CN117051030A - Method for constructing alfalfa double-target gene editing genetic transformation system - Google Patents

Abstract

The invention belongs to the technical field of alfalfa gene editing, and particularly relates to a method for constructing an alfalfa CRISPR/Cas9 genetic transformation system. The invention aims to make up the blank of the current CRISPR/Cas9 technology in the establishment and system optimization of an alfalfa gene editing system, provides an alfalfa efficient genetic transformation system based on the CRISPR/Cas9 technology, and overcomes the problems of regeneration cycle growth, low transformation efficiency, dependence on genotypes and the like of edited plants in the genetic transformation process. The system is different from the traditional plant gene editing genetic transformation system, does not need to induce callus, and provides an important system construction technology for alfalfa gene editing breeding and molecular level research. In particular to solve the bottleneck of tissue culture technology that alfalfa is difficult to form callus, has long culture period, low transformation efficiency and the like. The invention provides a method for directly using alfalfa stem tips as explants to carry out double-target gene editing genetic transformation based on CRISPR/Cas9 technology, which comprises the steps of preparation of alfalfa stem tip explants, construction of double-target gene editing vectors, acquisition of exogenous DNA molecule infection explants, screening of resistant explants, cultivation of explants with clustered buds, acquisition of alfalfa regeneration editing plants and the like.

Description

Method for constructing alfalfa double-target gene editing genetic transformation system

Technical Field

The invention belongs to the technical field of alfalfa gene editing, and particularly relates to a method for constructing an alfalfa CRISPR/Cas9 genetic transformation system.

Background

Alfalfa (Medicago sativa) is a perennial leguminous grass rich in protein, has long service life, high yield, strong adaptability and wide distribution, and has higher feeding value and nutritive value, and is called as 'pasture king'; the breeding of alfalfa with excellent characters can greatly promote the development of animal husbandry in China. Because alfalfa belongs to a strict cross pollination tetraploid plant, the alfalfa is highly self-incompatible, and the conventional breeding mode is long in time consumption and slow in effect, so that the improvement of agronomic characters is difficult. Gene editing techniques represented by the CRISPR/Cas9 system can accurately and directionally modify plants, and the CRISPR/Cas9 technology has been widely applied to plant gene function identification and crop genetic breeding at present, and has reports that endogenous genes are successfully edited in many crops, but reports about establishment and optimization of an alfalfa gene editing system are fewer.

In the existing alfalfa gene editing system, the growth period of an editing plant is longer, the tissue culture process is slow, the pollution is serious, the embryogenic callus which is effectively edited is difficult to form, and the editing efficiency is low; and the editing efficiency in different varieties of alfalfa is greatly different, and the progress of transgenosis and related genetic improvement work is severely restricted. Therefore, there is a need to establish a gene editing genetic transformation system based on CRISPR/Cas9 technology, which is rapid, efficient and suitable for various varieties of alfalfa.

Disclosure of Invention

The invention aims to make up the blank of the current CRISPR/Cas9 technology in the establishment and system optimization of an alfalfa gene editing system, provides an alfalfa efficient genetic transformation system based on the CRISPR/Cas9 technology, and overcomes the problems of regeneration cycle growth, low transformation efficiency, dependence on genotypes and the like of edited plants in the genetic transformation process. The system is different from the traditional plant gene editing genetic transformation system, does not need to induce callus, and provides an important system construction technology for alfalfa gene editing breeding and molecular level research. In particular to solve the bottleneck of tissue culture technology that alfalfa is difficult to form callus, has long culture period, low transformation efficiency and the like.

In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:

the CRISPR/Cas9 technology-based double-target gene editing genetic transformation is directly carried out by using alfalfa stem tips as explants, and comprises the steps of preparation of alfalfa stem tip explants, construction of double-target gene editing vectors, acquisition of exogenous DNA molecule infection explants, screening of resistant explants, cultivation of explants with clustered buds, acquisition of alfalfa regeneration editing plants and the like.

The preparation method of the stem tip explant comprises the following steps: selecting alfalfa seedlings which are not grown with 3 rd true leaves for 3-4 days on a seed culture medium, and cutting stem tip parts of the seedlings, which are 3-5 mm close to top meristematic points, to obtain stem tip explants;

the method for obtaining the exogenous DNA molecule infected explant comprises the following steps: dip-dyeing the stem tip explant in agrobacterium tumefaciens bacteria liquid containing exogenous DNA molecules, and culturing on a co-culture medium to obtain an infected explant;

the screening method of the explants with resistance comprises the following steps: transferring the stem tip of the infected explant into a selection medium for culture, and screening to obtain the explant with resistance;

the culture method of the explant with the cluster buds comprises the following steps: transferring the explant with resistance obtained by selection culture into an induced differentiation culture medium for culture to obtain cluster seedlings with morphology and callus at the bottom;

the method for obtaining the alfalfa regeneration editing plants comprises the following steps: transferring the explant with the cluster buds into a rooting culture medium for culture, and finally obtaining the edited plant.

The present invention further provides detailed methods to facilitate operation.

(1) Preparation of stem tip explants: selecting alfalfa seeds with full seeds, soaking and sterilizing with 30% sodium hypochlorite (NaClO) in an ultra-clean workbench, washing with sterile water, and air drying on sterilized filter paper; inoculating to a seed culture medium, placing in a constant temperature incubator for culturing for 3-4 days, selecting alfalfa seedlings without growing 3 rd true leaves, and cutting stem tip parts of the seedlings, which are close to the top meristem points by 3-5 mm.

(2) Preparation of agrobacterium and dye liquor: streaking the strain containing plasmid vector on a resistance plate from a refrigerator at-80deg.C, inverting, and culturing in the dark at 28deg.C for 48 h; inoculating the single colony after the culture to 2 mL LB liquid medium, shaking the culture at 28 ℃ and 90 r/min overnight for 16 h; taking a primary activated bacterial liquid to obtain a bacterial liquid with the following formula 1:1000 was added to LB liquid medium (50 mg/L rifampicin and 50 mg/L kanamycin), shake cultured overnight at 28℃with 90 r/min for 18 h; when the bacterial liquid activity value OD600 is about 0.6, the bacterial liquid is collected by centrifugation at 4000 r/min for 10 min at normal temperature, and is suspended in an MS liquid culture medium for standby.

Wherein the antibiotics added to the resistance plates should depend on the strain type.

Wherein, the MS liquid culture medium for suspending the thalli is equal to or less than the LB liquid culture medium in the previous step.

(3) Acquisition of exogenous DNA molecule infected explants: immersing the stem tip explant into agrobacterium tumefaciens bacteria solution containing exogenous DNA molecules, removing a needle head by a 50 mL sterile disposable needle tube, carrying out vacuum filtration for 30 times, and infecting 1 h; separating the bacterial solution and the explant, sucking the residual bacterial solution by using sterile filter paper on the stem tip, and placing the stem tip in a co-culture medium for dark culture of 3 d (25+/-2 ℃).

Wherein, in order to ensure the vacuum filtration effect, the bacterial liquid filled in the 50 mL sterile disposable needle tube each time should be 20-25 mL;

(4) Culturing alfalfa regeneration editing plants: transferring the stem tip of the infected explant into a selection medium, placing the selection medium in a constant temperature incubator for culturing 14 and d, and screening the selection medium to obtain the explant with resistance; transferring into an induced differentiation culture medium, and placing into a constant temperature incubator for culturing 7 d to obtain cluster seedlings with morphology of callus at the bottom; and transferring into rooting culture medium, and culturing in constant temperature incubator for 7 d to obtain edited plant.

In the above method, the culture conditions for the co-culture in the step (3) are as follows: 28. culturing in darkness at the temperature; the culture conditions of the constant temperature incubator in the rest steps are as follows: 25+ -2deg.C, light-dark cycle 12 h light/12 h dark, light intensity 2000 Lx;

in the method, the basic components of the seed culture medium are 1/2 MS dry powder, 12 g/L agar and 10 g/L sucrose, and the pH is 5.7;

in the method, the basic components of the co-culture medium are MS dry powder, 8 g/L agar, 30 g/L sucrose and 100-200 mu mol/L acetosyringone, and the pH is 5.4;

in the method, the basic components of the selection medium are MS dry powder, 8 g/L agar, 30 g/L sucrose, 1-5 mg/L hygromycin, 0.3 mg/L NAA, 0.5 mg/L KT and pH 5.8;

in the method, the basic components of the induced differentiation culture medium are MS dry powder, 8 g/L agar, 30 g/L sucrose, 2 mg/L2, 4-D, 0.2 mg/L KT and pH 5.8;

in the method, the rooting culture medium comprises the basic components of MS dry powder, 8 g/L agar, 30 g/L sucrose, 0.5 mg/L NAA and pH 5.8.

