an embodiment of the present invention, the method for sequencing a genomic clone library of the present invention may comprise the following steps:

1) constructing a sequencing library using the genomic clone library, and removing the vector fragment in the sequencing library;

2) Sequencing the sequencing library after removing the vector fragment.

According to an embodiment of the invention, the genomic clone library is a Fosmid clone library and the vector is a Fosmid vector. According to a specific example of the present invention, a method for removing a vector fragment in a sequencing library according to the present invention can be utilized to remove a vector fragment in a sequencing library.

According to some embodiments of the invention, the construction of the sequencing library can be performed by the following steps:

1) fragmenting the DNA in the genomic clone library;

2) attaching a linker to both ends of the fragmented DNA to obtain DNA to which the linker is added;

3) The DNA to which the linker has been added is subjected to PCR amplification, and the purified amplification product is recovered, and the amplified product constitutes a sequencing library.

According to an embodiment of the invention, the vector fragment in the sequencing library can be removed after construction of the sequencing library. Root According to some embodiments of the invention, the vector fragments in the sequencing library can be removed during the construction of the sequencing library. According to a specific example of the present invention, the vector fragment can be removed after fragmenting the DNA in the genomic library.

According to an embodiment of the invention, the sequencing library can be sequenced using a Solexa sequencer.

According to still another aspect of the present invention, the present invention provides a kit for genome sequencing, comprising: a vector for constructing a genomic clone library; a labeled probe capable of interacting with the vector or The fragment is hybridized; and a molecular entity capable of specifically binding to the label on the probe. According to an embodiment of the invention, the vector is a Fosmid vector. According to some embodiments of the invention, the probe is a biotinylated probe and the molecular entity is avidin. According to a specific example of the invention, the molecular entity is streptavidin. According to one embodiment of the invention, the molecular entity is streptavidin formed on the magnetic beads. It will be appreciated by those skilled in the art that kits of the invention may also include other reagents required for genomic clone library construction, sequencing, etc., which may further include linkers and linker blocking agents in accordance with embodiments of the present invention. The features and functions of the joint sealer have been described in detail above and will not be described again.

The inventors have found that a kit according to an embodiment of the present invention can be effectively used for genome sequencing, and in particular, a vector in a kit can be used to efficiently construct a library of genomic clones, thereby utilizing labeled probes and molecules in the kit. The entity is capable of efficiently removing the vector fragments in the library, thereby enabling efficient genome sequencing of the library from which the vector fragments are removed based on a high throughput sequencing platform. Thus, the application of the kit of the present invention to genome sequencing can effectively avoid waste of sequencing resources and generate unnecessary sequencing data, thereby reducing the cost of sequencing, improving the sequencing efficiency, and obtaining accurate sequencing results and easy data analysis.

Specifically, according to an embodiment of the present invention, the kit for genome sequencing of the present invention may comprise: a vector for constructing a genomic clone library, a labeled probe capable of hybridizing with a vector or a fragment thereof, and capable of specifically binding The labeled molecular entity of the probe.

According to an embodiment of the invention, the vector is a Fosmid vector. According to some embodiments of the invention, the probe is labeled with biotin and the molecular entity that specifically binds to the label is avidin, and according to a specific example of the invention, the preferred molecular entity is streptavidin. According to an embodiment of the invention, streptavidin may be formed on the magnetic beads. According to embodiments of the invention, the kit may also include other reagents including, but not limited to, linkers and linker blocking agents.

It should be noted that the method for removing a vector fragment in a sequencing library and its use according to an embodiment of the present invention are completed by the inventor of the present application through arduous creative labor and optimization work.

The additional aspects and advantages of the invention will be set forth in part in the description which follows. detailed description

The solution of the present invention will be explained below in conjunction with the embodiments. Those skilled in the art will appreciate that the following examples are merely illustrative of the invention and are not to be considered as limiting the scope of the invention. In the examples, the specific techniques or conditions are not indicated, according to the techniques or conditions described in the literature in the field (for example, refer to J. Sambrook et al., Huang Peitang et al., Molecular Cloning Experimental Guide, Third Edition, Science Press) or in accordance with the product manual. The reagents or instruments used are not specified by the manufacturer, and are conventional products that are commercially available, for example, from Illumina.

Example 1

1. Prepare the probe

The probe was prepared by a PCR reaction using a Fosmid vector (the sequence of which is shown in SEQ ID NO: 1) as a template. Among them, the reaction system of PCR is as follows:

Note: * indicates that the dNTP mixed solution used is a mixed solution of biotin-dNTP and normal dNTP in a ratio of 15:85, and the final concentration is 1 μΜ.

