CN117025609A - Rice tissue specific expression promoter and application thereof - Google Patents

Rice tissue specific expression promoter and application thereof Download PDF

Info

Publication number
CN117025609A
CN117025609A CN202311041985.8A CN202311041985A CN117025609A CN 117025609 A CN117025609 A CN 117025609A CN 202311041985 A CN202311041985 A CN 202311041985A CN 117025609 A CN117025609 A CN 117025609A
Authority
CN
China
Prior art keywords
os18r
promoter
rice
specific expression
rice tissue
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202311041985.8A
Other languages
Chinese (zh)
Inventor
林智敏
方少忠
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Biotechnology of Fujian Academy of Agricultural Science
Original Assignee
Institute of Biotechnology of Fujian Academy of Agricultural Science
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Biotechnology of Fujian Academy of Agricultural Science filed Critical Institute of Biotechnology of Fujian Academy of Agricultural Science
Priority to CN202311041985.8A priority Critical patent/CN117025609A/en
Publication of CN117025609A publication Critical patent/CN117025609A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8209—Selection, visualisation of transformants, reporter constructs, e.g. antibiotic resistance markers
    • C12N15/821—Non-antibiotic resistance markers, e.g. morphogenetic, metabolic markers
    • C12N15/8212—Colour markers, e.g. beta-glucoronidase [GUS], green fluorescent protein [GFP], carotenoid
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The invention relates to a rice tissue specific expression promoter and application thereof. Specifically, the present invention provides strong promoter Os18R nucleic acid sequences capable of expression in plant tissues and methods of making and using the same. The invention discloses that the reverse sequence of the plant gene promoter region has strong constitutive promoter functional elements for the first time. Also relates to an expression cassette and a recombinant expression vector containing the promoter. The Os18R promoter disclosed by the invention has strong activity in plant roots, stems, leaves, glumes and other organs, is not expressed in stamen, embryo and endosperm, and has good application prospect in the field of plant transgenosis.