The PDS gene is taken as an example to edit alfalfa plants, and a high-efficiency genetic transformation system for identifying positive edited seedlings in a short time is established on the basis of the genetic transformation system without a tissue culture process.

Compared with the prior art, the invention has the beneficial effects that:

1. the method does not need the traditional tissue culture induced callus re-differentiation process; based on CRISPR/Cas9 technology, hypocotyl or leaf of alfalfa is not selected to carry out gene editing through a callus induction way, but a direct stem tip differentiation induction way is adopted to obtain editing seedlings; the invention takes the alfalfa stem tip with complete shape and meristematic position as the explant, can be obtained by directly cutting from aseptic seedlings, and is convenient to operate.

2. In the invention, vacuum filtration is used during infection to destroy the integrity of cells, so that bacterial liquid can better infect the explant and more efficiently introduce exogenous DNA molecules;

3. compared with the traditional agrobacterium-mediated alfalfa high-efficiency stem tip genetic transformation system, the transformation efficiency of the method is 10.42%, the average transformation efficiency of different varieties of alfalfa is 33.33% and 34.00%, and the average regeneration period is about 28 d; and can obtain CRISPR/Cas9 editorial positive plants with consistent phenotype through resistance screening and sequencing identification; the system is applicable to alfalfa with various genotypes;

4. the method has the advantages of short transformation period, high efficiency and simple and convenient identification, and establishes an efficient alfalfa gene editing genetic transformation system applicable to different varieties based on the CRISPR/Cas9 technology.

Drawings

FIG. 1 shows the results of gel electrophoresis for the identification of Agrobacterium positive strains for genetic transformation in the method of the invention.

FIG. 2 shows a clumped seedling of alfalfa '218TR' stem tip genetically transformed by the method of the invention with callus at the bottom of morphology formed on induced differentiation medium.

FIG. 3 is a phenotypic control of finally obtained edited plants YK-3, YK-5 and wild plants after genetic transformation by the method of the invention, wherein the stem tip of alfalfa 'tourist' edits the MsPDS gene based on the CRISPR/Cas9 technology.

FIG. 4 shows the PCR detection results of the edited plants YK-3, YK-5 and wild type plants obtained by the method of the present invention for alfalfa 'tourist': the PCR products of YK-3 and YK-5 plants have a bright band at the position of 1000-1100 bp, and the wild plants have a bright band at the position of 1100-1200 bp.

FIG. 5 is a comparison of sequencing results of edited plants YK-3, YK-5 obtained by alfalfa 'tourist' using the method of the present invention with wild type plants: a) Comparison of target sequence sequencing results, b) comparison of cleavage site sequencing results.

FIG. 6 is a graph showing the phenotypic control of alfalfa 'Sardi7' based on CRISPR/Cas9 technology editing MsPDS genes, and the edited plants pds obtained after genetic transformation using the method of the present invention, compared to wild plants.

FIG. 7 is a graph showing the phenotype control of the edited plant dg1 obtained by genetic transformation of alfalfa 'Paola' based on CRISPR/Cas9 technology with the MsDG1 gene using the method of the present invention and a wild plant.

Detailed Description

The invention is further illustrated by the following examples, in conjunction with the accompanying drawings, which are not intended to limit the invention.

The specific experimental conditions and methods not specified in the following examples, the technical means employed, are generally conventional means well known to those skilled in the art; materials, reagents, etc., not noted, are commercially available.

Example 1:

(1) Construction of alfalfa PDS gene CRISPR editing vector

GV3101/PHEE401-MtPDS-1B is a recombinant Agrobacterium obtained by introducing a PHEE401-MtPDS-1B gene editing plasmid vector into Agrobacterium GV 3101; wherein plasmid PHEE401 is from Chen Jijun laboratory (Wang et al, 2015): the vector takes a pCambia vector as a framework, uses a medicago truncatula U6 promoter to drive sgRNA, and uses a 35S promoter to drive Cas9 protein; and a 19 bp sgRNA sequence (5'-TCCTTCCATCTCCGTTAAA-3') was designed as a target for MsPDS.