Among them, the forward primer for preparing the probe was: 5'-CCTGGGGTGCCTAATGAGTG-3' (SEQ ID NO: 2). Reverse primer for the preparation of the probe: 5'-CGTCGTTTTACAACGTCGTGA-3' (SEQ ID NO: 3).

The PCR reaction conditions were: 95 ° C, 2 minutes; 12 cycles of 95 ° C, 30 seconds, 65 ° C, 30 seconds, 72 ° C, 8 minutes; 72 ° C, 10 minutes; 4 ° C storage.

After the PCR was completed, the PCR product was purified using the DNA clean and ConcentratorTM-25 kit, and then the PCR product was disrupted using a Covaris S2 instrument to obtain a DNA fragment, which was then determined by gel electrophoresis to determine the size of the DNA fragment. The test results showed that the size of the DNA fragment was mainly about 300 bp. Then use The DNA fragment was purified by MinElute PCR Purification Kit and dissolved in 20 μl elution buffer to obtain a biotin-labeled probe. Then, use Qubit (HS) to quantify the concentration of the probe and set aside.

2. Probe hybridization with library

First, the Fosmid clone library of Puccinia striiformis f.sp 'rid genomic DNA was prepared using the CopyControlTM HTP Fosmid Library Construction Kit (Epicentre, USA) according to the manufacturer's detailed instructions.

Next, a sequencing library of wheat stripe rust DNA was constructed using Illumina's Multiplexing sample preparation oligonucleotide kit (PE-400-1002).

Then, the above-mentioned probe and a sequencing library of wheat stripe rust DNA (sometimes referred to simply as "library" in the present example) were prepared according to the ratios in the following table, and named as sample 1 and Sample 2:

Note: SC hybridization buffer and SC hybridization component A are derived from the sequence capture hybridization kit.

Among them, in each hybridization system, the amount of the library was 120 ng, the amount of the probe was 120 ng (quantified by Qubit), and a linker blocking agent was added to the hybridization system. The linker blocker was obtained from the tag sequencing primer kit (Illumina) and the mixed Rd2 sequencing primer (Multixing Rd2 Sequencing Primer kit, Illumina), wherein the sequence of the linker blocker is as follows:

Linker - sputum 1 : 5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCC TACACG ACGCTCTTCCGATCT-3' (SEQ ID NO: 4);

Linker - sputum 2: 5'-ACAAGCAGAAGACGGCATACGAGATAAGCAATGGTGA CTGGA GTTCAGACGTGTGCTCTTCCGATCT-3' (SEQ ID NO: 5).

In each hybrid system, the amount of both linker blocking agents was 0.06 nM, and the ratio of the amount of the linker to the library was 0.5 pM/ng.

Then, the two hybrid systems prepared above are hybridized, wherein the hybridization conditions are: denaturation at 95 ° C 10 After the minute, hybridization was carried out at 65 ° C according to the time specified in the table below to obtain a hybridization product, which was used.

3. Capture and separation of vector fragments

Library DNA (i.e., vector fragment) capable of hybridizing with the probe in the above hybridization product was captured and isolated using streptavidin magnetic beads (M280 magnetic beads) according to the manufacturer's instructions, and then derived from samples 1 and 2 The library DNA from which the vector fragment was removed was separately collected and labeled as 24- 1-D and 4- 12-D, and the concentrations of the two were determined. The results are as follows:

In addition, library DNA (i.e., vector fragments) hybridized with the probes from samples 1 and 2, respectively, were collected and labeled 24-1-V and 4- 12-V.

The library DNAs obtained above, namely 24-l-D, 4- 12-D, 24-1-V and 4- 12-V, were purified by QIAquick PCR Purification Kit according to the manufacturer's instructions.

4. Library DNA amplification

The library DNA obtained above was subjected to PCR amplification using PFX enzyme, wherein the PCR reaction system was as follows:

Among them, the forward primer for library DNA amplification is: 5'-CAAGCAGAAGACGGCATACGA -3' (SEQ ID NO: 6), reverse primer for library DNA amplification: 5'- AATGATACGGCGACCACCGAGATC -3' (SEQ ID NO: 7).

The PCR reaction conditions were: 94 ° C, 2 minutes; 12 cycles of 94 ° C, 15 seconds, 58 ° C, 30 seconds, 72 ° C, 30 seconds; 72 ° C, 5 minutes; 4 ° C storage. Thereby, an amplification product was obtained.

