CN116970590B

CN116970590B - Super mini-gene editor smaller than 380 amino acids and application thereof

Info

Publication number: CN116970590B
Application number: CN202311230195.4A
Authority: CN
Inventors: 王明; 孙照霖; 李宁
Original assignee: Beijing Kevland Biosciences Co ltd
Current assignee: Beijing Kevland Biosciences Co ltd
Priority date: 2023-09-22
Filing date: 2023-09-22
Publication date: 2024-01-30
Anticipated expiration: 2043-09-22
Also published as: CN116970590A

Abstract

The invention relates to the technical field of genetic engineering, in particular to a super mini-type gene editor with less than 380 amino acids and application thereof. The gene editor has at least one of the following amino acid sequences: the amino acid sequence of the amino acid sequence shown in SEQ ID NO.1 is 1 to 379, 1 to 378, 1 to 377, 1 to 376 and 1 to 375. The super mini gene editor with less than 380 AA is developed for the first time, can efficiently realize accurate and efficient editing from mammalian cells to living animals, and has great popularization and application values.

Description

Super mini-gene editor smaller than 380 amino acids and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a super mini-type gene editor with less than 380 amino acids and application thereof.

Background

The gene editing technology refers to a technology for performing targeted modification (knockout, insertion, replacement and the like) on genes to obtain new characteristics or functions, namely a first generation DNA nuclease editing system ZFNs, a second generation TALENs, a third generation CRISPR/Cas9 system, a BE (Base editing) system and a PE (Prime editing) system based on CRISPR/Cas9, the gene editing efficiency is continuously improved, editing types are continuously enriched, the cost is gradually reduced, the application range is continuously expanded, the technology has been deeply and widely used in the fields of medical treatment, agriculture, energy sources, materials, environment and the like, and a plurality of related gene editing products are marketed, and more products are in clinical trials or are prepared before marketing. Of particular importance, gene editing provides an unprecedented powerful tool for genetic engineering and gene therapy of human cells or tissues and other living bodies, which would bring about a great revolutionary development opportunity for the entire biological industry.

Early studies found that the CRISPR/Cas9 system is derived from the natural acquired immune system of bacteria and archaea, and that the complex composed of CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA) and Cas9 protein is resistant to invasion by exogenous DNA. In vitro reconstitution of CRISPR/Cas9 in 2012 and demonstration of its gene editing function in human cells in 2013 marks the beginning of the new generation gene editing era, after which this technology succeeded in performing gene editing functions in different types of cells and multiple species of animals and plants. However, CRISPR/Cas9, like ZFNs and TALENs, is edited on the basis of causing DNA double strand breaks at genomic target sites, thereby activating intracellular repair mechanisms. Repair mechanisms for DNA double strand breaks in cells include heterologous end junctions that are susceptible to random insertions, deletions, and homologous recombination repair that requires the presence of a homologous template to be activated. However, the heterologous terminal connection is easy to cause random insertion, thereby affecting the function and genome stability of the target gene; homologous recombination (HDR), although more accurate than end joining (NHEJ), has a low repair efficiency of about 0.1% -5% in cells, which greatly limits the application of precise gene editing techniques. Subsequently, in order to address the above-mentioned drawbacks, the gene editing technique, BE technique, which can perform single base conversion without depending on DNA double strand breaks was developed by David Liu laboratories of university of Harvard, 2016. This technology is based on complexes formed by dCas9 without nuclease activity (Inactive or dead Cas 9) or Cas9n with single-stranded DNA nickase activity (Cas 9 nicase), cytosine deaminase, uracil glycosylase inhibitor (Uracil DNA glycosylase inhibitor, UGI) and sgRNA, directly deaminating Cytosine (C) at the target site to Uracil (U) without causing double-stranded DNA breaks; due to the presence of uracil glycosylase inhibitor, excision of U is inhibited; with DNA replication, U is replaced by Thymine (T); ext> meanwhileext>,ext> Guanineext> (ext> Gext>)ext> originallyext> complementaryext> toext> Cext> onext> theext> complementaryext> strandext> isext> replacedext> byext> Adenineext> (ext> Aext>)ext>,ext> andext> singleext> baseext> preciseext> editingext> ofext> Cext> -ext> Text> andext> Gext> -ext> Aext> inext> aext> certainext> activityext> windowext> isext> finallyext> realizedext>.ext> Subsequently in 2017, a A.T base to g.c base pair conversion was achieved based on a new single base editor of e.coli TadA (ecTadA), adenine base editor (adenine base editors, ABEs). Scientists at home and abroad expand BE technology, editors such as GCBE, double BE and the like are developed successively, and the various BE editors are successfully applied to different types of cells and different animal and plant species. However, these studies are mainly applied to part of types of single base mutations, and other types of exact mutations, such as any type of point mutation, exact deletion and insertion, etc., cannot be achieved. In 2019, david r.liu laboratories developed a PE (Prime editing) editing system that can introduce not only insertions and deletions (indels) but also any conversion between 12 bases. The working principle of the system is as follows: the sgrnas were engineered to be pegRNA (prime editing guide RNA), the pernas contained a primer binding site (primer binding site, PBS) region; also carrying a reverse transcribed template sequence, which can be combined with Reverse Transcriptase (RT), while the pegRNA sequence directs its introduction into the target gene sequence for gene editing. The PE system is similar to the BE system because of the excessive self-body quantity, thereby limiting the wide application of the PE system in AAV gene therapy systems, which is the key of human gene therapy.

For Cas9 as described above, as well as BE systems and PE systems developed based thereon, a significant weakness is that the elements are too large, resulting in low cell transfection or delivery efficiency, thus limiting its range of application, and particularly, because of the large molecular weight of the editor, far exceeding the load-bearing capacity (less than 4.7 kb) of AAV gene therapy systems, thus limiting the application of these gene edits as drugs or therapeutic means, as well as in vivo and in vitro genetic modification. The reason for the oversize of the current editor is mainly that the molecular weight of the chassis core tool of Cas9 is oversize and reaches 1368 amino acids, and based on the oversize, the molecular weight of BE and PE systems constructed by fusing other functional domains (domains) is further increased, and the problem cannot BE solved from the chassis. Therefore, a plurality of task groups at home and abroad start to develop new editing tools by searching for new small enzymes of the chassis Cas system. At present, casMINI (557 AA), asCas12f1 (422 AA), ogeuIscB (499 AA) and SpCas12f (497 AA) are mainly available, but the efficiency is far lower than Cas9 (only about 2% on average), and many studies are limited to cellular level and rarely extend to animal and plant studies and gene therapy studies. While these small enzymes, while smaller than Cas9 enzyme (1368 AA), are not small enough to fuse different domains for future applications, importantly, so far, no new editors of less than 380 AA have been reported worldwide.

2021 nature reports found a new small TnpB editing tool, considered an ancestor of Cas12 system, and only 408 AA, but this report only validated targets in 293T cells, and up to now, no research report on other cell types and animal levels for this editing tool was seen. 2023, wang Haoyi et al, on nature, reported that 25 Tnpbs active in E.coli, screened from 64 annotated IS605 members, were obtained after further investigation by 369 amino acid and 382 amino acid editors ISAam1 and ISYmu1, but the length of the gene editor was still longer.

Therefore, developing smaller and efficient gene editors remains a central critical task in the current gene editing and development field.

Disclosure of Invention

The invention develops super mini editors of less than 380 AA by carrying out engineering operation of functional domain reduction on TnpB editors, which are named super Mini-GE-SWL, and the efficiency is between 10% and 60%, and is 20.74% on average, which is far higher than that of the original TnpB and other small gene editors. Meanwhile, the super mini gene editor is applied to a gene editing mouse and has great success, so that the super mini gene editor provided by the invention can be used for efficiently realizing accurate editing from mammalian cells to living animals, and the technical defect of the large existing gene editor is overcome.

The development strategy of the gene editor of the invention comprises the following steps:

(1) Analyzing the element structure of the gene editor, determining a core functional area and a non-core functional area of the gene editor, carrying out regional truncation on the non-core functional area, and constructing gene editor mutants with different truncate types;

(2) Cell-level and/or individual-level gene editing efficiency was validated for gene editor mutants.

Based on the above, the invention provides the following technical scheme.