Description

Rice tissue specific expression promoter and application thereof
Technical Field
The invention belongs to the technical field of biotechnology and genetic engineering, and particularly relates to a rice tissue specific expression promoter and application thereof.
Background
Promoters act as key regulators in the gene transcription process, playing an important role in plant genetic engineering (Xue et al, 2018). Common promoters are mainly divided into three types: constitutive, inducible and tissue-specific. Constitutive promoters are commonly used to analyze gene function and trait modifications, which can cause a stable expression level of a foreign gene in plants (Mitsuko et al, 2019). The 3 promoters currently most widely used for constitutive strong promoters are 35S, actin and Ubiquitin (Yanet al, 2005; he et al, 2009; kishi-kaboshi et al, 2017), respectively. However, the high efficiency and continuous driving of exogenous gene expression is not only essential for plant growth, but also consumes a lot of nutrients in the plant body, and can negatively affect plant growth (lietal, 2020), and transcription including constitutive promoters tends to inhibit plant growth (jeonegetal, 2015). Tissue specific promoters, typically a 5' -UTR of an expressed gene of a specific tissue, organ or specific developmental stage, are effective to avoid negative effects on plant growth (Xue et al, 2018). Although some tissue-specific expression promoters have been cloned, including mainly root (Li et al, 2019), leaf sheath (oshima et al, 2019), phloem (dutt et al, 2012), pollen grain (wangate et al, 2020), embryo (kit et al, 2011), endosperm (pattotal, 2012), and tissue portion (yeet al, 2012; yangate et al, 2014; manikandanal, 2016; bai et al, 2020), etc., only a small portion of the role of the cis-acting element is recognized (catalyst et al, 2008). In addition, tissue-specific expression promoters that have been cloned so far are mainly genes closely related to photoinduction and photosynthesis systems, involved in plant photosynthesis, and fulfill the function of converting light energy into sugar (Liu et al, 2018), for example: rbcS (matsuoka et al, 1994), DX1 (yeet al, 2012), D540 (caietal, 2007), and the like. The separation and identification of the rice tissue specific expression promoter related to the non-photosynthesis system are beneficial to avoiding the influence of light effect, and the application range is wider.
Disclosure of Invention
The invention aims to provide a rice tissue specific expression promoter and application thereof.
The aim of the invention is realized by the following technical scheme:
a rice tissue specific expression promoter Os18R has a nucleotide sequence shown in SEQ ID NO. 1.
A group of primer pairs for amplifying the rice tissue specific expression promoter Os18R, the nucleotide sequence of which is: os18R-2000F:5'-TTTAGATTAGCTATTTGACTTATTT-3' the number of the individual pieces of the plastic,
Os18R-2000R：5'-cccccccgcctccgcctccgcctTCG-3'。
an expression cassette is constructed by connecting the rice tissue specific expression promoter Os18R with a target gene.
A recombinant expression vector comprising the above rice tissue-specific expression promoter Os18R.
A transformant comprising the recombinant expression vector described above, said transformant being a cell line or a callus or a transgenic plant.
The application of the rice tissue specific expression promoter Os18R in the specific expression of regulating or starting target heterologous genes in rice tissues, wherein the rice tissues are roots, stems, leaves, leaf sheaths and glumes.
The application of the rice tissue specific expression promoter Os18R in improving rice traits or cultivating new transgenic rice varieties.
The invention has the remarkable advantages that:
the invention provides a rice tissue expression strong specific promoter, and the functional element of the promoter is derived from a reverse sequence of a promoter region at the upstream of a gene, and the promoter has strong activity in plant roots, stems, leaves, glumes and other organs, does not express in stamen, embryo and endosperm, and has good application prospect in the field of plant transgenosis.
Drawings
Fig. 1: the rice promoter Os18R has a total length of 2000bp and is located in LOC_Os05580 gene region.
Fig. 2: construction of recombinant expression vector pCXOS 18R.
Fig. 3: expression patterns of GUS and Actin genes of different tissues and organs of rice.
Fig. 4: GUS tissue staining of different tissue organs of rice.
Detailed Description
The following examples facilitate a better understanding of the present invention, but are not intended to limit the same. The experimental methods used in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples were commercially available products unless otherwise specified.
Example 1:
extracting genomic DNA of Nipponbare rice by CTAB method.
LOC_Os05580 genome information is extracted from a bioinformatics website (http:// price. Plant biology. Msu. Edu /), and a reverse sequence of a gene 5' region is obtained as a gene sequence of a promoter region (figure 1), and a total length of 2000bp is calculated, so that clone primers Os18R-2000F and Os18R-2000R of a synthetic rice promoter are designed (table 1). PCR amplifying the rice promoter Os18R sequence by taking Japanese sunny rice genome DNA as a template; the reaction system: 10×KOD buffer 2. Mu.l, 10mM dNTP 1.5. Mu.l, 10mM primer Os18R-2000F 2. Mu.l, 10mM primer Os18R-2000R 2. Mu.l, nippon Rice genomic DNA 2. Mu.l, KOD polymelase 1. Mu.l, rehydrated with double distilled water to 50. Mu.l; reaction conditions: 94 ℃ for 5min;98 ℃ for 30s,58.5 ℃ for 30s,72 ℃ for 2min for 30s,35 cycles; and at 72℃for 10min. Detecting PCR products by agarose gel electrophoresis, carrying out gel recovery on expected target bands with expected size of 2000bp, connecting the recovered products with pCXGUS-P plasmid at 16 ℃ for 12 hours, then transforming into E.coli DH5 alpha competent cells, selecting monoclonal colonies, amplifying and culturing the monoclonal colonies by using LB culture medium containing Kan, extracting plasmids by using a high-purity plasmid extraction kit, and selecting positive clone sequencing. The result shows that the full length of the rice promoter Os18R is 2000bp, the nucleotide sequence is shown as SEQ ID NO.1, and the cis-acting element related to tissue specific expression is shown as Table 2.
TABLE 1 Rice promoter Os18R clone primer sequence
Primer name Primer sequence (5 '-3')