Then, the amplified product was purified, dissolved in 30 μl of ultrapure water, and the concentration of the obtained amplification product was measured by Nanodrop, and the results were as follows:

5. Analysis of carrier removal

In the present example, the effect of removing the vector fragment in the library by the method for removing the vector fragment in the sequencing library of the present invention is analyzed by Q-PCR. At the time of analysis, a sample which was not treated by the method of the present invention was selected as a control. To determine the effect of removing the vector fragment, the untreated sample and the treated sample were diluted to the same concentration, and Q-PCR was performed to detect the content of the vector fragment in the two samples. The enrichment is then calculated by the following formula using the Ct values of the untreated and treated samples: enrichment _{= E} " *^«^ - "«f'>, where E is the amplification efficiency, For example, when the amplification efficiency is 100%, E = 2, indicating that the amplification efficiency is such that the number of copies of the amplicon is doubled for each amplification cycle. The degree of enrichment indicates a multiple of the amount of the carrier fragment in the control sample relative to the amount of the carrier fragment in the treated sample, and therefore, the effect of carrier removal can be obtained from the value of the enrichment degree, for example, when the enrichment degree is N , which indicates that the sample treated by the method of the present invention removes the 1-1/N carrier fragment.

Then, the library DNA from which the vector fragment was removed (i.e., the above 24-1-1D and 4112-D) and the library DNA from which the vector fragment was not removed (i.e., the sequencing library of the wheat stripe rust DNA) was used as a template for Q- A PCR reaction was performed to detect the content of the vector fragment in each library. Among them, the Q-PCR reaction system is as follows:

Note: SYBR Premix and Rox Reference Dye II are from SYBR@ Premix Ex TaqTM Among them, the forward primer for Q-PCR is: 5'-TTgTTCCCACgCCTGCTGAgTTGT-3' (SEQ ID NO: 8), and the reverse primer for Q-PCR is: 5'-ATCCCgAATTTgCTCCTCCATCCAC-3' (SEQ ID NO : 9 Q-PCR reaction conditions are: 95 ° C, 30 seconds; 40 cycles of 95 ° C, 15 seconds, 60 ° C, 1 minute.

The results of Q-PCR are as follows:

From the above results, it can be seen that the degree of enrichment of the vector fragment is greater than 5, which indicates that the content of the vector fragment in the sample treated by the method of the present invention is less than 1/5 of that of the control sample, thereby indicating that the method of the present invention removes the initial library. At least 80% of the vector fragments. Example 2

1. Prepare the probe

The probe prepared by the method for preparing a probe used in Example 1 was used.

2. Probe hybridization with library

First, a Fosmid clone library was constructed using blood genomic DNA from a Chinese adult male, and then a multi-sample preparation oligonucleotide kit (Illumina, PE-400-) was used according to the manufacturer's instructions. 1002) A sequencing library was constructed, called a YH Fosmid sequencing library. Then, the probe prepared above and the YH Fosmid sequencing library (hereinafter sometimes referred to simply as "library" in the present example) were prepared and hybridized according to the ratios in the following table:

Library 50 ng

2 x SC hybridization buffer 7.5 μΐ

SC hybridization component A 3 μ1

Probe 100 ng

Joint sealer 1 0.025 nM

Joint sealer 2 0.025 nM The water was made up to 15 μΐ wherein, in the above hybrid system, the mass ratio of the library to the probe was 1:2, and the linker blocking agent was the same as the linker of Example 1. The hybridization conditions were: denaturation at 95 ° C for 10 minutes, followed by hybridization at 65 ° C for 24 hours, thereby obtaining a hybridization product, which was used.

3. Capture and separation of vector fragments

Using the method for capturing and isolating the vector fragment used in Example 1, the library DNA capable of hybridizing with the probe, that is, the vector fragment, is captured and separated, and then the library DNA from which the vector fragment is removed is collected. It was labeled as YH-DNA-1 and its concentration was determined. The results are as follows:

The library DNA (i.e., vector fragment) that hybridizes to the probe is collected and labeled as YH-Vector-1.

The obtained library DNA was purified using QIAquick PCR Purification Kit according to the manufacturer's instructions and used.