(2) Detection of positive Agrobacterium

The successfully constructed plasmid vector is transferred into GV3101 agrobacterium competence, and an upstream primer U6-26p-F is designed in the U6-26p region: TGTCCCAGGATTAGAATGATTAGGC, designing a downstream primer U6-26t-R in the U6-26t region: CCCCAGAAATTGAACGCCGAAGAAC; detecting and identifying the bacterial liquid which has been propagated, and screening out positive bacterial strains; as shown in FIG. 1, the PCR products of bacterial liquids 1, 4, 5, 8 and 9 have a single band at the position of 400-500 bp, and are consistent with the positive plasmid control, and the vector construction is successful.

(3) Preparation of stem tip explants: selecting alfalfa 'tourist' seeds with full seeds, soaking and sterilizing in 30% sodium hypochlorite (NaClO) in a 2 mL sterile EP tube for 15 min, washing with sterile water for 3 times, and air drying on sterilized filter paper; inoculating to a seed culture medium, placing in a constant temperature incubator for culturing for 3-4 days, selecting alfalfa seedlings without growing 3 rd true leaves, and cutting stem tip parts of the seedlings, which are close to the top meristem points by 3-5 mm.

(4) Preparation of agrobacterium and dye liquor: the strain GV3101/PHEE401-MtPDS-1B 100 mu L transferred into an editing vector and purified is taken and placed in 20 mL LB liquid medium (50 mg/L rifampicin and 50 mg/L kanamycin are added) for shaking culture at 28 ℃ and 90 r/min for 24 h; transferring into 300 mL LB liquid medium (50 mg/L rifampicin and 50 mg/L kanamycin are added) to perform shaking culture at 28 ℃ and 90 r/min for 12-18 h; when the bacterial liquid activity value OD600 is 0.6-0.9, the bacterial liquid is collected by centrifugation at 4000 r/min for 15 min at normal temperature, and is suspended in 20 mL MS liquid culture medium for standby.

(5) Acquisition of exogenous DNA molecule infected explants: immersing the stem tip explant into the agrobacterium tumefaciens bacteria liquid in the step (2) of 20 mL, removing a needle head from a 50 mL sterile disposable needle tube, performing vacuum suction filtration for 30 times, and standing for infection of 1 h; separating the bacterial solution and the explant, sucking the residual bacterial solution by using sterile filter paper on the stem tip, and placing the stem tip in a co-culture medium for dark culture of 3 d (28+/-2 ℃).

(6) Culturing alfalfa regeneration editing plants: transferring the stem tip of the infected explant into a selection medium, placing the selection medium in a constant temperature incubator for culturing 14 and d, and screening the selection medium to obtain the explant with resistance; transferring into an induced differentiation culture medium, and culturing in a constant temperature incubator for 7 d to obtain cluster seedlings with callus at the morphological bottom as shown in figure 2; and transferring into rooting culture medium, and culturing in a constant temperature incubator for 7 d to obtain the edited plant shown in figure 3.

In the above method, the culture conditions of the co-culture are as follows: 28. culturing in darkness at the temperature; the culture conditions of the constant temperature incubator in the rest steps are as follows: 25+ -2deg.C, light-dark cycle 12 h light/12 h dark, light intensity 2000 Lx;

in the method, the basic components of the seed culture medium are 1/2 MS dry powder, 12 g/L agar and 10 g/L sucrose, and the pH is 5.7;

in the method, the basic components of the co-culture medium are MS dry powder, 8 g/L agar, 30 g/L sucrose and 100 mu mol/L acetosyringone, and the pH is 5.4;

in the method, the basic components of the selection medium are MS dry powder, 8 g/L agar, 30 g/L sucrose, 1 mg/L hygromycin, 0.3 mg/L NAA, 0.5 mg/L KT and pH 5.8;

in the method, the basic components of the induced differentiation culture medium are MS dry powder, 8 g/L agar, 30 g/L sucrose, 2 mg/L2, 4-D, 0.2 mg/L KT and pH 5.8;

in the method, the rooting culture medium comprises the basic components of MS dry powder, 8 g/L agar, 30 g/L sucrose, 0.5 mg/L NAA and pH 5.8. (7) Positive identification of alfalfa editing plants

Alfalfa plant 'guest' varieties YK-3 and YK-5 leaves were selected that were significantly dwarfed compared to wild type after resistance screening (FIG. 3). Extracting genomic DNA of leaf, taking MsPDS as a detection template, detecting PCR amplification products by 1.2% agarose gel electrophoresis, cutting corresponding bands, purifying by using a gel recovery kit, and sequencing and checking, wherein the checking results are shown in FIG. 4 and FIG. 5: the PCR products of YK-3 and YK-5 plants have a bright band at the position of 1000-1100 bp, the wild plants have a bright band at the position of 1100-1200 bp, and the PCR detection result preliminarily shows that the MsPDS genes in the edited plants are sheared.

Wherein, the detection primers used are MsPDS-F (5'-AACAGTCCATGTGGACCAGTTAGC-3') and MsPDS-R (5'-CCAGCCATGCAAACCAGATTAGTG-3') primers;

wherein, the synthesis of the detection primer and the sequencing test of the corresponding band are all completed by Shanghai biological company.

The research realizes successful acquisition of the mutant in the T0 generation by taking the alfalfa stem tip as an explant of a genetic transformation system, thereby constructing an efficient alfalfa stem tip genetic transformation system and providing a theoretical basis for applying CRISPR/Cas9 technology to improvement of alfalfa characters.

In the example, 50 stem tips of 'tourist' variety are selected as explants, the steps of the genetic transformation system are repeated for 3 times, and the transformation efficiency of the stem tips of 'tourist' in successfully transformed edited plants obtained after selection of the resistance of the culture medium can reach 33.33+/-6.11%

The data representation method comprises the following steps: means+sem, editing efficiency% = 20 mg ·l-1 kanamycin and 1 mg ·l-1 hygromycin after selection of regenerated shoots formation number per number of inoculated explants.

Example 2:

(1) Construction of alfalfa PDS gene CRISPR editing vector

GV3101/PHEE401-MtPDS-1B is a recombinant Agrobacterium obtained by introducing a PHEE401-MtPDS-1B gene editing plasmid vector into Agrobacterium GV 3101; wherein plasmid PHEE401 is from Chen Jijun laboratory (Wang et al, 2015): the vector takes a pCambia vector as a framework, uses a medicago truncatula U6 promoter to drive sgRNA, and uses a 35S promoter to drive Cas9 protein; and a 19 bp sgRNA sequence (5'-TCCTTCCATCTCCGTTAAA-3') was designed as a target for MsPDS.

(2) Detection of positive Agrobacterium

The successfully constructed plasmid vector is transferred into GV3101 agrobacterium competence, and an upstream primer U6-26p-F is designed in the U6-26p region: TGTCCCAGGATTAGAATGATTAGGC, designing a downstream primer U6-26t-R in the U6-26t region: CCCCAGAAATTGAACGCCGAAGAAC; detecting and identifying the bacterial liquid which has been propagated, and screening out positive bacterial strains; as shown in FIG. 1, the PCR products of bacterial liquids 1, 4, 5, 8 and 9 have a single band at the position of 400-500 bp, and are consistent with the positive plasmid control, and the vector construction is successful.

(3) Preparation of stem tip explants: selecting alfalfa 'Sardi7' seeds with full seeds, placing the seeds in a 2 mL aseptic EP tube, soaking and sterilizing the seeds in 30% sodium hypochlorite (NaClO) in an ultra-clean workbench for 15 min, washing the seeds with sterile water for 3 times, and then placing the seeds on sterilized filter paper for air drying; inoculating to a seed culture medium, placing in a constant temperature incubator for culturing for 3-4 days, selecting alfalfa seedlings without growing 3 rd true leaves, and cutting stem tip parts of the seedlings, which are close to the top meristem points by 3-5 mm.

(4) Preparation of agrobacterium and dye liquor: the strain GV3101/PHEE401-MtPDS-1B 100 mu L transferred into an editing vector and purified is taken and placed in 20 mL LB liquid medium (50 mg/L rifampicin and 50 mg/L kanamycin are added) for shaking culture at 28 ℃ and 90 r/min for 24 h; transferring into 300 mL LB liquid medium (50 mg/L rifampicin and 50 mg/L kanamycin are added) to perform shaking culture at 28 ℃ and 90 r/min for 12-18 h; when the bacterial liquid activity value OD600 is 0.6-0.9, the bacterial liquid is collected by centrifugation at 4000 r/min for 15 min at normal temperature, and is suspended in 20 mL MS liquid culture medium for standby.

(5) Acquisition of exogenous DNA molecule infected explants: immersing the stem tip explant into the agrobacterium tumefaciens bacteria liquid in the step (2) of 20 mL, removing a needle head from a 50 mL sterile disposable needle tube, performing vacuum suction filtration for 30 times, and performing rotary infection on a rotary mixer for 1 h; separating the bacterial solution and the explant, sucking the residual bacterial solution by using sterile filter paper on the stem tip, and placing the stem tip in a co-culture medium for dark culture of 3 d (28+/-2 ℃).

(6) Culturing alfalfa regeneration editing plants: transferring the stem tip of the infected explant into a selection medium, placing the selection medium in a constant temperature incubator for culturing 14 and d, and screening the selection medium to obtain the explant with resistance; transferring into an induced differentiation culture medium, and placing into a constant temperature incubator for culturing 7 d to obtain cluster seedlings with morphology of callus at the bottom; and transferring into rooting culture medium, and culturing in constant temperature incubator 7-d to obtain the edited plant shown in figure 6.

In the above method, the culture conditions of the co-culture are as follows: 28. culturing in darkness at the temperature; the culture conditions of the constant temperature incubator in the rest steps are as follows: 25+ -2deg.C, light-dark cycle 12 h light/12 h dark, light intensity 2000 Lx;

in the method, the basic components of the seed culture medium are 1/2 MS dry powder, 12 g/L agar and 10 g/L sucrose, and the pH is 5.7;

in the method, the basic components of the co-culture medium are MS dry powder, 8 g/L agar, 30 g/L sucrose and 100 mu mol/L acetosyringone, and the pH is 5.4;

in the method, the basic components of the selection medium are MS dry powder, 8 g/L agar, 30 g/L sucrose, 5 mg/L hygromycin, 0.3 mg/L NAA, 0.5 mg/L KT and pH 5.8;

in the method, the basic components of the induced differentiation culture medium are MS dry powder, 8 g/L agar, 30 g/L sucrose, 2 mg/L2, 4-D, 0.2 mg/L KT and pH 5.8;

in the method, the rooting culture medium comprises the basic components of MS dry powder, 8 g/L agar, 30 g/L sucrose, 0.5 mg/L NAA and pH 5.8.

The research realizes successful acquisition of the mutant in the T0 generation by taking the alfalfa stem tip as an explant of a genetic transformation system, thereby constructing an efficient alfalfa stem tip genetic transformation system and providing a theoretical basis for applying CRISPR/Cas9 technology to improvement of alfalfa characters.

In the example, 50 stem tips of the 'Sardi7' variety are selected as explants, the steps of the genetic transformation system are repeated for 3 times, and the transformation efficiency of the stem tips of the 'Sardi7' variety can reach 34.00+/-10.00% in successfully transformed editing plants obtained after selection of the medium resistance.

The data representation method comprises the following steps: means+sem, editing efficiency% = 20 mg ·l-1 kanamycin and 1 mg ·l-1 hygromycin after selection of regenerated shoots formation number per number of inoculated explants.

The above is only a preferred embodiment of the present invention, and is not intended to limit the present invention, and it is still possible for those skilled in the art to modify the technical solutions described in the foregoing embodiments or to make equivalent substitutions for some of the technical features thereof. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims (3)

1. The efficient genetic transformation system of alfalfa based on CRISPR/Cas9 technology is different from the traditional plant gene editing genetic transformation system, and can directly carry out genetic transformation on the stem tip of alfalfa without inducing callus; provides an important system construction technology for alfalfa gene editing breeding and molecular level research, and particularly can solve the bottleneck of tissue culture technology that alfalfa is difficult to form callus, long in culture period, low in conversion efficiency and the like.

2. The method according to claim 1, characterized in that:

1) Constructing an editing vector of CRISPR/Cas9 based on an MsPDS gene, and providing a rapid phenotype identification method for gene editing;

2) Providing a set of alfalfa stem tip genetic transformation system without a tissue culture process;

3) The efficiency of alfalfa gene editing is improved;

4) The editing efficiency of alfalfa with different genotypes is higher.

3. The feature of claim 2 (2), wherein:

the CRISPR/Cas9 technology-based double-target gene editing genetic transformation is directly carried out by using alfalfa stem tips as explants, and comprises the steps of preparation of alfalfa stem tip explants, construction of double-target gene editing vectors, acquisition of exogenous DNA molecule infection explants, screening of resistant explants, cultivation of explants with clustered buds, acquisition of alfalfa regeneration editing plants and the like.