Os18R-2000F TTTAGATTAGCTATTTGACTTATTT
Os18R-2000R CCCCCCCGCCTCCGCCTCCGCCTTCG
TABLE 2 cis-acting elements in the Os18R sequence of the rice promoter that are associated with tissue-specific expression
In order to be conveniently connected with a carrier, the recovery product of the rice promoter Os18R with correct sequence is added with the A tail to obtain a reaction system of the rice promoter Os18R with the A tail and the A tail: 10 Xbuffer 1.5 mu L of radix et rhizoma Nardostachyos, 1.5 mu L of 2.5mM dNTP, 0.5 mu L of Taq enzyme of radix et rhizoma Nardostachyos, 30 mu L of product fragment and ddH supplement 2 O to 40. Mu.L, and placed on a PCR instrument at 70℃for 10min. The rice promoter Os18R with A tail was ligated with pCXGUS-P plasmid fragment (XcmI cleavage recovery) to obtain recombinant expression vector pCXOs18R (FIG. 2).
Example 2:
the recombinant expression vector pCXOS18R is transformed into LBA4404 agrobacterium tumefaciens, the Japanese sunny rice callus is used as a receptor material for genetic transformation, the genetic transformation is realized by using the agrobacterium tumefaciens to mediate the rice mature embryo to induce the callus, and the regeneration positive plant is formed by antibiotic screening, callus regeneration, callus differentiation and seedling growth rooting. The method comprises the following specific steps:
1) Seed pretreatment: wild type Japanese seed is treated by husking, treating with 75% ethanol for 2min, soaking with 25% NaClO solution on a shaker (low speed 100 rpm) for 30min, and sterilizing with ddH 2 O is washed for 3 to 5 times and dried;
2) Mature embryo induced callus: inoculating sterilized seeds on a callus induction culture medium (N6+2, 4-D2.0 mg/L+sucrose 25g/L+Phytagel 3.0g/L, pH=5.8), and culturing for about 7D under dark condition at 27 ℃; after the culture is finished, the germinated mature embryo is picked up to an embryogenic callus induction medium (N6 +2, 4-D2.5 mg/L) to be continuously cultured for about 15 days until granular embryogenic callus is grown;
3) Preparation and infection of agrobacterium: streaking LBA4404 Agrobacterium tumefaciens strain containing recombinant expression vector pCXOS18R on a YEB plate, culturing in darkness at 28 ℃ for 2d, picking single colony, and culturing in a YEB liquid culture medium containing 50mg/ml rifampicin and 50mg/ml kanamycin at 28 ℃ in a shaking table overnight; after the completion of the culture, the cells were collected by centrifugation, resuspended in N6+AD medium (N6 +100umol/L acetosyringone +2, 4-D0.5 mg/L), and OD was adjusted 600 About 0.8 to obtain agrobacterium infection solution;
4) Selecting 15-20 g to 100mL triangular flask, adding 50mL of agrobacterium infection solution, placing in a 28 ℃ incubator for 25min to fully infect, taking out the granular embryogenic callus, blow-drying on filter paper, placing on co-culture medium N6-As (N6 +200umol/L acetosyringone), and co-culturing for 3-7 d under the dark condition at 22 ℃;
5) Resistant callus screening: transferring the co-cultured granular embryogenic callus into a 100mL triangular flask, adding sterile water containing 500mg/L carbenicillin for 20min, washing 3-5 times with sterile water, airing on filter paper, picking up a screening culture medium N6-H (N6 +50mg/mL hygromycin), and culturing in dark at 28 ℃ until the newly born resistant callus;
6) Callus differentiation and regenerated plant rooting: transferring the new-born resistant callus to a differentiation medium (N6+0.5 mg/L6-BA+0.1 mg/LNAA), culturing at 28 ℃ under light for 14-30d, transferring to a rooting medium (MS basal medium), and culturing to grow into seedlings to obtain transgenic plants.
To further confirm whether the Os18R promoter was specifically expressed in rice tissues, RT-PCR analysis and GUS histochemical staining analysis were performed on transgenic plants. The roots, stems, leaves, leaf sheaths, glumes, stamens, embryos and endosperm of the pure line of the transgenic Japanese sunny rice plant are collected, RNA is extracted, the RNA is reversely transcribed into cDNA to be used as a template, the ACTIN gene of the rice is used as an internal reference, and the expression condition of the GUS reporter gene driven by the Os18R promoter in the transgenic rice is analyzed. As is clear from the results in FIG. 3, the GUS gene of interest driven by Os18R was expressed in roots, stems, leaves, leaf sheaths of rice plants, but not in pistils, embryos and endosperm, and it was a tissue-specific promoter. Cutting root, stem, leaf sheath, glume, stamen, embryo and endosperm of transgenic rice plant (cutting seed with dissecting knife), immersing in staining solution, maintaining at 37deg.C for 3-12 hr, and decolorizing with 70% ethanol for 2-3 times. When the plants are observed under a dissecting scope and photographed, the results in FIG. 4 show that the roots, stems, leaves, leaf sheaths and glumes are all stained, and the stamen, embryo and endosperm are not stained.
RT-PCR detection primer: wherein the ACINT gene primer is as follows: actin f:5'-TGTGCTTGATTCTGGTGATGG-3', actinR:5' -ATCTTCATTAGGCAGTCAGTCAG-3; the GUS gene primer is as follows: gusF:5'-CGGTGATGATAATCGGCTGAT-3', gusR:5'-CCTGCGTCAATGTAATGTTCTG-3'. Procedure for RT-PCR detection system: 10 day root Mix buffer12.5 μl,10mM GusF (ActinF for control) 2 μl,10mM GusR (ActinR for control) 2 μl, taq polymelase 0.5 μl, cDNA 1 μl, and the rest were underfilled with double distilled water to 25 μl. PCR reaction conditions: pre-denaturation at 94℃for 2min; denaturation at 94℃for 30s, annealing at 58℃for 30s, elongation at 72℃for 30s,28 cycles; extending at 72℃for 10min. The size of the ACTIN amplified fragment is 123bp; the GUS gene amplified fragment has the size of 186bp.
The above results indicate that the Os18R promoter drives the exogenous GUS gene to express the gene of interest in rice tissues (root, stem, leaf sheath, glume) but not in pistil, embryo and endosperm. Therefore, the Os18R promoter has good application prospect in transgenic engineering, especially for insect resistance or disease resistance transgene application, and can solve the problems of plant resistance but relatively safe edible part.
The above description is only a preferred embodiment of the present invention, and all equivalent changes and modifications made according to the claims of the present invention, including external connection of other exogenous genes, transformation and truncation of the Os18R promoter, etc. shall fall within the scope of the present invention.