First, the present invention provides a gene editor having at least one of the following amino acid sequences:

the amino acid sequence of the amino acid sequence shown in SEQ ID NO.1 is 1 to 379, 1 to 378, 1 to 377, 1 to 376 and 1 to 375.

Preferably, the gene editor comprises the above amino acid sequence and a functional protein; or comprises the amino acid sequence and the polypeptide.

The functional protein or polypeptide, when linked to the above amino acid sequence, does not affect the activity of the above amino acid sequence (binding activity to guide RNA, endonuclease activity, binding to a specific site of a target sequence under the guidance of guide RNA, cleavage activity, etc.).

The amino acid sequence can be widely applied after the functional elements of the functional protein or the polypeptide are connected. If the protein is connected with a nuclear localization signal sequence, the activity of the protein entering the cell nucleus can be improved; the cell repair mechanism is connected with a key regulatory factor of the cell repair mechanism, and the proportion of specific repair can be improved by regulating the in-vivo repair mechanism.

Preferably, the functional protein or polypeptide is selected from at least one of the following: epitope tags, reporter sequences, nuclear localization signal sequences, transmembrane peptides, targeting moieties, transcriptional activation domains, transcriptional repression domains, nuclease domains or domains with specific activity; the specific activities include: nucleotide deaminase, methylase activity, demethylase, transcriptional activation activity, transcriptional repression activity, transcriptional release factor activity, histone modification activity, nuclease activity, single-stranded RNA cleavage activity, double-stranded RNA cleavage activity, single-stranded DNA cleavage activity, double-stranded DNA cleavage activity or nucleic acid binding activity.

In particular embodiments, epitope tags are well known to those skilled in the art, including but not limited to His, V5, FLAG, HA, myc, VSV-G, trx, and the like. The skilled person may select an appropriate epitope tag according to the desired purpose (e.g. purification, detection or labelling).

In particular implementations, reporter sequences are well known to those skilled in the art, including but not limited to GST, HRP, CAT, GFP, hcRed, dsRed, CFP, YFP, BFP, etc.

In a specific implementation, the nuclear localization signal sequence (NLS) comprises 1 or more NLS sequences. The nuclear localization signal sequence is located at, near or near the end (e.g., N-terminus or C-terminus) of the gene editor of the invention.

In particular embodiments, the transmembrane peptides include, but are not limited to, TAT, CPP5, and the like, to increase the ability of the gene editor of the invention to penetrate cell membranes.

Further, the present invention provides a nucleic acid encoding the above gene editor.

In particular embodiments, the nucleic acid may be codon optimized for expression in a prokaryotic cell or eukaryotic cell.

Further, the present invention provides a complex comprising a protein component and a nucleic acid component;

the protein component is the gene editor;

the nucleic acid component contains TTGAT/TTTAT characteristics and a targeting sequence capable of hybridizing with a target sequence;

and/or, the nucleic acid component contains a nucleotide sequence of the guide RNA.

The protein component and the nucleic acid component are capable of binding to each other to form a complex.

The protein component and the nucleic acid component may be naturally occurring or modified.

In some embodiments, the target sequence is a non-naturally occurring DNA or RNA sequence.

In particular embodiments, when the target sequence is DNA, the target sequence is located 5' of the protospacer adjacent motif (TAM).

In some embodiments, the target sequence is present within the cell.

In some embodiments, the target sequence is present in the nucleus or in the cytoplasm (e.g., organelle).

Preferably, the cell is a prokaryotic cell.

Further, the present invention provides a biological material comprising the above gene editor, or nucleic acid, or complex, said biological material being an expression cassette, a vector, a host cell, a transgenic cell line, or a recombinant microorganism.

Preferably, the host cell comprises a cell incapable of propagating as a plant or animal individual and the transgenic cell line comprises a cell incapable of propagating as a plant or animal individual.

In a specific implementation process, the vector is a cloning vector or an expression vector. The vector is capable of expressing the above gene editor, or a nucleic acid encoding the gene editor, or a complex of the above. Such vectors include, but are not limited to, plasmids, phages, cosmids.

In particular embodiments, host cells include, but are not limited to, prokaryotic cells (e.g., E.coli cells), eukaryotic cells (e.g., yeast cells), insect cells, plant cells, or animal cells (e.g., mammalian cells, e.g., mouse cells or human cells). The host cell may also be a cell line, such as a 293T cell line.

Further, the present invention provides a delivery composition comprising a delivery vehicle and at least one of the following components: the above gene editor, nucleic acid, complex, biological material.

Preferably, the delivery vehicle is at least one of the following: lipid particles, sugar particles, metal particles, protein particles, liposomes, exosomes, microbubbles, gene-gun vectors, viral vectors (e.g., replication-defective retroviruses, lentiviruses, adenoviruses, or adeno-associated viruses).

Delivery compositions of the present invention may be delivered by any method known in the art, including, but not limited to, electroporation, lipofection, nuclear transfection, microinjection, sonoporation, gene gun, calcium phosphate mediated transfection, cationic transfection, lipofection, dendritic transfection, heat shock transfection, nuclear transfection, magnetic transfection, lipofection, puncture transfection, optical transfection, reagent enhanced nucleic acid uptake, delivery via liposomes, immunoliposomes, viral particles, artificial virions, and the like.

Further, the present invention provides a pharmaceutical product comprising at least one of the following components: the above gene editor, nucleic acid, complex, biomaterial, delivery composition.

Preferably, the medicine further comprises pharmaceutically acceptable auxiliary materials.

Such drugs include, but are not limited to, those used for gene editing.

Further, the invention provides a reagent or a kit, which comprises at least one of the following components: the above gene editor, nucleic acid, complex, biomaterial, delivery composition.

The components comprised in the reagents or kits of the invention may be provided in any suitable container.

In some embodiments, the reagent or kit further comprises one or more buffers. The buffer may be any buffer including, but not limited to, sodium carbonate buffer, sodium bicarbonate buffer, borate buffer, tris buffer, MOPS buffer, HEPES buffer, and combinations thereof.

In some embodiments, the reagent or kit further comprises one or more oligonucleotides corresponding to a targeting sequence for insertion into a vector, such that the targeting sequence and the regulatory element are operably linked.

In some embodiments, the reagent or kit comprises a homologous recombination template polynucleotide.

Further, the present invention provides the use of the above-described gene editor, nucleic acid, complex, biological material, delivery composition, pharmaceutical, reagent or kit in gene editing.

In some embodiments, the gene editing is for non-diagnostic therapeutic purposes.

Preferably, the gene editing is eukaryotic.

Such eukaryotic organisms include, but are not limited to, humans, monkeys, mice, pigs, cows, sheep, rabbits, etc.

Further, the present invention provides a method for modifying a target gene, comprising modifying the target gene using the above-described gene editor, nucleic acid, complex, biological material, delivery composition, drug, reagent, or kit.

In some embodiments, the method of modification of the target gene is for non-diagnostic therapeutic purposes.

In a specific implementation, the above-described gene editor, nucleic acid, complex, biological material, delivery composition, drug, reagent, or kit is contacted with a target gene in which the target sequence is present for modification or delivery to a cell or embryo containing the target gene.

In some embodiments, the target gene is present in an embryo or cell.

Preferably, the target gene is present in eukaryotic cells, more preferably in mammalian cells. The mammalian cells include, but are not limited to, human cells, monkey cells, non-human primate, bovine, porcine, or rodent cells.

In some embodiments, the cell is a non-mammalian eukaryotic cell, such as poultry or fish, and the like.

In some embodiments, the cell is a plant cell, e.g., a cultivated plant (e.g., corn, sorghum, wheat, or rice), algae, tree, or vegetable cell.

In some embodiments, the target gene is present in an in vitro nucleic acid molecule (e.g., a plasmid).

In some embodiments, the method results in cleavage of a target sequence in a target gene (e.g., double-strand cleavage of DNA or single-strand cleavage of RNA).

In some embodiments, the disruption results in reduced transcription of the target gene.

Preferably, the modification method further comprises editing the target gene with an editing template (e.g., an exogenous nucleic acid).

In a specific implementation, the editing template is contacted with the target gene for editing, or delivered to a cell or embryo containing the target gene for editing.

In some embodiments, the method repairs a disrupted target gene by homologous recombination with an editing template (e.g., an exogenous nucleic acid), wherein the repair results in a mutation comprising an insertion, deletion, or substitution of one or more nucleotides of the target gene.

In some embodiments, the mutation results in a change in one or more amino acids in a protein expressed from a gene comprising the target sequence.

In some embodiments, the modification further comprises inserting an editing template (e.g., an exogenous nucleic acid) into the fragmented target gene.

In some embodiments, the modification methods are used to alter one or more target sequences in a target gene or nucleic acid molecule encoding a target gene product to modify a cell, cell line, or organism.

Compared with the prior art, the invention has the beneficial effects that:

the super mini gene editor with less than 380 AA is developed for the first time, can efficiently realize accurate and efficient editing from mammalian cells to living animals, and has great popularization and application values.

Drawings

FIG. 1 is a gene editing schematic of the superminiature gene editor of the present invention.

FIG. 2 is a graph demonstrating the efficiency of gene editing mediated by primitive TnpB in HEK293T cells.

FIG. 3 is a roadmap of the development technique of the super mini-gene editor of the invention.

FIG. 4 is a graph showing the efficiency of cell-level mediated gene editing by the supermini gene editor of the present invention.

FIG. 5 is a graph showing the in vitro blastocyst rate and mouse birth rate efficiency statistics of the supermini gene editor of the present invention.

FIG. 6 is a graph showing the efficiency of gene editing mediated by the supermini gene editor of the invention at the mouse blastula level.

FIG. 7 is a graph showing the efficiency of gene editing mediated by the supermini gene editor of the invention at the individual mouse level.

Detailed Description

For the purpose of making the objects, technical solutions and advantages of the present invention more apparent, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings, and it is apparent that the described embodiments are some embodiments of the present invention, not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

The examples are not intended to identify the particular technology or conditions, and are either conventional or are carried out according to the technology or conditions described in the literature in this field or are carried out according to the product specifications. The reagents and instruments used, etc. are not identified to the manufacturer and are conventional products available for purchase by regular vendors.

The gene editing principle of the programmable nuclease provided by the invention is shown in figure 1, and specifically comprises the following steps: when the SuperMini gene editor (i.e. SuperMini-GE-SWL) recognizes the presence of TAM sequence, the reRNA and SuperMini-GE-SWL proteins form a complex, targeting a DNA sequence complementary to the base pairing of the reRNA, the DNA double strand is opened, the reRNA binds to one of the single strands, i.e. the Target Strand (TS), at which time the cleavage activity of the SuperMini-GE-SWL protease is activated and the Target Strand (TS) and non-target strand (NTS) are cleaved by the SuperMini-GE (379,378,377,376,375) -SWL protease. Different target DNA fragments can be targeted by designing different reRNA sequences in the presence of a suitable TAM.

1. Cloning and efficiency validation of original TnpB

1. Construction of the original TnpB expression vector

The amino acid sequence of the original TnpB used in the experiment is shown as SEQ ID NO.1, and the gene sequence is shown as SEQ ID NO. 2. The gene synthesis fragments were synthesized by Shanghai Bioengineering Co. The gene fragment, pST1374 (Addgene, # 13426) vector was digested with EcoRI (purchased from NEB) and then the gene fragment and vector were recombined by the action of a recombinase (purchased from Norfluzan). Sequencing to identify the recombinant plasmid vector, and extracting the plasmid.

2. Construction of the reRNA

4 endogenous genes were selected in HEK293T cells and 8 rernas were designed. The site sequences are shown in table 1 below.

TABLE 1 ReRNA recognition sequence Listing

The base complementary pairing upstream and downstream primers are designed according to the target site sequence, and sterilized water is added for dissolution to 10uM. Annealing and connecting to pGL3-U6-sgRNA (Addgene, # 51133) vectors respectively, and sequencing and verifying to construct the targeted specific reRNA.

3. Culture and transfection of HEK293FT cells

HEK293FT cells (purchased from ATCC) were recovered and cultured in 10cm dishes (Corning, 430167) in DMEM (HyClone, SH 30243.01) containing 10% by volume of fetal bovine serum (HyClone, SV 30087). The culture temperature was 37℃and the carbon dioxide concentration was 5%. After passaging, when the cell density was 80%, the cells were plated to 12-well plates.

After 12-14h of cell separation, transfection was performed using lipo3000 cell transfection reagent (available from Thermo) at a cell concentration of about 80%; the total amount of plasmid transfected per well was 1ug, with TnpB expression plasmid and reRNA expression plasmid mixed at 1:1. The mixed plasmid was mixed in 75ul of Opti-MEM (Gibco, 11058021) medium while adding 2.5 ul lipo3000 cell transfection reagent and allowed to stand for 5 min; in addition, 2.75. Mu.l lipo3000 cell transfection reagent was mixed into 75. Mu.l Opti-MEM medium and allowed to stand for 5 min; mixing the materials 2) and 3) at a slow speed, and standing for 20 minutes; respectively adding the mixed and standing transfection solution into the cultured cells; 48-72 hours after transfection, the medium was removed, the cells were washed once with PBS, then digested with TE (Thermo Fisher, R001100), stopped with DMEM containing 10% FBS, and centrifuged to collect the cells, which were finally resuspended in medium.

4. Cutting efficiency verification

1/6 of the above collected cells were directly lysed and the target site fragments were PCR amplified using the primers designed as shown in Table 2, and each genomic target site fragment was PCR amplified using the Norflu high fidelity enzyme kit (Vazyme, p501-d 2).

TABLE 2 PCR amplification primers for different target sites

The PCR reaction system is shown in Table 3.

TABLE 3 PCR reaction System

PCR reaction procedure reference kit. The PCR amplified product was purified and recovered by AxyPrep PCR Clean-up kit (Axygen, AP-PCR-500G) for second generation sequencing analysis (Shanghai Bioengineering Co., ltd.). Analysis found that there was an editing efficiency of 10% -60% in all 8 sites detected (fig. 2).

2. TnpB functional domain truncation and efficiency detection

Based on the efficient gene editing of the original TnpB, the invention analyzes the structure and truncates the non-core functional domain. The invention mainly aims at shortening the functional domain of the N end, and the truncated body is shown in figure 3. pST1374-TnpB constructed in the first section was used as a backbone vector, digested with FseI and BsaI (both purchased from NEB), and recovered by purification using AxyPrep PCR Clean-up kit (Axygen, AP-PCR-500G).

In order to obtain the minimum SuperMini-GE-SWL, the invention makes truncations of single amino acids on 373-380 AA basis on the basis of extensive experimental investigation, and the truncations strategy is shown in FIG. 3. Using original TnpB (SEQ ID NO. 2) as a template, an upstream primer and a downstream primer (the primers are shown in Table 4) were designed, and fragments of 887bp,890bp,893bp,896bp,899bp and 884bp were amplified by PCR using Forward/Reverse-8, forward/Reverse-9, forward/Reverse-10, forward/Reverse-11, forward/Reverse-12, forward/Reverse-13, and the major differences were that amino acid deletions of 33AA,32AA,31AA,30AA,29AA and 34AA were present at the N-terminus of TnpB. And (3) connecting a skeleton vector with different truncated amplification products by using a homologous recombination method to obtain TnpB with different truncated types.

TABLE 4 design of primer for truncated PCR amplification

Subsequently, functional activity of the 6 truncations was verified as in the first part. HEK293T cells are co-transformed by truncated TnpB and the reRNA of the targeted endogenous gene, genome is lysed after 72 hours, and efficiency verification is carried out by using T7E1 through regional PCR amplification and fragment recovery.

1) Gradient annealing of PCR products

And (3) measuring the concentration of the obtained recovered PCR product, and carrying out gradient annealing on the PCR product to obtain a gradient annealed PCR product.

The system of the above gradient annealing is shown in table 5 below.

Table 5 shows a gradient annealed system

The gradient annealing procedure for the PCR products described above is shown in Table 6.

Table 6 shows a gradient annealing procedure for PCR products

2) T7E1 cleavage was performed on the gradient annealed PCR product obtained in the above 1), and the cleavage system was as shown in Table 7 below.

TABLE 7 enzyme digestion system

The reaction procedure: the cleavage reaction shown in Table 7 was carried out in a 37℃incubator for a cleavage reaction time of 1 h to give a cleavage product.

And (3) performing polyacrylamide gel (PAGE) electrophoresis detection on the enzyme-digested product, adopting 8% polyacrylamide gel, and dyeing the PAGE gel by using EB after electrophoresis is finished.

The T7E1 enzyme digestion result and the second generation sequencing analysis show that when the truncated body is truncated to 374AA, the cutting activity of the truncated body is inactivated; 375AA-379AA, which still had cleavage activity, wherein the 379AA truncate did not significantly decrease its cleavage activity compared to TnpB in both endogenous sites of ROSA26, EMX1, and the 375AA-378AA truncate had some effect on its cleavage activity, but it still remained high cleavage activity (fig. 4A-F). The above results demonstrate that the superMini gene editor SuperMini-GE-SWL of the present invention can effectively mediate gene editing at the cellular level.

3. Super mini gene editor SuperMini-GE (379,378,377,376,375) -SWL mediated mouse blastula and individual level gene editing activity verification

Subsequently, the invention uses truncated SuperMini-GE (379,378,377,376,375) -SWL and original TnpB as a chassis to verify the gene editing activity of the mediated blastula and individual level. To facilitate observation of the mouse phenotype, a candidate Tyr gene was targeted, and homozygous mutation of this gene could result in the change of the body hair of the mouse from black to white, as shown in the flow chart of fig. 5A.

1. Construction of targeting Tyr Gene SuperMini-GE (379,378,377,376,375) -SWL expression vector

The Tyr gene exon 1 region was selected as the targeting site, and the reRNA was designed (shown in fig. 5B). The base-complementary paired upstream and downstream primers for the target site sequences were then designed and dissolved to 10uM with sterile water. Annealing and connecting to pGL3-U6-sgRNA (Addgene, # 51133) vectors respectively, and sequencing and verifying to construct the targeted specific reRNA.

2. Microinjection preparation of Tyr Gene edited blastula and mice

1) Superovulation was performed on mice of suitable age, specifically by intraperitoneal injection of 10IU of PMSF (purchased from Ningbo hormone second pharmaceutical factory) into each mouse, followed by intraperitoneal injection of 10IU of HCG (purchased from Ningbo hormone second pharmaceutical factory) after 48 hours;

2) After HCG injection, female mice were mated with the breeding male mice 1:1, while age-appropriate recipient female mice were mated with the ligating male mice 1:1;

3) The next day of mating, selecting a master mouse and a recipient master mouse which see the thrombus;

4) Dislocation and sacrifice are carried out on the female mouse with the thrombus, the skin is cut off, the left and right ovaries of the mouse are taken out by using ophthalmic scissors and forceps, and the expansion part of the oviduct is found;

5) The fertilized eggs were peeled off from the enlarged portion of the oviduct with an embryo handling needle, treated with hyaluronidase (purchased from Sigma), and collected in embryo handling liquid (purchased from Sigma);

6) SuperMini-GE (379,378,377,376,375) -SWL, tnpB and reRNA were transcribed in vitro (from Thermo), the in vitro transcripts were mixed at 1:1 for a total of 200ng/ul, the mixture was then injected into animal embryos using a micromanipulation system, and after half an hour, the fertilized eggs with the better status after injection were either placed in mouse embryo culture (from Sigma) for in vitro culture or transplanted into surrogate female mice. For fertilized eggs cultured in vitro, the blastula can be collected for detection after 3.5 d; for the transplanted fertilized eggs, after 19 days, mice were born, their phenotypes were observed and their genotypes were analyzed.

Statistical analysis of the blastula rates revealed that blastula rates were 77.1%,71.1%,71.7%,76.6%,76.7%,73.8%, respectively, after injection of superMini-GE (379,378,377,376,375) -SWL and npB, and that this data was substantially identical to the in vitro cultured blastula rates of the wild type control group (FIG. 5C). Further statistical analysis of the mice birth rates revealed that after injection of SuperMini-GE379-SWL, tnpB, the mice birth rates were 25.5%,39.1%, respectively, which were consistent with those reported in the literature for gene editing individuals (shown in FIG. 5D). The above results confirm that injection of the supermini gene editor has no toxic or side effects on blastocyst formation and birth of individuals.

3. Mouse single blastula detection assay

Subsequently, the mice were collected and subjected to a statistical analysis of the efficiency. The specific operation is as follows:

1) Mice blasts were placed in PBS (purchased from Gibco) and rinsed 3 times;

2) 10ul embryo lysates (from Thermo) were dispensed into 200ul PCR tubes and single blasts were aspirated into the lysates with a microinjection needle, and the above system was placed in a PCR instrument and the following procedure was run: 55 degrees for 2 hours; 95 ℃ for 10min;

3) Performing nested PCR amplification on the treated single blastula, wherein Tyr-F/R is used for the first round of amplification; tyr-F1/R1 was used for the second round of amplification; the nested amplification primers were designed as follows:

Tyr-F：ttaacctattggtgcag；（SEQ ID NO.30）

Tyr-R：ttaacctattggtgcag；（SEQ ID NO.31）

Tyr-F1：GTGGATGACCGTGAGTCCT；（SEQ ID NO.32）

Tyr-R1：CCCAGTTAGTTCTCGAATTTC；（SEQ ID NO.33）

the PCR amplification system was as in Table 3. T7E1 cleavage experiments (same as above) and second generation sequencing analysis were performed on PCR amplification products obtained by single blastula amplification. As shown in FIGS. 6a, 6b and 6c, superMini-GE (379,378,377,376,375) -SWL was effective in mediating gene editing at the mouse blastula level.

4. Mouse individual level genotyping

After 2 weeks of birth, mice were observed for phenotype. Phenotypic analysis results found that mice born after injection exhibited different degrees of albino phenotype (shown in figure 7A). PCR amplification (amplification system was as described above) and second generation sequencing analysis were performed by extracting the mouse tail genome, and the mice showed different degrees of gene editing in Tyr gene (shown in FIGS. 7B-C).

In conclusion, the super mini-type gene editor effectively overcomes the defect of larger existing gene editing tools, can efficiently mediate gene editing at cell and individual levels, and has high industrial utilization value.

Finally, it should be noted that: the above embodiments are only for illustrating the technical solution of the present invention, and are not limiting; although the invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical scheme described in the foregoing embodiments can be modified or some technical features thereof can be replaced by equivalents; such modifications and substitutions do not depart from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A gene editor is characterized in that the amino acid sequence is the 1 st to 379 th amino acid sequence of the amino acid sequence shown in SEQ ID NO. 1.

2. A nucleic acid encoding the gene editor of claim 1.

3. A complex comprising a protein component and a nucleic acid component;

the protein component is the gene editor of claim 1;

the nucleic acid component contains TTGAT characteristics and a targeting sequence capable of hybridizing with a target sequence;

4. A biomaterial comprising the gene editor of claim 1, or the nucleic acid of claim 2, or the complex of claim 3; the biological material is an expression cassette, a vector, a host cell, a transgenic cell line or a recombinant microorganism.

5. A delivery composition comprising a delivery vehicle and at least one of the following components: the gene editor of claim 1, the nucleic acid of claim 2, the complex of claim 3, or the biological material of claim 4.

6. A pharmaceutical product comprising at least one of the following components: the gene editor of claim 1, the nucleic acid of claim 2, the complex of claim 3, the biomaterial of claim 4, or the delivery composition of claim 5.

7. A reagent or kit comprising at least one of the following components: the gene editor of claim 1, the nucleic acid of claim 2, the complex of claim 3, the biomaterial of claim 4, or the delivery composition of claim 5.

8. Use of the gene editor of claim 1, the nucleic acid of claim 2, the complex of claim 3, the biological material of claim 4, the delivery composition of claim 5, the pharmaceutical product of claim 6, or the reagent or kit of claim 7 in gene editing; the application is for non-disease diagnosis and therapeutic purposes.

9. A method for modifying a target gene, comprising: modifying a target gene with the gene editor of claim 1, the nucleic acid of claim 2, the complex of claim 3, the biological material of claim 4, the delivery composition of claim 5, the pharmaceutical product of claim 6, or the reagent or kit of claim 7; the methods are for non-disease diagnosis and treatment purposes.

10. The method of claim 9, further comprising editing the target gene using an editing template.