4. PCR amplification of the library DNA obtained by PCR amplification of the library DNA used in Example 1 to obtain an amplification product, and then the amplified product is purified and dissolved in 30 μl of ultrapure water. In the middle, and using Nanodrop to determine the concentration of the amplified product obtained, the results are as follows:

5. Analysis of carrier removal

Using the method of analyzing the effect of removing the vector fragment in the library by using the vector fragment method of the present invention for removing the vector fragment in the sequencing library, the method of removing the vector fragment in the library in this example was analyzed by Q-PCR. The effect of Q-PCR is as follows:

As can be seen from the above results, the degree of enrichment of the vector fragment is greater than 5, indicating the sample treated by the method of the present invention. The content of the carrier fragment was less than 1/5 of the control sample. Thus, the method of the invention removes at least 80% of the vector fragments in the original library. Industrial applicability

The method for removing a vector fragment in a sequencing library of the present invention, a method for sequencing a genomic clone library, and a kit for genome sequencing can effectively remove a vector fragment in a Fosmid small fragment sequencing library, thereby enabling It can be applied to the sequencing of genomic clone libraries, which can reduce the cost of sequencing and improve the efficiency of sequencing and data analysis.

Although specific embodiments of the invention have been described in detail, those skilled in the art will understand. Various modifications and alterations of those details are possible in light of the teachings of the invention. The full scope of the invention is given by the appended claims and any equivalents thereof.

In the description of the present specification, the description of the terms "one embodiment", "some embodiments", "illustrative embodiment", "example", "specific example", or "some examples", etc. Particular features, structures, materials or features described in the examples or examples are included in at least one embodiment or example of the invention. In the present specification, the schematic representation of the above terms does not necessarily mean the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in a suitable manner in any one or more embodiments or examples.

Claims

Claim

A method for removing a vector fragment in a sequencing library, comprising the steps of:

Providing a labeled probe capable of hybridizing to the vector fragment;

Hybridizing the probe to the sequencing library such that the probe forms a labeled double-stranded nucleic acid with the vector fragment;

The labeled double-stranded nucleic acid is removed using a labeled molecular entity that specifically binds to the probe, thereby removing the vector fragment in the sequencing library.

2. Method according to claim 1, characterized in that the carrier is a Fosmid vector.

3. The method of claim 1 wherein the labeled probe is a biotinylated probe and the molecular entity is avidin.

4. The method according to claim 3, wherein the molecular entity is streptavidin.

5. The method according to claim 4, wherein the molecular entity is formed on the magnetic beads.

6. The method according to claim 1, wherein the probe is subjected to liquid phase hybridization with the sequencing library.

7. The method according to claim 1, wherein the probe is hybridized with the sequencing library at a mass ratio of about 1:1 to about 2:1.

8. The method of claim 1, further comprising adding a linker blocking agent to the sequencing library prior to performing the hybridization reaction.

9. The method of claim 8, wherein the ratio of the linker blocking agent to the sequencing library is between about 0.3 pM/ng and 0.8 pM/ng.

10. The method according to claim 9, wherein the ratio of the linker blocking agent to the sequencing library is 0.5 pM/ng.

11. The method according to claim 1, wherein the hybridization reaction has a time of 1, 4, 16, 24 or more hours.

12. A method for sequencing a genomic clone library, comprising the steps of: constructing a sequencing library using a genomic clone library, wherein the sequencing library comprises a vector fragment;

The vector fragment in the sequencing library is removed using the method according to any one of claims 1-11; and the sequencing library after removal of the vector fragment is sequenced.

13. The method according to claim 12, wherein the genomic clone library is a Fosmid clone Library, and the vector is a Fosmid vector.

14. The method according to claim 12, wherein said constructing the sequencing library is performed by the following steps:

Fragmenting the DNA in the genomic clone library to obtain a DNA fragment;

A linker is attached to both ends of the DNA fragment to obtain a ligation product;

The ligation product is subjected to PCR amplification to obtain an amplification product;

The amplification product is recovered and purified, and the amplification product constitutes the sequencing library.

15. The method according to claim 12, wherein the vector fragment in the sequencing library is removed after constructing the sequencing library or during the process of constructing the sequencing library;

16. The method according to claim 12, wherein after the DNA in the genomic clone library is fragmented, the vector fragment in the sequencing library is removed.

17. Method according to claim 12, characterized in that the sequencing is carried out using a Solexa sequencer.

18. A kit for genome sequencing, comprising:

a vector for constructing a genomic clone library;

a labeled probe capable of hybridizing to the vector fragment;

A molecular entity that is capable of specifically binding a label on the probe.

The kit according to claim 18, wherein the carrier is a Fosmid carrier.

20. A kit according to claim 18 wherein the probe is a biotinylated probe and the molecular entity is avidin.

The kit according to claim 20, wherein the molecular entity is streptavidin.

The kit according to claim 21, wherein the molecular entity is streptavidin formed on the magnetic beads.

23. The kit of claim 18, further comprising a linker and a linker blocking agent.