Claims (8)

1. A rice tissue-specific expression promoter Os18R, characterized in that: the nucleotide sequence is shown as SEQ ID NO. 1.
2. A set of primer pairs for amplifying the rice tissue-specific expression promoter Os18R of claim 1, wherein: the nucleotide sequence is:
Os18R-2000F：5'-TTTAGATTAGCTATTTGACTTATTT-3'，
Os18R-2000R：5'-cccccccgcctccgcctccgcctTCG-3'。
3. an expression cassette, characterized in that: constructed by linking the rice tissue-specific expression promoter Os18R according to claim 1 with a target gene.
4. A recombinant expression vector, characterized in that: comprising the rice tissue-specific expression promoter Os18R according to claim 1.
5. A transformant, characterized in that: a recombinant expression vector according to claim 4.
6. The transformant according to claim 5, wherein: the transformant is a cell line or a callus or a transgenic plant.
7. The use of the rice tissue-specific expression promoter Os18R according to claim 1 for regulating or promoting the specific expression of a heterologous gene of interest in rice tissue, wherein: the rice tissue is root, stem, leaf sheath and glume.
8. The use of the rice tissue-specific expression promoter Os18R according to claim 1 for improving rice traits or for breeding new varieties of transgenic rice.
CN202311041985.8A 2023-08-18 2023-08-18 Rice tissue specific expression promoter and application thereof Pending CN117025609A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202311041985.8A CN117025609A (en) 2023-08-18 2023-08-18 Rice tissue specific expression promoter and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202311041985.8A CN117025609A (en) 2023-08-18 2023-08-18 Rice tissue specific expression promoter and application thereof

Publications (1)

Publication Number Publication Date
CN117025609A true CN117025609A (en) 2023-11-10

Family

ID=88635149

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202311041985.8A Pending CN117025609A (en) 2023-08-18 2023-08-18 Rice tissue specific expression promoter and application thereof

Country Status (1)

Country Link
CN (1) CN117025609A (en)

Similar Documents

Publication Publication Date Title
CN104450711B (en) OsmiR156f genes are increasing paddy rice effective tillering and the application in improving paddy rice single plant yield
CN111593058B (en) Bna-miR169n gene and application thereof in controlling drought resistance of brassica napus
CN112175965B (en) Gene and protein for enhancing resistance of rice blast and bacterial leaf blight and method for improving resistance of rice blast and bacterial leaf blight
WO2020221029A1 (en) Zea mays receptor-like kinase gene zmrlk7 and use thereof
CN105087640A (en) Gene for regulating seed development of plants and application of gene
CN108531506B (en) Method for regulating and controlling plant type structure of crop and method for obtaining compact plant type crop
CN100587071C (en) Plant flower organ specificity promoter and its application
JP2009534019A (en) Transgenic plant for controlling sugar beet lottery and method therefor
CN116694661A (en) ShN/AINV5-4D gene for regulating plant germination rate and application thereof
CN112662688B (en) Application of walnut SnRK1 protein kinase coding gene JrSnRK1 in synthesis and accumulation of oil
CN117025609A (en) Rice tissue specific expression promoter and application thereof
CN108795942B (en) Rice exogenous stress induced expression promoter Psubs3 and application thereof
CN113234753A (en) Cultivation, identification and application of maize microfilament depolymerizing factor ADF7 transgenic plant
CN116376933B (en) Rice germination rate regulating gene OsSCYL2 and application thereof
CN116063433B (en) Gene for regulating oil content of rape seeds and application thereof
CN109811006B (en) Application method of tomato miR482 gene in plant branch control
CN112760322B (en) Rice constitutive strong promoter and application thereof
CN116083452B (en) Carrot gibberellin oxidase gene and expression and application thereof
Otani et al. Genetic transformation of sweet potato (Ipomoea batatas (L.) Lam.) by Agrobacterium tumefaciens
CN111575286B (en) Corn pollen specific promoter and application thereof
CN117448323A (en) Rice phosphatidylinositol transporter embryo specific promoter and application thereof
CN107142262B (en) Rice seed specific promoter Posseed and application thereof
CN115927330A (en) Application of peach MIR6288b in regulation of plant branch number
CN106674340B (en) Hybrid paper mulberry transcription factor BpSEM and coding gene and application thereof
CN118147144A (en) Promoter for driving gene to express in rape root system and induced by high phosphorus and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination