CN111893138A - Agrobacterium-mediated sugarcane growth point genetic transformation method - Google Patents

Abstract

The invention discloses a method for agrobacterium-mediated genetic transformation of sugarcane growing points, which belongs to the technical field of sugarcane cultivation₁Differentiation Medium M₂Rooting medium M₃Transformation Medium MR and Co-Medium M₄Inducing and differentiating the sugarcane callus, preparing agrobacterium engineering bacteria liquid, carrying out genetic transformation on sugarcane growing points by using agrobacterium mediation, and detecting transgenic plants. The invention shortens the time of obtaining the transformed plant from the sugarcane, improves the transformation efficiency, and expresses the pCAMBIA3301 plant by the agrobacterium-mediated transformation technologyThe vector is introduced into GT35 sterile seedlings, 353 resistant plants are obtained through screening of a screening culture medium, PCR detection is carried out on the resistant plants, 333 plants become positive, the positive rate reaches 94.33%, and the result shows that the exogenous gene is successfully introduced into sugarcane.

Description

Agrobacterium-mediated sugarcane growth point genetic transformation method

Technical Field

The invention relates to the technical field of sugarcane cultivation, in particular to a method for agrobacterium-mediated genetic transformation of sugarcane growing points.

Background

Because the sugarcane is an aneuploid allopolyploid crop, the genetic background is complex, the separation of filial generation among varieties is wide, the genetic rule is difficult to be clarified by the conventional genetics means, various excellent target characters are difficult to be integrated by the conventional cross breeding means, and the molecular breeding is an important means for obtaining the excellent variety of the sugarcane. At present, methods mainly used in sugarcane genetic transformation include an agrobacterium-mediated method and a gene gun bombardment method, and receptors for transformation are embryogenic callus regardless of the agrobacterium-mediated method or the gene gun bombardment method. The traditional methods are all under the conditions of long plant transformation time and low efficiency, and can not meet the requirements of the existing society.

Disclosure of Invention

The invention aims to provide a method for agrobacterium-mediated genetic transformation of sugarcane growing points, which solves the technical problem that callus is difficult to regenerate after agrobacterium transformation in the conventional sugarcane cultivation, shortens the time for obtaining transformed plants and improves the transformation efficiency.

A method for agrobacterium-mediated genetic transformation of a sugar cane growing point, the method comprising the steps of:

step 1: selecting genetically transformed sugarcane materials, strains and plasmids;

step 2: preparation of callus for induction cultureNutrient M₁Differentiation Medium M₂Rooting medium M₃Transformation Medium MR and Co-Medium M₄；

And step 3: inducing and differentiating the sugarcane callus;

and 4, step 4: preparing agrobacterium engineering bacteria liquid;

and 5: carrying out genetic transformation on a sugarcane growing point by using agrobacterium mediation;

step 6: and detecting the transgenic plants.

Furthermore, in the step 1, the sugarcane material is cassia sugar No. 35, the strains are escherichia coli strain JM109 and agrobacterium tumefaciens strain EHA105, the plasmid is pCAMBIA3301, and the plasmid contains a CaMV 35s promoter and a Bar gene for coding herbicide-resistant glufosinate-methyl.

Further, in the step 2, callus induction medium M₁MS +2, 4-D3.0 mg/L + coconut juice 100ml/L + sucrose 30g/L + Agar6g/L, callus induction culture medium M₁pH of 5.8, differentiation Medium M₂Is MS +6-BA2.0mg/L + NAA 0.1mg/L + coconut juice 100ml/L + cane sugar 30g/L + Agar6g/L, differentiation culture medium M₂The pH of (1) is 5.8, rooting medium M₃MS, NAA4.0mg/L, coconut juice 100ml/L, cane sugar 30g/L and rooting medium M₃pH of 5.8, transformation medium MR 1/2MS macroelement, [ MS macroelement: ammonium Nitrate (NH)₄NO₃) Potassium nitrate (KNO)₃) Magnesium sulfate (MgSO)₄·7H₂O), potassium dihydrogen phosphate (KH)₂PO₄)]+ MS other components (MS other components specifically mean [ trace elements: potassium iodide (KI)), boric acid (H)₃BO₃) Manganese sulfate (MnSO)₄·4H₂O), zinc sulfate (ZnSO)₄·7H₂O), sodium molybdate (Na)₂MoO₄·2H₂O), copper sulfate (CuSO)₄·5H₂O), cobalt chloride (CoCl)₂·6H₂O); iron salt: FeSO₄·7H₂O、Na₂-EDTA·2H₂O; organic matter composition: inositol, IVB nicotinic acid, pyridoxine hydrochloride, thiamine hydrochloride, glycine)]+2, 4-D1.0 mg/L + sucrose 30g/L + AS 200. mu. mol/L + glucose 10mmol/L + fruitSugar 10mmol/L, pH of transformation Medium MR 5.3, cocultivation Medium M₄MS +6-BA2.0mg/L + NAA 0.1mg/L + coconut juice 100ml/L + cane sugar 30g/L + Agar6g/L + AS 100 mu mol/L, and a coculture medium M₄The pH of (3) was 5.8.

Further, the specific process of the step 3 is that the tail tips of sugarcane plants growing strongly in the field are selected, the leaves are peeled off, the tail tips of 28-32cm are reserved, the surface is disinfected by 75% ethanol, the outer leaf sheaths of 4-5 layers are peeled off and then placed in a super clean workbench, tender heart leaf tissues which are 9-11cm away from the growing point at the top end of the heart leaf tissues are taken as explants, the heart leaf tissues are transversely cut into slices with the thickness of 0.2-0.5 mm and inoculated in a callus induction culture medium M₁Culturing at 27 deg.C in dark for 15-20 days, expanding explant, growing water-soaked callus on the edge, and inoculating the water-soaked callus into new callus induction culture medium M₁Subculture for proliferation for 15-20 days until light yellow, dry and compact embryogenic callus grows out, wherein the number of times of transfer is 2-3, picking up embryogenic callus, peeling into small particles with uniform size on super clean bench, transferring into callus differentiation culture medium M₂In a light incubator at 27 deg.C for 2000Lx for 16 hr per day and 8 hr per day, inducing germination, and culturing in a new callus differentiation culture medium M15-20 days later₂Culturing medium and strong seedlings.

Further, the specific process of step 4 is as follows: freezing EHA105 Agrobacterium strain containing pCAMBIA3301 plasmid in a-80 deg.C refrigerator, taking EHA105 Agrobacterium strain containing pCAMBIA3301 plasmid from the refrigerator, streaking on YEP (bacterial culture medium) plate containing Kan (kanamycin) and rifampicin, culturing at 28 deg.C for 48h, selecting partial single colony, inoculating to 10ml YEP liquid culture medium containing Kan and rifampicin, culturing at 28 deg.C and 200rpm under shaking to logarithmic growth phase;

putting 1ml of bacterial liquid into 50ml of YEP liquid culture medium containing Kan and rifampicin, oscillating and culturing at 28 ℃, 200rpm until OD value and absorbance are reached, wherein the OD value is 0.5-0.6 which is a very important parameter for measuring thallus density or thallus biomass in the field of microorganisms;

transferring the bacterial liquid into a centrifugal tube, centrifuging at 4 ℃ and 5000rpm for 5-8min, removing supernatant, and collecting thalli;

the cells were resuspended in an equal volume of the transformation medium MR liquid medium containing 200. mu. mol/L Acetosyringone (AS) and cultured at 28 ℃ for 2 hours at 200 rpm.

Further, the specific process of step 5 is as follows: selecting sugarcane seedlings growing vigorously on a differentiation medium M2 as transformation materials;

dividing the plant into individual plants on a clean bench by using forceps, cutting off the individual plants 1cm away from the root by using medical scissors, removing the upper part with leaves, and reserving young stems containing growth points, wherein the young stems are small stem sections of 1 cm;

transferring the small stem segment into a culture bottle, adding an agrobacterium liquid activated by 200 mu mol/LAS for 2h, and carrying out dip dyeing for about 5-10 min, wherein the period is slightly oscillated;

taking out the bacteria solution with tweezers after 5-10 min, sucking the bacteria solution with sterile filter paper, transferring the bacteria solution into sterile water for cleaning for 2-3 times, sucking the bacteria solution with sterile paper, transferring the bacteria solution to a co-culture medium M without antibiotics₄Culturing for 4 days;

then transferred into a rooting culture medium M containing 500mg/L of cefuroxime and 0.4mg/L of herbicide (PPT)₃Performing the following steps;

through PPT screening, the resistant seedlings are transferred to a rooting culture medium M without antibiotics₃The culture is recovered for 4 days;

opening the bottle cap, moving to the outdoor, hardening off seedlings, taking out the seedlings after 2 days, washing attached culture medium with running water, culturing in a greenhouse with 80% of air relative humidity, and planting the seedlings in a tray filled with nutrient soil in a single plant mode after the seedlings survive.

Further, the specific process of step 6 is as follows: extracting genome DNA from robust transgenic plant leaves by using a kit, diluting the genome DNA to 20-40 ng/mu l, taking the diluted genome DNA as a template, and using primers 3301-F1: CATTTGGAGAGGACACGCTG; 3301-R1: CAAATCTCGGTGACGGGCAG, performing PCR amplification, and establishing empty white water control group, positive control group and negative control group, wherein the positive control group is plasmid pCAMBIA3301, and the negative control group is untransformed sugarcane GT35 genome DNA.

Further, the PCR (polymerase chain reaction) reaction system is:

the PCR reaction program is: at 95 ℃ for 5min, 95 ℃ for 50sec, 58 ℃ for 30sec, 72 ℃ for 1min for 35 cycles, and at 72 ℃ for 5min, the PCR product was detected by electrophoresis on 1.0% agarose gel.

In the test, GT35 is used as an experimental material, a pCAMBIA3301 plant expression vector is introduced into GT35 sterile seedlings by an agrobacterium-mediated transformation technology, and 353 resistant plants are obtained by screening through a screening culture medium. The PCR detection is carried out on the resistant plants, 333 plants become positive, and the positive rate reaches 94.33%. Indicating that the exogenous gene is successfully introduced into the sugarcane.

By adopting the technical scheme, the invention has the following technical effects:

the invention shortens the time of obtaining transformed plants from sugarcane, improves the transformation efficiency, introduces pCAMBIA3301 plant expression vectors into GT35 sterile seedlings by an agrobacterium-mediated transformation technology, obtains 353 resistant plants by screening a culture medium, carries out PCR detection on the resistant plants, proves that 333 plants have positive property, the positive rate reaches 94.33 percent, and indicates that exogenous genes are successfully introduced into the sugarcane, the receptor material adopts the meristem of a growing point of the sugarcane, the growing point is positioned at the top of a stem tip, the cells of the growing point are continuously divided and differentiated to generate a new stem structure, the stem is extended, monocotyledons are not natural hosts of the agrobacterium, the infection of the agrobacterium to the monocotyledons is improved, the mechanical damage to the receptor is an important condition for the agrobacterium to invade the cells, the invention cuts off the upper part of the seedlings by scissors, exposes the growing point and appropriately causes wound surfaces on the growing point, the cut off the growing point by preventing the section from being too deep in the operation, the growth site is then exposed sufficiently and a wound is created to allow sufficient interaction of the receptor with the Agrobacterium.

Drawings

FIG. 1 is a diagram of loose, yellow, water-soaked callus according to the present invention.

FIG. 2 is a diagram of a light yellow, dry, dense embryogenic callus of the present invention.

FIG. 3 is a diagram of a sugarcane plantlet of the invention.

FIG. 4 is a flow chart of PCR detection according to the present invention.

FIG. 5 is a diagram of resistant plants obtained by PPT screening according to the present invention.

FIG. 6 is a diagram showing the result of PCR detection of the transgenic plant of the present invention.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, preferred embodiments are given and the present invention is described in further detail. It should be noted, however, that the numerous details set forth in the description are merely for the purpose of providing the reader with a thorough understanding of one or more aspects of the present invention, which may be practiced without these specific details.

A method for agrobacterium-mediated genetic transformation of a sugar cane growing point, the method comprising the steps of:

1.1 plant Material, Strain, plasmid

The genetic transformation material is Guangxi Zhuang autonomous region agronomy academy of sciences sugarcane research institute self-breeding sweet variety 'Guitang No. 35 (GT 35)'. Escherichia coli strain JM109, Agrobacterium tumefaciens strain EHA105 and plasmid pCAMBIA3301 stored in the research laboratory are binary expression vectors commonly used for plant transgenosis, and contain CaMV 35s promoter and Bar gene encoding herbicide-resistant glufosinate (PPT).

1.2 preparation of basic culture medium:

callus induction culture medium M₁: MS +2, 4-D3.0 mg/L + coconut juice 100ml/L + sucrose 30g/L + Agar6g/L, pH 5.8.

Differentiation Medium M₂: MS +6-BA2.0mg/L + NAA 0.1mg/L + coconut juice 100ml/L + cane sugar 30g/L + Agar6g/L, and pH is 5.8.

Rooting medium M₃: MS + NAA4.0mg/L + coconut juice 100ml/L + sucrose 30g/L, pH 5.8.

The transformation medium MR is 1/2MS macroelements + other components of MS +2, 4-D1.0 mg/L + sucrose 30g/L + AS 200. mu. mol/L + glucose 10mmol/L + fructose 10mmol/L, pH 5.3.

Co-Medium M₄：M₂+AS 100μmol/L，pH5.8。

Callus induction and differentiation

Selecting strong sugarcane plant tail tips growing in the field, peeling off leaves, reserving about 30cm tail tips, and bringing back to the laboratory. Sterilizing the surface with 75% ethanol, removing 4-5 layer outer leaf sheath, placing in a superclean workbench, collecting tender heart leaf tissue about 10cm away from the top growth point as explant, cross-cutting into 0.2-0.5 mm thick slices, and inoculating to callus induction culture medium (M)₁) And culturing at 27 deg.C in dark for 15-20 days to make the explant expand and grow water-soaked callus on the edge. The water-soaked callus is divided into small blocks and is connected into a new culture medium for subculture multiplication; subculture once in 15-20 days until light yellow, dry and compact embryogenic callus is grown (generally, transferring for 2-3 times).

Picking up good embryogenic callus, peeling into small particles with uniform size on a super clean bench, transferring into callus differentiation medium (M)₂) In the light incubator, the light is used for inducing the sprouting at 27 ℃ and 2000Lx for 16 hours every day and the darkness is used for 8 hours. Transferring to new culture medium after 15-20 days for strong seedling culture.

Preparation of agrobacterium engineering bacteria liquid:

1. the EHA105 Agrobacterium strain containing the pCAMBIA3301 plasmid was removed from the-80 ℃ freezer, streaked on YEP plates containing Kan and rifampicin, cultured at 28 ℃ for 48 hours, and a part of a single colony was picked up and inoculated into 10ml of YEP liquid medium containing Kan and rifampicin, cultured at 28 ℃ with shaking at 200rpm until logarithmic growth phase.

2. Taking 1ml of the bacterial liquid, putting the bacterial liquid into 50ml of YEP liquid culture medium containing Kan and rifampicin, and carrying out shaking culture at 28 ℃ and 200rpm until the OD is 0.5-0.6.

3. Transferring the bacterial liquid into a centrifuge tube, centrifuging for 5-8min at 4 ℃ and 5000rpm, discarding the supernatant, and collecting the thalli.

4. The cells were resuspended in an equal volume of MR liquid medium containing 200. mu. mol/L Acetosyringone (AS), and cultured at 28 ℃ and 200rpm for 2 hours.

Agrobacterium-mediated genetic transformation of sugarcane growing points

1. Is selected at M₂The vigorous sugarcane seedlings grown on the culture medium are used as transformation materials.

2. The plant is divided into individual plants on a clean bench by using tweezers, and the individual plants are cut off by using medical scissors about 1cm away from the root, the parts with leaves on the upper surface are removed, and a small segment of young stem (about 1cm of small stem segment) containing a growing point is reserved.

3. The small stem segments were transferred to a culture flask, and Agrobacterium fluid activated with AS (200. mu. mol/L) for 2h was added, and the mixture was dip-stained for about 5-10 min with gentle shaking.

Taking out the bacteria solution with tweezers after 4.5-10 min, sucking the bacteria solution with sterile filter paper, transferring the bacteria solution into sterile water for cleaning for 2-3 times, sucking the bacteria solution with sterile paper, and transferring the bacteria solution to M without antibiotics₄On the medium, the culture was carried out for 4 days.

5. Then transferred into M containing 500mg/L of cefuroxime and 0.4mg/L of PPT₃In a culture medium.

6. Through PPT screening, resistant seedlings are transferred to M without antibiotics₃The culture was resumed on the medium for 4 days.

7. Opening the bottle cap, moving to the outdoor, hardening off seedlings, taking out the seedlings after 2 days, washing attached culture medium with running water, culturing in a greenhouse with 80% of air relative humidity, and planting the seedlings in a tray filled with nutrient soil in a single plant mode after the seedlings survive.

Detection of transgenic plants

And (3) PCR amplification: and (3) taking the strong transgenic plant leaves and extracting genome DNA by using the kit. Diluting the DNA to 20-40 ng/. mu.l, using the DNA as a template, and using primers 3301-F1: CATTTGGAGAGGACACGCTG; 3301-R1: CAAATCTCGGTGACGGGCAG, PCR amplification was performed, setting up a blank control (water), a positive control (plasmid pCAMBIA3301) and a negative control (untransformed sugarcane GT35 genomic DNA). The PCR reaction procedure and system are as follows: PCR reaction (20. mu.l):

PCR reaction procedure:

5min at 95 ℃; 35 cycles of 95 ℃ 50sec, 58 ℃ 30sec, 72 ℃ 1 min; 5min at 72 ℃. The PCR product was detected by electrophoresis on a 1.0% agarose gel.

2. Results and analysis

2.1 Induction and differentiation of sugarcane embryogenic callus

Cutting folium Ginkgo in M₁Approximately one week after the upper culture, swelling began and water-stained callus began to grow from the leaf edges (FIG. 1). After culturing for 15-20 days, the whole explant forms loose, yellow and water-soaked callus. Dividing the first induced callus into small pieces and transferring to new M₁Subculturing in the culture medium to obtain light yellow, dry and compact embryogenic callus (FIG. 2). The differentiation ability of the embryogenic callus is very strong, and the embryogenic callus is transferred into M₂Green bud point is formed about 7 days after the culture medium is differentiated, the seedling with length of 2-3cm is obtained after about 15-20 days, and the seedling is transplanted into M₂The culture was continued until the height of the plantlets was about 4-5cm, as shown in FIG. 3.

2.2 Agrobacterium-mediated transformation of growing points of sugarcane seedlings

Through an agrobacterium-mediated method, a plant expression vector pCAMBIA3301 is used for carrying out genetic transformation on a growing point of a sugarcane seedling, as shown in figure 4, a resistant plant is obtained through PPT screening, as shown in figure 5, and subsequent PCR detection can be carried out after the resistant plant grows to 4-5 cm.

2.3 PCR detection of resistant plants

The kit is adopted to extract the DNA of the leaf blade of the resistant plant, and PCR amplification detection is carried out by using detection primers 3301-F1 and 3301-R1. 333 resistant plants amplified fragments consistent with the expected size, and the results initially indicated that pCAMBIA3301 had successfully integrated into the sugarcane genome, and partial results are shown in FIG. 6.

FIG. 6 PCR assay of transgenic plants, 1: marker DL 2000; 2: blank control (water); 3: negative control (untransformed sugarcane plants); 4: positive control (plasmid DNA); 5-25: a transgenic sugarcane plant.

Because the genetic basis of sugarcane is narrow, and the sugarcane is an aneuploid allopolyploid crop, the genetic background is complex, and the agrobacterium-mediated genetic transformation efficiency of the sugarcane is not high. And the regeneration process of the sugarcane is long, and the somatic cell mutation is easy to generate. Therefore, the selection of a proper transformation receptor effectively avoids the regeneration process, and establishes a transformation system which is not limited by the genotype, which is the key point of the research on sugarcane transgenosis at present. The experimental receptor material adopts the meristem of the growing point of the sugarcane, the growing point is positioned at the top end of the stem tip, and the cells of the experimental receptor material are continuously divided and differentiated to generate a new stem structure, so that the stem is elongated. Monocotyledons are not natural hosts of agrobacterium, and the important condition for the agrobacterium to invade cells is to improve the infectivity of the agrobacterium to the monocotyledons and artificially cause mechanical damage to receptors. The upper part of a seedling is cut off by scissors for the experiment, a growing point is exposed, a wound surface is properly formed on the growing point, the growing point is cut off by preventing the cut surface from being too deep, the growing point is fully exposed and a wound is generated during operation, so that the receptor and the agrobacterium are fully interacted, and the aim of genetic transformation of the exogenous gene is fulfilled.

In the test, GT35 is used as an experimental material, a pCAMBIA3301 plant expression vector is introduced into GT35 sterile seedlings by an agrobacterium-mediated growth point transformation technology, and 353 resistant plants are obtained through screening by a screening culture medium. The PCR detection is carried out on the resistant plants, 333 plants become positive, and the positive rate reaches 94.33%. Indicating that the exogenous gene is successfully introduced into the sugarcane.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that those skilled in the art can make various improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be construed as the protection scope of the present invention.

Claims (8)

1. A method for agrobacterium-mediated genetic transformation of a sugar cane growing point, comprising the steps of:

step 1: selecting genetically transformed sugarcane materials, strains and plasmids;

step 2: preparing callus induction culture medium M₁Differentiation Medium M₂Rooting medium M₃Transformation Medium MR and Co-Medium M₄；

And step 3: inducing and differentiating the sugarcane callus;

and 4, step 4: preparing agrobacterium engineering bacteria liquid;

and 5: carrying out genetic transformation on a sugarcane growing point by using agrobacterium mediation;

step 6: and detecting the transgenic plants.

2. The method of claim 1, wherein the agrobacterium-mediated genetic transformation of the sugarcane growth site comprises: in the step 1, the sugarcane material is cassia sugar No. 35, the strains are escherichia coli strain JM109 and agrobacterium tumefaciens strain EHA105, the plasmid is pCAMBIA3301, and the plasmid contains a CaMV 35s promoter and a Bar gene for coding herbicide-resistant glufosinate-methyl.

3. The method of claim 2, wherein the agrobacterium-mediated genetic transformation of the sugarcane growth site comprises: in the step 2, callus induction culture medium M₁MS +2, 4-D3.0 mg/L + coconut juice 100ml/L + sucrose 30g/L + Agar6g/L, callus induction culture medium M₁pH of 5.8, differentiation Medium M₂Is MS +6-BA2.0mg/L + NAA 0.1mg/L + coconut juice 100ml/L + cane sugar 30g/L + Agar6g/L, differentiation culture medium M₂The pH of (1) is 5.8, rooting medium M₃MS + NAA4.0mg/L + coconut juice 100ml/L + cane sugar 30g/L, rooting culture medium M₃The pH of (1) is 5.8, the transformation medium MR is 1/2MS macroelements + MS other components +2, 4-D1.0 mg/L + sucrose 30g/L + AS 200. mu. mol/L + glucose 10mmol/L + fructose 10mmol/L, the pH of the transformation medium MR is 5.3, and the co-culture medium M is₄Is MS +6-BA2.0mg/L + NAA 0.1mg/L + coconut juice 100ml/L + sucrose 30g/L + Agar6g/L + AS 100 mu mol/L, and co-culture medium M₄Has a pH of 5.8, and MS macroelements include ammonium Nitrate (NH)₄NO₃) Potassium nitrate (KNO)₃) Magnesium sulfate (MgSO)₄·7H₂O) and potassium dihydrogen phosphate (KH)₂PO₄) The other components of MS comprise trace elements, iron salt and organic matter, wherein the trace elements comprise potassium iodide (KI) and boric acid (H)₃BO₃) Manganese sulfate (MnSO)₄·4H₂O), zinc sulfate (ZnSO)₄·7H₂O), sodium molybdate (Na)₂MoO₄·2H₂O), copper sulfate (CuSO)₄·5H₂O), cobalt chloride (CoCl)₂·6H₂O); iron salt: FeSO₄·7H₂O、Na₂-EDTA·2H₂O; the organic components comprise inositol, IVB nicotinic acid, pyridoxine hydrochloride, thiamine hydrochloride and glycine.

4. The method of claim 3, wherein the agrobacterium-mediated genetic transformation of the sugarcane growth site comprises: selecting the tail tips of sugarcane plants which grow vigorously in the field, peeling off leaves, reserving the tail tips of 28-32cm, disinfecting the surface with 75% ethanol, peeling off 4-5 outer leaf sheaths, placing the sugarcane plants in a super clean workbench, taking tender heart leaf tissues 9-11cm away from a top growing point as explants, transversely cutting the heart leaf tissues into thin slices with the thickness of 0.2-0.5 mm, and inoculating the slices to a callus induction culture medium M₁Culturing at 27 deg.C in dark for 15-20 days, expanding explant, growing water-soaked callus on the edge, and inoculating the water-soaked callus into new callus induction culture medium M₁Subculture for proliferation for 15-20 days until light yellow, dry and compact embryogenic callus grows out, wherein the number of times of transfer is 2-3, picking up embryogenic callus, peeling into small particles with uniform size on super clean bench, transferring into callus differentiation culture medium M₂In a light incubator at 27 deg.C for 2000Lx for 16 hr per day and 8 hr per day, inducing germination, and culturing in a new callus differentiation culture medium M15-20 days later₂Culturing medium and strong seedlings.

5. The method of claim 4, wherein the agrobacterium-mediated genetic transformation of the sugarcane growth site comprises: the specific process of the step 4 is as follows: placing the EHA105 agrobacterium strain containing pCAMBIA3301 plasmid into a refrigerator at-80 ℃ for storage, taking the EHA105 agrobacterium strain containing pCAMBIA3301 plasmid out of the refrigerator, streaking on a YEP plate containing Kan and rifampicin, culturing at 28 ℃ for 48h, selecting a part of single colony, inoculating into 10ml YEP liquid culture medium containing Kan and rifampicin, culturing at 28 ℃, and carrying out shaking culture at 200rpm until logarithmic growth phase;

putting 1ml of the bacterial liquid into 50ml of YEP liquid culture medium containing Kan and rifampicin, and carrying out shaking culture at the temperature of 28 ℃ and 200rpm until the OD is 0.5-0.6;

transferring the bacterial liquid into a centrifugal tube, centrifuging at 4 ℃ and 5000rpm for 5-8min, removing supernatant, and collecting thalli;

the thalli is resuspended in the equal volume of transformation medium MR liquid medium containing 200umol/L acetosyringone, the temperature is 28 ℃, and the culture is carried out for 2 hours at 200 rpm.

6. The method of claim 5, wherein the agrobacterium-mediated genetic transformation of the sugarcane growth site comprises: the specific process of the step 5 is as follows: selected in differentiation medium M₂The sugarcane seedlings growing vigorously are used as transformation materials;

dividing the plant into individual plants on a clean bench by using forceps, cutting off the individual plants 1cm away from the root by using medical scissors, removing the upper part with leaves, and reserving young stems containing growth points, wherein the young stems are small stem sections of 1 cm;

transferring the small stem segment into a culture bottle, adding an agrobacterium liquid activated by 200 mu mol/LAS for 2h, and carrying out dip dyeing for about 5-10 min, wherein the period is slightly oscillated;

taking out the bacteria solution with tweezers after 5-10 min, sucking the bacteria solution with sterile filter paper, transferring the bacteria solution into sterile water for cleaning for 2-3 times, sucking the bacteria solution with sterile paper, transferring the bacteria solution to a co-culture medium M without antibiotics₄Culturing for 4 days;

then transferred into rooting culture medium M containing 500mg/L of cefuroxime and 0.4mg/LPPT₃Performing the following steps;

through PPT screening, the resistant seedlings are transferred to a rooting culture medium M without antibiotics₃The culture is recovered for 4 days;

opening the bottle cap, moving to the outdoor, hardening off seedlings, taking out the seedlings after 2 days, washing attached culture medium with running water, culturing in a greenhouse with 80% of air relative humidity, and planting the seedlings in a tray filled with nutrient soil in a single plant mode after the seedlings survive.

7. The method of claim 6, wherein the agrobacterium-mediated genetic transformation of the sugarcane growth site comprises: the specific process of the step 6 is as follows: extracting genome DNA from robust transgenic plant leaves by using a kit, diluting the genome DNA to 20-40 ng/mu l, taking the diluted genome DNA as a template, and using primers 3301-F1: CATTTGGAGAGGA CACGCTG; 3301-R1: CAAATCTCGGTGACGGGCAG, performing PCR amplification, and establishing empty white water control group, positive control group and negative control group, wherein the positive control group is plasmid pCAMBIA3301, and the negative control group is untransformed sugarcane GT35 genome DNA.

8. The method of claim 7, wherein the agrobacterium-mediated genetic transformation of the sugar cane growing point comprises: the PCR reaction system is as follows:

the PCR reaction program is: at 95 ℃ for 5min, 95 ℃ for 50sec, 58 ℃ for 30sec, 72 ℃ for 1min for 35 cycles, and at 72 ℃ for 5min, the PCR product was detected by electrophoresis on 1.0% agarose gel.

Images