CN116948994A - Glyceraldehyde-3-phosphate dehydrogenase mutant and application thereof - Google Patents

Glyceraldehyde-3-phosphate dehydrogenase mutant and application thereof Download PDF

Info

Publication number
CN116948994A
CN116948994A CN202210398758.XA CN202210398758A CN116948994A CN 116948994 A CN116948994 A CN 116948994A CN 202210398758 A CN202210398758 A CN 202210398758A CN 116948994 A CN116948994 A CN 116948994A
Authority
CN
China
Prior art keywords
val
ala
leu
ile
lys
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202210398758.XA
Other languages
Chinese (zh)
Inventor
吴涛
薛婷莉
栾明月
姚佳琪
张孟娟
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Langfang Meihua Bio Technology Development Co Ltd
Original Assignee
Langfang Meihua Bio Technology Development Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Langfang Meihua Bio Technology Development Co Ltd filed Critical Langfang Meihua Bio Technology Development Co Ltd
Priority to CN202210398758.XA priority Critical patent/CN116948994A/en
Publication of CN116948994A publication Critical patent/CN116948994A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0008—Oxidoreductases (1.) acting on the aldehyde or oxo group of donors (1.2)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/32—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Bacillus (G)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/26—Preparation of nitrogen-containing carbohydrates
    • C12P19/28—N-glycosides
    • C12P19/30—Nucleotides
    • C12P19/32—Nucleotides having a condensed ring system containing a six-membered ring having two N-atoms in the same ring, e.g. purine nucleotides, nicotineamide-adenine dinucleotide
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/26—Preparation of nitrogen-containing carbohydrates
    • C12P19/28—N-glycosides
    • C12P19/38—Nucleosides
    • C12P19/40—Nucleosides having a condensed ring system containing a six-membered ring having two nitrogen atoms in the same ring, e.g. purine nucleosides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P25/00—Preparation of compounds containing alloxazine or isoalloxazine nucleus, e.g. riboflavin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y102/00—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2)
    • C12Y102/01—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2) with NAD+ or NADP+ as acceptor (1.2.1)
    • C12Y102/01012—Glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) (1.2.1.12)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y102/00—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2)
    • C12Y102/01—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2) with NAD+ or NADP+ as acceptor (1.2.1)
    • C12Y102/01059—Glyceraldehyde-3-phosphate dehydrogenase (NAD(P)+)(phosphorylating) (1.2.1.59)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention provides glyceraldehyde-3-phosphate dehydrogenase mutant and application thereof. The mutation of amino acid 169 of glyceraldehyde-3-phosphate dehydrogenase from glycine (G) to aspartic acid (D) or glutamic acid (E) in a microorganism of the genus Bacillus enables the microorganism to produce nucleosides with high efficiency. The invention provides an effective means for mass production of nucleosides and has wide application prospect.

Description

Glyceraldehyde-3-phosphate dehydrogenase mutant and application thereof
Technical Field
The invention belongs to the technical field of microbial engineering, and particularly relates to glyceraldehyde-3-phosphate dehydrogenase mutant and application thereof.
Background
Nucleosides are a generic term for a class of glycosides. Nucleosides are constituents of nucleic acids and nucleotides. The nucleoside is formed by condensing D-ribose or D-Z-deoxyribose with pyrimidine base or purine base. The nucleoside is generally colorless crystals, insoluble in common organic solvents, soluble in hot water and having a melting point of 160-240 ℃. Nucleosides produced from D-ribose are called ribonucleosides, involved in RNA composition; nucleosides produced from D- α -deoxyribose are called deoxyribonucleosides and participate in DNA composition. D-ribose condenses with adenine, guanine, cytosine, thymine, or uracil to form the corresponding adenine ribonucleoside, guanine ribonucleoside, cytosine ribonucleoside, thymine ribonucleoside, and uracil ribonucleoside, which are abbreviated as adenosine (A), guanosine (G), cytidine (C), thymidine (T), and uridine (U), respectively.
Guanosine and inosine have a wide range of roles in the food and pharmaceutical industries. In the food field, guanosine and inosine are important precursors of disodium guanylate and disodium inosinate, respectively, and the combination of disodium guanylate and disodium inosinate is used as a food flavor enhancer, and is widely applied to condiments such as chicken essence, soy sauce and the like. In the field of medicine, guanosine and inosine can be used as medicine intermediates of various antiviral medicines, such as acyclovir, ribavirin, guanosine triphosphate sodium and the like, and guanosine is required to be used as a synthetic raw material. Inosine is an important precursor of inosinic acid, and inosinic acid can be used as a precursor for synthesizing Adenylate (AMP) and Guanylate (GMP), and is suitable for treating leukopenia, thrombocytopenia, various heart diseases, acute and chronic hepatitis, liver cirrhosis and the like caused by various reasons, and can also treat central retinitis, optic atrophy and the like.
At present, microbial fermentation is a main method for producing nucleosides, and mainly used microorganisms include bacillus subtilis, bacillus amyloliquefaciens, bacillus pumilus and the like. In the breeding and transformation process of the growing strain, the nucleoside high-yield strain is directionally bred by using ultraviolet mutagenesis and diethyl sulfate for mutation breeding; or based on the metabolic path and regulation mechanism of nucleotide in bacteria, the genetic background and the characteristics of the strain are deeply known, and the strain is purposefully modified by metabolic engineering means to obtain the production strain with excellent properties and high nucleoside yield. However, the fermentation performance of the current nucleoside strains is still poor, the conversion rate of the nucleosides is still low, and the requirement of large-scale industrial production cannot be met.
Disclosure of Invention
The invention aims to provide glyceraldehyde-3-phosphate dehydrogenase mutant and application thereof.
To achieve the object of the present invention, in a first aspect, the present invention provides a glyceraldehyde-3-phosphate dehydrogenase mutant comprising a mutation of amino acid 169 of glyceraldehyde-3-phosphate dehydrogenase from G to D or E.
In the present invention, the reference sequence number of glyceraldehyde-3-phosphate dehydrogenase at NCBI may be NP-390780.1 or CBI43831.1.
In a second aspect, the invention provides a nucleic acid molecule encoding said glyceraldehyde-3-phosphate dehydrogenase mutant.
In a third aspect, the invention provides biological materials comprising the nucleic acid molecules, including but not limited to recombinant DNA, expression cassettes, transposons, plasmid vectors, viral vectors or engineering bacteria.
In a fourth aspect, the invention provides any one of the following uses of the nucleic acid molecule or a biological material comprising the nucleic acid molecule:
(1) Used for fermentation production of nucleoside;
(2) For improving fermentation yield of nucleosides;
(3) Is used for constructing the genetic engineering bacteria for producing nucleosides.
In a fifth aspect, the present invention provides a method for constructing a nucleoside-producing strain, comprising introducing a mutation into the genome of a microorganism having nucleoside-producing ability by genetic engineering means so that the glyceraldehyde-3-phosphate dehydrogenase encoded thereby comprises a G169D or G169E mutation site.
Wherein the microorganism is Bacillus (Bacillus) strain such as Bacillus subtilis (Bacillus subtilis), bacillus amyloliquefaciens (Bacillus amyloliquefaciens), and Bacillus pumilus (Bacillus pumilus). Preferably bacillus subtilis or bacillus amyloliquefaciens, more preferably b.subtilis A1 (see CN 201910599510.8) or b.a8333.
The construction process of the a8333 strain is as follows (see cn202111266398. X): with strain DSM7 (ATCC 23350, see Genome sequence of B. Amyloquefaciens type strain DSM 7) T reveals differences to plant-associated B.amyloquefaciens FZB 42) genome as template, guaB-1f/1r and guaB-2f/3r as primers, 2 fragments were amplified using Phusion super Fidelity polymerase (New England BioLabs). 2 fragments were fused by using the primer guaB-1f/3r to obtain a recombinant fragment (the nucleotide sequence of the ORF region is shown as SEQ ID NO: 9). Will guaB L454F Fragment and pKSU plasmid (pKSU plasmid is given by university of south opening Wang Shufang, see A markerless gene replacement method for B. Amyloliquefaciens LL3 and its use in genome reduction and improvement of poly-gamma-glutamic acid production [ J)]The recombinant plasmid pKSU-guaB is obtained after operations such as SalI/PstI double digestion, assembly, transformation and the like of 8963-8973.Zhang W,Gao W,Feng J,et al DOI:10.1007/s00253-014-5824-2 (21), applied Microbiology and Biotechnology,2014,98 (21) L454F . Transformants were selected at 30℃with LB plates containing 2.5. Mu.g/mL chloramphenicol, transferred to B.a 836 strain (see CN 112574934A), inoculated into 5mL LB liquid medium, cultured at 42℃at 200rpm for 12 hours and transferred to a generation, and diluted and spread to LB plates containing 5. Mu.g/mL chloramphenicol to obtain primary recombinants; inoculating the primary recombinant into 5ml LB liquid medium, culturing at 42 deg.C and 200rpm for 12 hr, transferring to primary, diluting and coating LB plate containing 0.8 μm 5-FU for screening secondary recombinant, and screening to obtain guaB L454F The strain obtained was b.a 837. Extraction of pBE43 plasmid (PBE 43 plasmid is total Gene Synthesis, ref. Effects of overexpression of key enzyme genes on guanosine accumulation in Bacillus amyloliquefaciens), linearization of the plasmid using KpnI/SalI, fusion PCR of the mutated purR sequence (abbreviated as R2, SEQ ID NO: 10) and mutated tal sequence (abbreviated as L5, SEQ ID NO: 11) to obtain R2+L5 fragment, ligation to linearized P using an assembly kitIn the BE43 plasmid, the plasmid PBE43-R2+L5 is constructed and obtained. This plasmid was transformed into strain b.a 837 to give the starting strain b.a8333.
In a sixth aspect, the present invention provides a method for constructing a nucleoside-producing engineering bacterium, wherein the nucleoside-producing strain constructed by the above method is used as a starting strain, and the starting strain is genetically engineered by at least one of the following methods (1) to (3):
(1) introducing mutation into the original strain by utilizing a genetic engineering means, so that the coded pyruvate kinase contains a T101K, T101R or T101P mutation site;
(2) introducing a mutation into the starting strain by genetic engineering means such that its pycA gene encoding pyruvate carboxylase comprises a mutation of the first base from T to G or A;
(3) by means of genetic engineering, mutation is introduced into the original strain to make the coded phosphoenolpyruvate carboxykinase contain K147R or K147H mutation site.
Preferably, the starting strain is genetically engineered using the combination of (1) to (3).
In the present invention, the reference sequence number of pyruvate kinase on NCBI may be NP-390796.1, and the reference sequence number of phosphoenolpyruvate carboxykinase on NCBI may be NP-390934.2.
The pycA gene may be from bacillus subtilis:
i) A nucleotide sequence shown as SEQ ID NO. 7;
ii) the nucleotide sequence shown in SEQ ID NO. 7 is substituted, deleted and/or added with one or more nucleotides and expresses the same functional protein;
iii) A nucleotide sequence which hybridizes to the sequence shown in SEQ ID No. 7 and expresses the same functional protein under stringent conditions, i.e., in a 0.1 XSSPE solution containing 0.1% SDS or in a 0.1 XSSC solution containing 0.1% SDS, at 65℃and washing the membrane with the solution;
iv) a nucleotide sequence which has more than 90% homology with the nucleotide sequence of i), ii) or iii) and expresses the same functional protein.
The pycA gene may be from bacillus amyloliquefaciens, which is:
a) A nucleotide sequence shown as SEQ ID NO. 8;
b) The nucleotide sequence shown in SEQ ID NO. 8 is a nucleotide sequence which is substituted, deleted and/or added with one or more nucleotides and expresses the same functional protein;
c) A nucleotide sequence which hybridizes to the sequence shown in SEQ ID No. 8 and expresses the same functional protein under stringent conditions, i.e., in a 0.1 XSSPE solution containing 0.1% SDS or in a 0.1 XSSC solution containing 0.1% SDS, at 65℃and washing the membrane with the solution;
d) Nucleotide sequences which have more than 90% homology with the nucleotide sequences of a), b) or c) and express the same functional protein.
In a seventh aspect, the present invention provides a nucleoside producing strain or engineering bacterium constructed according to the method.
In an eighth aspect, the present invention provides a method of producing nucleosides, the method comprising the steps of:
1) Culturing the nucleoside producing strain or engineering bacterium to obtain a culture of the microorganism;
2) Collecting the produced nucleosides from the culture obtained in step 1).
The nucleoside includes adenosine, inosine, guanosine and their corresponding nucleoside derivatives such as inosine, inosinic acid, guanine, guanylic acid, riboflavin, diacetylguanylic acid, etc.
By means of the technical scheme, the invention has at least the following advantages and beneficial effects:
the glyceraldehyde-3-phosphate dehydrogenase mutant has positive effect on the improvement of the adenosine and inosine yields of bacillus subtilis. After the 169 th amino acid of glyceraldehyde-3-phosphate dehydrogenase is mutated from glycine (G) to aspartic acid (D) or glutamic acid (E), the yield of adenosine and inosine is improved, and particularly, the effect is best after the glycine (G) is mutated to glutamic acid (E). Mutant gapB G169E The yield of the engineering strain A365 adenosine is improved from 4.4g/L to 5.5g/L optimally, and the mutant gapB G169D The yield of the inosine of the engineering strain A363 is improved from 2.2g/L to 3.1g/L optimally.
The glyceraldehyde-3-phosphate dehydrogenase mutant has positive effect on improving guanosine and inosine yields of bacillus amyloliquefaciens. After the 169 th amino acid of glyceraldehyde-3-phosphate dehydrogenase is mutated from glycine (G) to aspartic acid (D) or glutamic acid (E), guanosine yield and inosine yield are improved, and particularly, after glycine (G) is mutated to glutamic acid (E), the effect is best. Mutant gapB G169E The yield of the guanosine of the engineering strain 8453 is improved from 17.1g/L to 19.5g/L optimally, and the mutant gapB is obtained G169D The yield of the engineering strain 8449 inosine is improved from 1.5g/L to 1.9g/L optimally.
Detailed Description
The present invention aims to provide a method for producing purine nucleosides by using a microorganism, and a novel microorganism capable of producing purine nucleosides with high efficiency.
It has been found that glyceraldehyde-3-phosphate dehydrogenase of Bacillus subtilis or Bacillus amyloliquefaciens is modified so that a microorganism can efficiently produce nucleosides and a new microorganism capable of efficiently producing nucleosides has been successfully created, thereby completing the present invention.
The invention adopts the following technical scheme:
the present invention provides a Bacillus subtilis in which the 169 th amino acid of glyceraldehyde-3-phosphate dehydrogenase (NP-390780.1) encoded by gapB Gene (reference sequence No. Gene ID:937393 on NCBI) is mutated from glycine (G) to aspartic acid (D) or glutamic acid (E). Wild type glyceraldehyde-3-phosphate dehydrogenase derived from Bacillus subtilis and mutant gapB thereof G169D 、gapB G169E The amino acid sequences of (2) are respectively shown as SEQ ID NO 1-3.
glyceraldehyde-3-phosphate dehydrogenase encoded by gapB gene participates in gluconeogenesis, catalyzes oxidative phosphorylation of glyceraldehyde-3-phosphate (G3P) to 1, 3-Biphosphate (BPG), and the process can be divided into two steps of reaction, requiring participation of cofactor NADP (or NAD). The first reaction involves forming a hemiacetal intermediate between G3P and a cysteine residue, and then oxidizing the hemiacetal intermediate to a thioester while reducing NADP (or NAD) to NADPH (or NADH). The second reaction involves exchange of the reducing NADPH (or NADH) with a second NADP (or NAD) and attack of the thioester by the nucleophilic inorganic phosphate to form BPG. The total reaction equation is: g3p+ phosphate+nad (P) (+) < = > bpg+nad (P) H.
The invention realizes mutation of glyceraldehyde-3-phosphate dehydrogenase by modifying gapB gene, so that the capability of the microorganism for producing nucleoside is enhanced compared with unmodified strain, and finally the yield of nucleoside is improved.
The bacillus subtilis initial strain used in the invention is Bacillus subtilis A1 (hereinafter referred to as A1), and the construction method can be seen in CN201910599510.8.
The Bacillus subtilis mutant strain A342-pckA used in the invention K147R (hereinafter referred to as A358) is self-constructed, and the construction method can be also seen in CN202210255870.8.
The present invention also provides a Bacillus amyloliquefaciens, wherein the 169 th amino acid of glyceraldehyde-3-phosphate dehydrogenase (reference sequence number CBI43831.1 on NCBI) encoded by gapB gene (BAMF_2705 on NCBI) is mutated from glycine (G) to aspartic acid (D) or glutamic acid (E). Wild glyceraldehyde-3-phosphate dehydrogenase derived from Bacillus amyloliquefaciens and mutant gapB thereof G169D 、gapB G169E The amino acid sequences of (2) are respectively shown as SEQ ID NO 4-6.
The invention realizes mutation of glyceraldehyde-3-phosphate dehydrogenase by modifying gapB gene, so that the capability of the microorganism for producing nucleoside is enhanced compared with unmodified strain, and finally the yield of nucleoside is improved.
The bacillus amyloliquefaciens initial strain used in the invention is Bacillus amyloliquefaciens 8333 (hereinafter referred to as B.a 8333), and the construction method can be seen in CN202111266398.X.
Bacillus amyloliquefaciens mutant strain 8333-pycA for use in the present invention t1a (hereinafter abbreviated as 8441) is self-construction, and the construction method can be also seen in CN202210255870.8.
The following examples are illustrative of the invention and are not intended to limit the scope of the invention. Unless otherwise indicated, the examples are in accordance with conventional experimental conditions, such as the molecular cloning laboratory Manual of Sambrook et al (Sambrook J & Russell DW, molecular Cloning: a Laboratory Manual, 2001), or in accordance with the manufacturer's instructions.
The amino acid sequence of the pyruvate kinase related in the following example is shown as SEQ ID NO. 12, the nucleotide sequence encoding the pyruvate carboxylase derived from Bacillus subtilis is shown as SEQ ID NO. 7, the nucleotide sequence encoding the pyruvate carboxylase derived from Bacillus amyloliquefaciens is shown as SEQ ID NO. 8, and the amino acid sequence of the phosphoenolpyruvate carboxykinase is shown as SEQ ID NO. 13.
The primers used in the following examples are shown in Table 1:
TABLE 1
Primer name Primer sequence (5 '-3')
pyk T101K -UP-1F GGTTCTCCGAGTGCTGCTGAC
pyk T101K -UP-1R CATATGTCACTGAAATTTTATCTGTTGTTCCTACAACCTCGTCCA
pyk T101K -DN-2F TGGACGAGGTTGTAGGAACAACAGATAAAATTTCAGTGACATATG
pyk T101K -DN-2R ACAGGTTTGCCCAGCGCGTTG
pycA t1g -UP-1F TCATCAGGTTTGCAAGTGATC
pycA t1a -UP-1R ACTTTTTGTATCGATTGCTGAGACATACTTTTCTCCCCCTTACCCGAA
pycA t1a -DN-2F TTCGGGTAAGGGGGAGAAAAGTATGTCTCAGCAATCGATACAAAAAGT
pycA t1g -DN-2R GCGAGGCTTTAATGATGATCGG
pycA t1g -UP-3F CGGCCTCGGTCTCGGAGAAAG
pycA t1a -UP-3R CTTTTTGGATGGATTGTTGTGACATACTTTTCTCCCCCTTGGCCTAA
pycA t1a -DN-4F TTAGGCCAAGGGGGAGAAAAGTATGTCACAACAATCCATCCAAAAAG
pycA t1g -DN-4R GTTCCTGACGATTCTCATTCC
pckA K147R -UP-1F CGTAAAAGGGTTTGCAATGTC
pckA K147R -UP-1R GGTGAACGGCTGCTCAACTGTTCTCTTATCATTTCCTTCCGGACGGA
pckA K147R -DN-2F TCCGTCCGGAAGGAAATGATAAGAGAACAGTTGAGCAGCCGTTCACC
pckA K147R -DN-2R ATATGAATCGGGTAAGCTGCC
gapB G169D -UP-1F GGTAAAAGTAGCGATCAACGG
gapB G169D -UP-1R GTAGTCATCAGACCGCTCTCAATGTCAAACTCTTCATCCAGCACTTTTAC
gapB G169D -DN-2F GTAAAAGTGCTGGATGAAGAGTTTGACATTGAGAGCGGTCTGATGACTAC
gapB G169D -DN-2R ATACAGCAGACGGATGTTTCA
gapB G169E -UP-1R GTAGTCATCAGACCGCTCTCAATCTCAAACTCTTCATCCAGCACTTTTAC
gapB G169E -DN-2F GTAAAAGTGCTGGATGAAGAGTTTGAGATTGAGAGCGGTCTGATGACTAC
gapB G169D -UP-3F GGTAAAAGTAGCAATCAACGG
gapB G169D -UP-3R GTCGTCATCAGGCCGCTTTCAATGTCGAATTCCTGATCGAGCACTTTGAC
gapB G169D -DN-4F GTCAAAGTGCTCGATCAGGAATTCGACATTGAAAGCGGCCTGATGACGAC
gapB G169D -DN-4R ACACAGCTGACGGGTGTTTCA
gapB G169E -UP-3R GTCGTCATCAGGCCGCTTTCAATCTCGAATTCCTGATCGAGCACTTTGAC
gapB G169E -DN-4F GTCAAAGTGCTCGATCAGGAATTCGAGATTGAAAGCGGCCTGATGACGAC
EXAMPLE 1 construction of pyruvate kinase mutant strains A1-pyk T101K
Primer pyk Using the genome of Strain B.subtilis A1 as a template T101K -UP-1F/pyk T101K -UP-1R and pyk T101K -DN-2F/pyk T101K DN-2R, 2 fragments were amplified using Phusion super Fidelity polymerase (New England BioLabs). By primer pyk T101K -UP-1F/pyk T101K The 2 fragments were fused by DN-2R to obtain recombinant fragments. The recombinant fragment was combined with the pKSU plasmid (pKSU plasmid is given by the teachings of university of south opening Wang Shufang, see Amarkerless gene replacement method for B. Amyloliquefaciens LL3 and its use in genome reduction and improvement of poly-gamma-glutamic acid production [ J)]The recombinant plasmid pKSU-pyk is obtained after operations such as assembly and transformation of 8963-8973.Zhang W,Gao W,Feng J,et al DOI:10.1007/s00253-014-5824-2, etc. of Applied Microbiology and Biotechnology,2014,98 (21) T101K . Transformation into B.subtilis A1 Strain, selection of transformants with LB plate containing 2.5. Mu.g/mL chloramphenicol at 30℃and transfer of the obtained transformants into 5mL LB liquid medium, cultivation at 42℃and 200rpm for 12 hours and dilution and coating onto LB plate containing 5. Mu.g/mL chloramphenicol to obtain a primary weightGrouping; inoculating the primary recombinant into 5ml LB liquid medium, culturing at 42 deg.C and 200rpm for 12 hr, transferring to primary, diluting and coating LB plate containing 0.8 μm 5-FU for screening secondary recombinant, and screening to obtain pyk T101K Point mutant strain designated A1-pyk T101K Hereinafter referred to as a325.
EXAMPLE 2 construction of pyruvate carboxylase mutant Strain A325-pycA t1a
The genome of strain B.subilis A1 is used as a template, and a primer pycA t1g -UP-1F/pycA t1a -UP-1R and pycA t1a -DN-2F/pycA t1g DN-2R, 2 fragments were amplified using Phusion super Fidelity polymerase (New England BioLabs). With primer pycA t1g -UP-1F/pycA t1g The 2 fragments were fused by DN-2R to obtain recombinant fragments. The recombinant fragment is assembled with the pKSU plasmid, transformed and the like to obtain the recombinant plasmid pKSU-pycA t1a . Transferring into A325 strain, screening transformant with LB plate containing 2.5 mug/mL chloramphenicol at 30deg.C, inoculating obtained transformant into 5mL LB liquid medium, culturing at 42 deg.C 200rpm for 12h and transferring to generation, diluting and coating onto LB plate containing 5 mug/mL chloramphenicol to obtain primary recombinant; inoculating the primary recombinant into 5ml LB liquid medium, culturing at 42 deg.C and 200rpm for 12 hr, transferring to primary, diluting and coating LB plate containing 0.8 μm 5-FU for screening secondary recombinant, and screening to obtain pycA t1a Point mutant strain designated A325-pycA t1a Hereinafter, a342 is abbreviated.
EXAMPLE 3 construction of phosphoenolpyruvate carboxykinase mutant Strain A342-pckA K147R
The genome of the strain B.subtilis A1 is used as a template, and a primer pckA K147R -UP-1F/pckA K147R -UP-1R and pckA K147R -DN-2F/pckA K147R DN-2R, 2 fragments were amplified using Phusion super Fidelity polymerase (New England BioLabs). With primer pckA K147R -UP-1F/pckA K147R The 2 fragments were fused by DN-2R to obtain recombinant fragments. The recombinant fragment and the pKSU plasmid are assembled, transformed and the like to obtain the recombinant plasmid pKSU-pckA K147R . Transformation into A342 Strain, selection of transformants with LB plate containing 2.5. Mu.g/mL chloramphenicol at 30℃and grafting of the obtained transformants into 5mL LB liquidCulturing in a culture medium at 42 ℃ for 12 hours at 200rpm, transferring the first generation, diluting and coating the first generation on an LB plate containing 5 mu g/mL chloramphenicol to obtain a first recombinant; inoculating the primary recombinant into 5ml LB liquid medium, culturing at 42 deg.C and 200rpm for 12 hr, transferring to primary, diluting and coating LB plate containing 0.8 μm 5-FU for screening secondary recombinant, and screening to obtain pckA K147R Point mutant strain designated A342-pckA K147R Hereinafter, a358 is abbreviated.
EXAMPLE 4 construction of glyceraldehyde-3-phosphate dehydrogenase mutant Strain A358-gapB G169D
The primer gapB is prepared by taking the genome of the strain B.subtilis A1 as a template G169D -UP-1F/gapB G169D UP-1R and gapB G169D -DN-2F/gapB G169D DN-2R, 2 fragments were amplified using Phusion super Fidelity polymerase (New England BioLabs). With primer gapB G169D -UP-1F/gapB G169D The 2 fragments were fused by DN-2R to obtain recombinant fragments. The recombinant plasmid pKSU-gapB is obtained after the recombinant fragment and the pKSU plasmid are assembled, transformed and the like G169D . Transferring to A358 strain, screening transformant with LB plate containing 2.5 mug/mL chloramphenicol at 30deg.C, inoculating obtained transformant into 5mL LB liquid medium, culturing at 42 deg.C 200rpm for 12h and transferring to generation, diluting and coating onto LB plate containing 5 mug/mL chloramphenicol to obtain primary recombinant; inoculating the primary recombinant into 5ml LB liquid medium, culturing at 42 deg.C and 200rpm for 12 hr, transferring to primary, diluting and coating LB plate containing 0.8 μm 5-FU for screening secondary recombinant, and screening to obtain gapB G169D Point mutant strain designated A358-gapB G169D Hereinafter, a363.
EXAMPLE 5 construction of glyceraldehyde-3-phosphate dehydrogenase mutant strain A358-gapB G169E
The primer gapB is prepared by taking the genome of the strain B.subtilis A1 as a template G169D -UP-1F/gapB G169E UP-1R and gapB G169E -DN-2F/gapB G169D DN-2R, 2 fragments were amplified using Phusion super Fidelity polymerase (New England BioLabs). With primer gapB G169D -UP-1F/gapB G169D The 2 fragments were fused by DN-2R to obtain recombinant fragments. The recombinant plasmid pKSU-gapB is obtained after the recombinant fragment and the pKSU plasmid are assembled, transformed and the like G169E . Transferring to A358 strain, screening transformant with LB plate containing 2.5 mug/mL chloramphenicol at 30deg.C, inoculating obtained transformant into 5mL LB liquid medium, culturing at 42 deg.C 200rpm for 12h and transferring to generation, diluting and coating onto LB plate containing 5 mug/mL chloramphenicol to obtain primary recombinant; inoculating the primary recombinant into 5ml LB liquid medium, culturing at 42 deg.C and 200rpm for 12 hr, transferring to primary, diluting and coating LB plate containing 0.8 μm 5-FU for screening secondary recombinant, and screening to obtain gapB G169E Point mutant strain designated A358-gapB G169E Hereinafter, a365 is abbreviated.
EXAMPLE 6 construction of pyruvate carboxylase mutant Strain 8333-pycA t1a
The genome of the strain Bacillus amyloliquefaciens 8333 is used as a template, and a primer pycA t1g -UP-3F/pycA t1a -UP-3R and pycA t1a -DN-4F/pycA t1g DN-4R, 2 fragments were amplified using Phusion super Fidelity polymerase (New England BioLabs). With primer pycA t1g -UP-3F/pycA t1g The 2 fragments were fused by DN-4R to obtain recombinant fragments. The recombinant fragment is assembled with the pKSU plasmid, transformed and the like to obtain the recombinant plasmid pKSU-pycA t1a . Transforming into Bacillus amyloliquefaciens 8333 strain, screening transformant with LB plate containing 2.5 mug/mL chloramphenicol at 30deg.C, inoculating obtained transformant into 5mL LB liquid medium, culturing at 42 deg.C 200rpm for 12h and transferring to generation, diluting and coating onto LB plate containing 5 mug/mL chloramphenicol to obtain primary recombinant; inoculating the primary recombinant into 5ml LB liquid medium, culturing at 42 deg.C and 200rpm for 12 hr, transferring to primary, diluting and coating LB plate containing 0.8 μm 5-FU for screening secondary recombinant, and screening to obtain pycA t1a Point mutant strain designated 8333-pycA t1a Hereinafter, 8441 is abbreviated.
EXAMPLE 7 construction of glyceraldehyde-3-phosphate dehydrogenase mutant strain 8441-gapB G169D
The genome of the strain Bacillus amyloliquefaciens 8333 is used as a template, and a primer gapB is used G169D -UP-3F/gapB G169D UP-3R and gapB G169D -DN-4F/gapB G169D DN-4R, 2 fragments were amplified using Phusion super Fidelity polymerase (New England BioLabs). With primer gapB G169D -UP-3F/gapB G169D The 2 fragments were fused by DN-4R to obtain recombinant fragments. The recombinant plasmid pKSU-gapB is obtained after the recombinant fragment and the pKSU plasmid are assembled, transformed and the like G169D . Transferring into 8441 strain, screening transformant with LB plate containing 2.5 mug/mL chloramphenicol at 30deg.C, inoculating obtained transformant into 5mL LB liquid medium, culturing at 42 deg.C 200rpm for 12h and transferring to generation, diluting and coating onto LB plate containing 5 mug/mL chloramphenicol to obtain primary recombinant; inoculating the primary recombinant into 5ml LB liquid medium, culturing at 42 deg.C and 200rpm for 12 hr, transferring to primary, diluting and coating LB plate containing 0.8 μm 5-FU for screening secondary recombinant, and screening to obtain gapB G169D Point mutant strain designated 8441-gapB G169D Hereinafter, 8449 is abbreviated.
EXAMPLE 8 construction of glyceraldehyde-3-phosphate dehydrogenase mutant strain 8441-gapB G169E
The genome of the strain Bacillus amyloliquefaciens 8333 is used as a template, and a primer gapB is used G169D -UP-3F/gapB G169E UP-3R and gapB G169E -DN-4F/gapB G169D DN-4R, 2 fragments were amplified using Phusion super Fidelity polymerase (New England BioLabs). With primer gapB G169D -UP-3F/gapB G169D The 2 fragments were fused by DN-4R to obtain recombinant fragments. The recombinant plasmid pKSU-gapB is obtained after the recombinant fragment and the pKSU plasmid are assembled, transformed and the like G169E . Transferring into 8441 strain, screening transformant with LB plate containing 2.5 mug/mL chloramphenicol at 30deg.C, inoculating obtained transformant into 5mL LB liquid medium, culturing at 42 deg.C 200rpm for 12h and transferring to generation, diluting and coating onto LB plate containing 5 mug/mL chloramphenicol to obtain primary recombinant; inoculating the primary recombinant into 5ml LB liquid medium, culturing at 42 deg.C and 200rpm for 12 hr, transferring to primary, diluting and coating LB plate containing 0.8 μm 5-FU for screening secondary recombinant, and screening to obtain gapB G169E Point mutant strain designated 8441-gapB G169E Hereinafter abbreviated as 8453.
Example 9 glycoside production Performance validation of Bacillus subtilis engineering strains
1. Culture medium:
(1) Seed culture formula (g/L): glucose 20, yeast powder 5, corn steep liquor dry powder 5, monopotassium phosphate 3, magnesium sulfate 0.5, ferrous sulfate 0.02, manganese sulfate 0.01, pH 7.0-7.2 and sterilizing at 121 ℃ for 20min.
(2) Fermentation medium formulation (g/L): glucose 60, yeast powder 3.5, monopotassium phosphate 3, ammonium sulfate 25, manganese sulfate 0.01, magnesium sulfate 5, monosodium glutamate 10, corn steep liquor dry powder 15, calcium carbonate 25, pH 7.0-7.2 and sterilizing at 121 ℃ for 20min.
2. Culture method
(1) Strains three sections were streaked on LB plates and incubated overnight at 37 ℃.
(2) Single colonies were picked and inoculated into 30mL of seed medium, and cultured at 110rpm and 36℃for 7-8 hours.
(3) The cells were inoculated into 30ml of a fermentation medium at 10% (v/v) and incubated at 120rpm and 36℃for 36 hours.
3. Detection and results
The detection of nucleosides in the fermentation broth was performed using High Performance Liquid Chromatography (HPLC), the results are shown in table 2.
TABLE 2 shaking flask fermentation production ability evaluation results (three-time repeated mean)
Strain Adenosine yield (g/L) Inosine yield (g/L)
A1 1.3 0.6
A325 2.1* 1.0*
A342 3.4* 1.5*
A358 4.4* 2.2*
A363 5.2* 3.1*
A365 5.5* 2.6*
Note that: * Indicating a significant difference (P < 0.01) compared to the starting strain.
From the above experimental results, it was found that glyceraldehyde-3-phosphate dehydrogenase mutant has positive effect on improvement of adenosine and inosine production, mutant gapB G169E The yield of the engineering strain A365 adenosine is improved from 4.4g/L to 5.5g/L optimally, and the mutant gapB G169D The yield of the inosine of the engineering strain A363 is improved from 2.2g/L to 3.1g/L optimally.
Example 10 glycoside production Performance validation of Bacillus amyloliquefaciens engineering strain
1. Culture medium:
(1) Seed culture formula (g/L): glucose 20, yeast powder 5, corn steep liquor dry powder 5, monopotassium phosphate 3, magnesium sulfate 0.5, ferrous sulfate 0.02, manganese sulfate 0.01, pH 7.0-7.2 and sterilizing at 121 ℃ for 20min.
(2) Fermentation medium formulation (g/L): 120 parts of glucose, 3.5 parts of yeast powder, 3 parts of monopotassium phosphate, 25 parts of ammonium sulfate, 0.01 part of manganese sulfate, 5 parts of magnesium sulfate, 10 parts of monosodium glutamate, 15 parts of corn steep liquor dry powder, 25 parts of calcium carbonate, and sterilizing at the pH of 7.0-7.2 and 121 ℃ for 20 minutes.
2. Culture method
(1) The glycerol-preserved strain was streaked on LB plates and cultured overnight at 37℃to give a monoclonal.
(2) Single colonies were picked and inoculated into 30mL of seed medium and cultured at 110rpm at 37℃for 7-8 h.
(3) The cells were inoculated into 30ml of fermentation medium at 10% (v/v) and incubated at 35℃for 70 hours at 130rpm on a shaker.
3. Detection and results
The detection of nucleosides in the fermentation broth was performed using High Performance Liquid Chromatography (HPLC) and the results are shown in table 3.
TABLE 3 evaluation of guanosine and inosine produced by shake flask fermentation (average of three replicates)
Strain Guanosine yield (g/L) Inosine yield (g/L)
8333 9.8 1.0
8441 17.1* 1.5*
8449 19.2* 1.9*
8453 19.5* 1.8*
Note that: * Indicating a significant difference (P < 0.01) compared to the starting strain.
From the above experimental results, it was found that glyceraldehyde-3-phosphate dehydrogenase mutant has positive effect on improvement of guanosine and inosine yields, mutant gapB G169E The yield of the guanosine of the engineering strain 8453 is improved from 17.1g/L to 19.5g/L optimally, and the mutant gapB is obtained G169D The yield of the engineering strain 8449 inosine is improved from 1.5g/L to 1.9g/L optimally.
Therefore, the glyceraldehyde-3-phosphate dehydrogenase mutant and the glyceraldehyde-3-phosphate dehydrogenase mutant strain provided by the invention have remarkable promotion effect on the improvement of the yield of target products of adenosine or guanosine and inosine. The glyceraldehyde-3-phosphate dehydrogenase mutant and the recombinant microorganism thereof provide references for the construction of production strains for producing adenosine or guanosine and inosine and derivatives taking the mutant as precursors.
The order of the steps of the construction of the strain of the invention is not limited, and the person skilled in the art can achieve the purpose of the invention according to the disclosure of the invention, and the construction of the strain belongs to the protection scope of the invention.
The strain codes in the invention are as A1-pyk T101K 、A325-pycA t1a 、A342-pckA K147R 、A358-gapB G169D 、A358-gapB G169E Etc. are for convenience of description and should not be construed as limiting the invention. The bacillus subtilis pyruvate kinase mutation pyk constructed by the method T101K Pyruvic acid carboxylase mutant pycA T1A Isoengineering bacteria, phosphoenolpyruvate carboxykinase mutant pckA K147R Isoengineering bacteria, and glyceraldehyde-3-phosphate dehydrogenase mutant gapB G169D 、gapB G169E Isoengineering bacteria and mutant gapB containing bacillus amyloliquefaciens glyceraldehyde-3-phosphate dehydrogenase G169D 、gapB G169E The use of engineering bacteria includes, but is not limited to, adenosine or guanosine, inosine.
While the invention has been described in detail in the foregoing general description and with reference to specific embodiments thereof, it will be apparent to one skilled in the art that modifications and improvements can be made thereto. Accordingly, such modifications or improvements may be made without departing from the spirit of the invention and are intended to be within the scope of the invention as claimed.
Sequence listing
<110> gallery plum blossom biotechnology development Co., ltd
<120> glyceraldehyde-3-phosphate dehydrogenase mutant and use thereof
<130> KHP221113205.7
<160> 13
<170> SIPOSequenceListing 1.0
<210> 1
<211> 340
<212> PRT
<213> Bacillus subtilis (Bacillus subtilis)
<400> 1
Met Lys Val Lys Val Ala Ile Asn Gly Phe Gly Arg Ile Gly Arg Met
1 5 10 15
Val Phe Arg Lys Ala Met Leu Asp Asp Gln Ile Gln Val Val Ala Ile
20 25 30
Asn Ala Ser Tyr Ser Ala Glu Thr Leu Ala His Leu Ile Lys Tyr Asp
35 40 45
Thr Ile His Gly Arg Tyr Asp Lys Glu Val Val Ala Gly Glu Asp Ser
50 55 60
Leu Ile Val Asn Gly Lys Lys Val Leu Leu Leu Asn Ser Arg Asp Pro
65 70 75 80
Lys Gln Leu Pro Trp Arg Glu Tyr Asp Ile Asp Ile Val Val Glu Ala
85 90 95
Thr Gly Lys Phe Asn Ala Lys Asp Lys Ala Met Gly His Ile Glu Ala
100 105 110
Gly Ala Lys Lys Val Ile Leu Thr Ala Pro Gly Lys Asn Glu Asp Val
115 120 125
Thr Ile Val Met Gly Val Asn Glu Asp Gln Phe Asp Ala Glu Arg His
130 135 140
Val Ile Ile Ser Asn Ala Ser Cys Thr Thr Asn Cys Leu Ala Pro Val
145 150 155 160
Val Lys Val Leu Asp Glu Glu Phe Gly Ile Glu Ser Gly Leu Met Thr
165 170 175
Thr Val His Ala Tyr Thr Asn Asp Gln Lys Asn Ile Asp Asn Pro His
180 185 190
Lys Asp Leu Arg Arg Ala Arg Ala Cys Gly Glu Ser Ile Ile Pro Thr
195 200 205
Thr Thr Gly Ala Ala Lys Ala Leu Ser Leu Val Leu Pro His Leu Lys
210 215 220
Gly Lys Leu His Gly Leu Ala Leu Arg Val Pro Val Pro Asn Val Ser
225 230 235 240
Leu Val Asp Leu Val Val Asp Leu Lys Thr Asp Val Thr Ala Glu Glu
245 250 255
Val Asn Glu Ala Phe Lys Arg Ala Ala Lys Thr Ser Met Tyr Gly Val
260 265 270
Leu Asp Tyr Ser Asp Glu Pro Leu Val Ser Thr Asp Tyr Asn Thr Asn
275 280 285
Pro His Ser Ala Val Ile Asp Gly Leu Thr Thr Met Val Met Glu Asp
290 295 300
Arg Lys Val Lys Val Leu Ala Trp Tyr Asp Asn Glu Trp Gly Tyr Ser
305 310 315 320
Cys Arg Val Val Asp Leu Ile Arg His Val Ala Ala Arg Met Lys His
325 330 335
Pro Ser Ala Val
340
<210> 2
<211> 340
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 2
Met Lys Val Lys Val Ala Ile Asn Gly Phe Gly Arg Ile Gly Arg Met
1 5 10 15
Val Phe Arg Lys Ala Met Leu Asp Asp Gln Ile Gln Val Val Ala Ile
20 25 30
Asn Ala Ser Tyr Ser Ala Glu Thr Leu Ala His Leu Ile Lys Tyr Asp
35 40 45
Thr Ile His Gly Arg Tyr Asp Lys Glu Val Val Ala Gly Glu Asp Ser
50 55 60
Leu Ile Val Asn Gly Lys Lys Val Leu Leu Leu Asn Ser Arg Asp Pro
65 70 75 80
Lys Gln Leu Pro Trp Arg Glu Tyr Asp Ile Asp Ile Val Val Glu Ala
85 90 95
Thr Gly Lys Phe Asn Ala Lys Asp Lys Ala Met Gly His Ile Glu Ala
100 105 110
Gly Ala Lys Lys Val Ile Leu Thr Ala Pro Gly Lys Asn Glu Asp Val
115 120 125
Thr Ile Val Met Gly Val Asn Glu Asp Gln Phe Asp Ala Glu Arg His
130 135 140
Val Ile Ile Ser Asn Ala Ser Cys Thr Thr Asn Cys Leu Ala Pro Val
145 150 155 160
Val Lys Val Leu Asp Glu Glu Phe Asp Ile Glu Ser Gly Leu Met Thr
165 170 175
Thr Val His Ala Tyr Thr Asn Asp Gln Lys Asn Ile Asp Asn Pro His
180 185 190
Lys Asp Leu Arg Arg Ala Arg Ala Cys Gly Glu Ser Ile Ile Pro Thr
195 200 205
Thr Thr Gly Ala Ala Lys Ala Leu Ser Leu Val Leu Pro His Leu Lys
210 215 220
Gly Lys Leu His Gly Leu Ala Leu Arg Val Pro Val Pro Asn Val Ser
225 230 235 240
Leu Val Asp Leu Val Val Asp Leu Lys Thr Asp Val Thr Ala Glu Glu
245 250 255
Val Asn Glu Ala Phe Lys Arg Ala Ala Lys Thr Ser Met Tyr Gly Val
260 265 270
Leu Asp Tyr Ser Asp Glu Pro Leu Val Ser Thr Asp Tyr Asn Thr Asn
275 280 285
Pro His Ser Ala Val Ile Asp Gly Leu Thr Thr Met Val Met Glu Asp
290 295 300
Arg Lys Val Lys Val Leu Ala Trp Tyr Asp Asn Glu Trp Gly Tyr Ser
305 310 315 320
Cys Arg Val Val Asp Leu Ile Arg His Val Ala Ala Arg Met Lys His
325 330 335
Pro Ser Ala Val
340
<210> 3
<211> 340
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 3
Met Lys Val Lys Val Ala Ile Asn Gly Phe Gly Arg Ile Gly Arg Met
1 5 10 15
Val Phe Arg Lys Ala Met Leu Asp Asp Gln Ile Gln Val Val Ala Ile
20 25 30
Asn Ala Ser Tyr Ser Ala Glu Thr Leu Ala His Leu Ile Lys Tyr Asp
35 40 45
Thr Ile His Gly Arg Tyr Asp Lys Glu Val Val Ala Gly Glu Asp Ser
50 55 60
Leu Ile Val Asn Gly Lys Lys Val Leu Leu Leu Asn Ser Arg Asp Pro
65 70 75 80
Lys Gln Leu Pro Trp Arg Glu Tyr Asp Ile Asp Ile Val Val Glu Ala
85 90 95
Thr Gly Lys Phe Asn Ala Lys Asp Lys Ala Met Gly His Ile Glu Ala
100 105 110
Gly Ala Lys Lys Val Ile Leu Thr Ala Pro Gly Lys Asn Glu Asp Val
115 120 125
Thr Ile Val Met Gly Val Asn Glu Asp Gln Phe Asp Ala Glu Arg His
130 135 140
Val Ile Ile Ser Asn Ala Ser Cys Thr Thr Asn Cys Leu Ala Pro Val
145 150 155 160
Val Lys Val Leu Asp Glu Glu Phe Glu Ile Glu Ser Gly Leu Met Thr
165 170 175
Thr Val His Ala Tyr Thr Asn Asp Gln Lys Asn Ile Asp Asn Pro His
180 185 190
Lys Asp Leu Arg Arg Ala Arg Ala Cys Gly Glu Ser Ile Ile Pro Thr
195 200 205
Thr Thr Gly Ala Ala Lys Ala Leu Ser Leu Val Leu Pro His Leu Lys
210 215 220
Gly Lys Leu His Gly Leu Ala Leu Arg Val Pro Val Pro Asn Val Ser
225 230 235 240
Leu Val Asp Leu Val Val Asp Leu Lys Thr Asp Val Thr Ala Glu Glu
245 250 255
Val Asn Glu Ala Phe Lys Arg Ala Ala Lys Thr Ser Met Tyr Gly Val
260 265 270
Leu Asp Tyr Ser Asp Glu Pro Leu Val Ser Thr Asp Tyr Asn Thr Asn
275 280 285
Pro His Ser Ala Val Ile Asp Gly Leu Thr Thr Met Val Met Glu Asp
290 295 300
Arg Lys Val Lys Val Leu Ala Trp Tyr Asp Asn Glu Trp Gly Tyr Ser
305 310 315 320
Cys Arg Val Val Asp Leu Ile Arg His Val Ala Ala Arg Met Lys His
325 330 335
Pro Ser Ala Val
340
<210> 4
<211> 340
<212> PRT
<213> Bacillus amyloliquefaciens (Bacillus amyloliquefaciens)
<400> 4
Met Lys Val Lys Val Ala Ile Asn Gly Phe Gly Arg Ile Gly Arg Met
1 5 10 15
Val Phe Arg Lys Ala Met Glu Asp Asp Gln Ile Gln Ile Thr Ala Ile
20 25 30
Asn Ala Ser Tyr Pro Pro Glu Thr Leu Ala His Leu Ile Lys Tyr Asp
35 40 45
Thr Ile His Gly Arg Tyr Asp Gln Glu Val Glu Ala Ala Glu Asp Ser
50 55 60
Leu Ile Val Asn Gly Lys His Ile Met Leu Phe Asn Arg Arg Asp Pro
65 70 75 80
Arg Glu Leu Pro Trp Lys Glu Cys Gly Ile Asp Ile Val Val Glu Ala
85 90 95
Thr Gly Lys Phe Asn Ser Lys Glu Lys Ala Met Ser His Ile Glu Ala
100 105 110
Gly Ala Lys Lys Val Ile Leu Thr Ala Pro Gly Lys Asn Glu Asp Val
115 120 125
Thr Ile Val Met Gly Val Asn Glu Glu Gln Phe Asn Pro Asp Glu His
130 135 140
Val Ile Ile Ser Asn Ala Ser Cys Thr Thr Asn Cys Leu Ala Pro Val
145 150 155 160
Val Lys Val Leu Asp Gln Glu Phe Gly Ile Glu Ser Gly Leu Met Thr
165 170 175
Thr Val His Ala Tyr Thr Asn Asp Gln Lys Asn Ile Asp Asn Pro His
180 185 190
Lys Asp Leu Arg Arg Ala Arg Ala Cys Gly Glu Ser Ile Ile Pro Thr
195 200 205
Ser Thr Gly Ala Ala Lys Ala Leu Ser Leu Val Leu Pro His Leu Lys
210 215 220
Gly Lys Leu His Gly Leu Ala Leu Arg Val Pro Val Pro Asn Val Ser
225 230 235 240
Leu Val Asp Leu Val Cys Asp Leu Lys Thr Asp Val Ser Ala Glu Gln
245 250 255
Val Asn Ala Ala Phe Gln Arg Ala Ala Lys Thr Ser Met Tyr Gly Ile
260 265 270
Leu Asp Tyr Ser Asp Glu Pro Leu Val Ser Ser Asp Tyr Asn Thr Asn
275 280 285
Ser His Ser Ala Ile Ile Asp Gly Leu Thr Thr Met Val Met Glu Asp
290 295 300
Arg Lys Val Lys Val Leu Ala Trp Tyr Asp Asn Glu Trp Gly Tyr Ser
305 310 315 320
Cys Arg Val Val Asp Leu Ile Arg His Val Ala Ala Arg Met Lys His
325 330 335
Pro Ser Ala Val
340
<210> 5
<211> 340
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 5
Met Lys Val Lys Val Ala Ile Asn Gly Phe Gly Arg Ile Gly Arg Met
1 5 10 15
Val Phe Arg Lys Ala Met Glu Asp Asp Gln Ile Gln Ile Thr Ala Ile
20 25 30
Asn Ala Ser Tyr Pro Pro Glu Thr Leu Ala His Leu Ile Lys Tyr Asp
35 40 45
Thr Ile His Gly Arg Tyr Asp Gln Glu Val Glu Ala Ala Glu Asp Ser
50 55 60
Leu Ile Val Asn Gly Lys His Ile Met Leu Phe Asn Arg Arg Asp Pro
65 70 75 80
Arg Glu Leu Pro Trp Lys Glu Cys Gly Ile Asp Ile Val Val Glu Ala
85 90 95
Thr Gly Lys Phe Asn Ser Lys Glu Lys Ala Met Ser His Ile Glu Ala
100 105 110
Gly Ala Lys Lys Val Ile Leu Thr Ala Pro Gly Lys Asn Glu Asp Val
115 120 125
Thr Ile Val Met Gly Val Asn Glu Glu Gln Phe Asn Pro Asp Glu His
130 135 140
Val Ile Ile Ser Asn Ala Ser Cys Thr Thr Asn Cys Leu Ala Pro Val
145 150 155 160
Val Lys Val Leu Asp Gln Glu Phe Asp Ile Glu Ser Gly Leu Met Thr
165 170 175
Thr Val His Ala Tyr Thr Asn Asp Gln Lys Asn Ile Asp Asn Pro His
180 185 190
Lys Asp Leu Arg Arg Ala Arg Ala Cys Gly Glu Ser Ile Ile Pro Thr
195 200 205
Ser Thr Gly Ala Ala Lys Ala Leu Ser Leu Val Leu Pro His Leu Lys
210 215 220
Gly Lys Leu His Gly Leu Ala Leu Arg Val Pro Val Pro Asn Val Ser
225 230 235 240
Leu Val Asp Leu Val Cys Asp Leu Lys Thr Asp Val Ser Ala Glu Gln
245 250 255
Val Asn Ala Ala Phe Gln Arg Ala Ala Lys Thr Ser Met Tyr Gly Ile
260 265 270
Leu Asp Tyr Ser Asp Glu Pro Leu Val Ser Ser Asp Tyr Asn Thr Asn
275 280 285
Ser His Ser Ala Ile Ile Asp Gly Leu Thr Thr Met Val Met Glu Asp
290 295 300
Arg Lys Val Lys Val Leu Ala Trp Tyr Asp Asn Glu Trp Gly Tyr Ser
305 310 315 320
Cys Arg Val Val Asp Leu Ile Arg His Val Ala Ala Arg Met Lys His
325 330 335
Pro Ser Ala Val
340
<210> 6
<211> 340
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 6
Met Lys Val Lys Val Ala Ile Asn Gly Phe Gly Arg Ile Gly Arg Met
1 5 10 15
Val Phe Arg Lys Ala Met Glu Asp Asp Gln Ile Gln Ile Thr Ala Ile
20 25 30
Asn Ala Ser Tyr Pro Pro Glu Thr Leu Ala His Leu Ile Lys Tyr Asp
35 40 45
Thr Ile His Gly Arg Tyr Asp Gln Glu Val Glu Ala Ala Glu Asp Ser
50 55 60
Leu Ile Val Asn Gly Lys His Ile Met Leu Phe Asn Arg Arg Asp Pro
65 70 75 80
Arg Glu Leu Pro Trp Lys Glu Cys Gly Ile Asp Ile Val Val Glu Ala
85 90 95
Thr Gly Lys Phe Asn Ser Lys Glu Lys Ala Met Ser His Ile Glu Ala
100 105 110
Gly Ala Lys Lys Val Ile Leu Thr Ala Pro Gly Lys Asn Glu Asp Val
115 120 125
Thr Ile Val Met Gly Val Asn Glu Glu Gln Phe Asn Pro Asp Glu His
130 135 140
Val Ile Ile Ser Asn Ala Ser Cys Thr Thr Asn Cys Leu Ala Pro Val
145 150 155 160
Val Lys Val Leu Asp Gln Glu Phe Glu Ile Glu Ser Gly Leu Met Thr
165 170 175
Thr Val His Ala Tyr Thr Asn Asp Gln Lys Asn Ile Asp Asn Pro His
180 185 190
Lys Asp Leu Arg Arg Ala Arg Ala Cys Gly Glu Ser Ile Ile Pro Thr
195 200 205
Ser Thr Gly Ala Ala Lys Ala Leu Ser Leu Val Leu Pro His Leu Lys
210 215 220
Gly Lys Leu His Gly Leu Ala Leu Arg Val Pro Val Pro Asn Val Ser
225 230 235 240
Leu Val Asp Leu Val Cys Asp Leu Lys Thr Asp Val Ser Ala Glu Gln
245 250 255
Val Asn Ala Ala Phe Gln Arg Ala Ala Lys Thr Ser Met Tyr Gly Ile
260 265 270
Leu Asp Tyr Ser Asp Glu Pro Leu Val Ser Ser Asp Tyr Asn Thr Asn
275 280 285
Ser His Ser Ala Ile Ile Asp Gly Leu Thr Thr Met Val Met Glu Asp
290 295 300
Arg Lys Val Lys Val Leu Ala Trp Tyr Asp Asn Glu Trp Gly Tyr Ser
305 310 315 320
Cys Arg Val Val Asp Leu Ile Arg His Val Ala Ala Arg Met Lys His
325 330 335
Pro Ser Ala Val
340
<210> 7
<211> 3447
<212> DNA
<213> Bacillus subtilis (Bacillus subtilis)
<400> 7
ttgtctcagc aatcgataca aaaagtatta gtagcaaaca ggggagaaat tgcaatccga 60
atattccggg cgtgtaccga gttgaatatt cgtacagttg cggtctattc aaaagaagat 120
tccggttcct accatcggta caaagcggat gaagcatact tggtcggtga agggaaaaaa 180
ccgattgatg cttacctgga tattgaaggt atcattgata ttgcgaaaag aaacaaagtc 240
gatgcaattc atccgggata cggtttctta tctgaaaata ttcattttgc gagacgatgt 300
gaagaagaag gcatcgtatt catagggcca aaatccgagc atctcgatat gtttggtgac 360
aaggtaaaag cgcgtgagca ggcagaaaaa gcgggaatcc ccgtgattcc gggaagcgac 420
ggtcctgccg aaacgcttga agccgtcgaa caatttggac aagctaacgg ttatccgatc 480
atcattaaag cctcgcttgg cggcggcggc cgcggtatgc ggattgtcag atctgaaagt 540
gaagttaaag aagcatatga gcgtgctaaa tcagaggcga aagcagcctt tggcaatgat 600
gaagtttatg tagaaaaatt aattgagaat ccgaaacata ttgaggttca ggtcattgga 660
gacaagcagg gcaatgtcgt ccatcttttt gagagggatt gctccgttca aagacgccat 720
caaaaagtca ttgaagtggc gccgagtgtc tcgctgtcac ctgaattaag ggaccaaatt 780
tgtgaggctg cagttgcgct tgccaaaaat gtaaactata taaatgcggg gacggtcgaa 840
ttccttgttg caaacaacga gttctacttt attgaagtaa atcctcgcgt acaagttgaa 900
cacacgataa cagaaatgat tactggtgtc gatattgttc aaactcagat ccttgttgcc 960
caagggcaca gccttcacag caaaaaagta aatattcctg agcaaaagga catttttaca 1020
atcggctatg ccattcagtc acgggttacg actgaggatc cgcaaaatga tttcatgcct 1080
gatacaggaa aaatcatggc ttaccgctca ggcggcggtt ttggtgtccg tcttgatacc 1140
ggaaacagct tccagggcgc cgtgatcaca ccatactatg attcacttct cgttaagctt 1200
tcaacttggg ctttaacgtt tgaacaggca gctgccaaaa tggtgcgaaa ccttcaggag 1260
tttagaatca gaggcataaa aacgaacatt ccgttccttg agaacgttgc aaagcatgag 1320
aagttcctga cagggcaata tgatacatct ttcattgata caacgcctga attatttaat 1380
ttccctaaac aaaaagaccg cggaacgaaa atgctcactt acatcggcaa tgtgacagtg 1440
aacggcttcc ctggaatcgg gaaaaaagaa aaaccggcgt ttgacaaacc gttaggcgta 1500
aaggtagacg ttgatcagca gcctgccaga ggaacaaagc aaattctcga tgaaaaaggt 1560
gcagaagggc ttgcaaattg ggttaaggag cagaaatctg tccttttaac tgatacgaca 1620
ttcagggatg cccaccaatc gttattggca actagaatca gatcgcatga tttgaaaaaa 1680
atcgcaaatc cgacggctgc gttatggcct gaactattca gtatggaaat gtggggaggc 1740
gcgaccttcg atgtagccta ccgattcctg aaagaagatc cgtggaaacg tttggaagat 1800
cttcgcaaag aagtgccgaa taccttattc cagatgttgc ttcgctcatc aaatgcggtc 1860
ggctatacga attatccgga caatgtgatt aaagaatttg tgaagcaatc agctcaatcc 1920
ggtattgatg tgtttcgtat tttcgacagc ttaaactggg taaaagggat gacgttagcc 1980
attgatgctg ttagggatac cggcaaagtg gcagaagctg cgatttgtta tacgggagat 2040
atccttgaca agaaccggac gaagtacgac cttgcatatt atacatcgat ggcgaaggag 2100
cttgaggcgg ccggagccca tattctcggg attaaagata tggcagggct gttaaaaccg 2160
caggctgcat atgagctcgt ttctgcgttg aaagaaacga tcgacattcc ggttcacctt 2220
catacgcatg atacgagcgg aaacggtatt tatatgtatg cgaaagctgt tgaagccggc 2280
gttgatatca tagacgtggc ggtcagctca atggcgggat taacgtcaca gcctagcgcg 2340
agcggatttt atcatgcgat ggaaggcaac gaccgccgtc cggaaatgaa tgtccaaggc 2400
gttgaattgc tgtcccaata ttgggagtcg gtgcgtaaat attatagtga atttgaaagc 2460
ggaatgaagt ctccgcatac tgaaatttat gaacacgaaa tgccaggggg ccaatacagc 2520
aacctgcagc agcaagccaa gggagtaggc cttggcgacc gctggaacga agtcaaggaa 2580
atgtacagac gcgtgaacga tatgttcggt gacatcgtca aggtaacgcc ttcctcaaaa 2640
gtagtcggag atatggcact ctacatggtg caaaacaatc tgactgaaaa agacgtttac 2700
gaaaaaggtg aatctttaga tttccctgat tctgtcgtgg agctttttaa aggaaatatc 2760
ggccagcctc atggcggatt cccagaaaaa ctgcaaaagc tgatcttaaa agggcaggag 2820
ccgattacag tcagaccggg cgaactgctt gagccggtgt catttgaagc gatcaaacag 2880
gaatttaaag agcagcataa cttggaaatt tcagatcagg atgctgtggc atatgccctt 2940
tatcctaaag tcttcactga ttatgtgaaa acgacagaaa gctatggaga catctcggta 3000
ttagatacac cgacattctt ctacggtatg acattaggtg aagagataga agttgaaatt 3060
gagcgcggca aaacgctgat cgttaagctg atttcaatcg gtgagcctca gcctgatgcc 3120
acccgcgtcg tttatttcga actcaacggg cagccgcgtg aagtagtcat taaagatgaa 3180
agcattaagt cttccgttca ggaaaggctg aaagcagacc ggacaaatcc aagccacatc 3240
gcagcttcca tgcctggaac agttattaag gtattggctg aagcaggcac aaaagtcaat 3300
aaaggtgatc atttgatgat taatgaagcg atgaaaatgg aaacaacggt tcaggcgcct 3360
ttctcaggaa caatcaagca ggttcatgtg aaaaatggtg agccgatcca aacgggagat 3420
ctgctccttg aaattgaaaa agcataa 3447
<210> 8
<211> 3447
<212> DNA
<213> Bacillus amyloliquefaciens (Bacillus amyloliquefaciens)
<400> 8
ttgtcacaac aatccatcca aaaagtgtta gtagcaaaca ggggagaaat tgcgatccgg 60
attttccggg cgtgcacaga attgaacatc agaacggtag ccgtttattc aaaagaagat 120
tcaggttcct accaccgcta taaagcggat gaagcctatc ttgtcggaga aggcaaaaaa 180
ccgattgacg cgtatcttga tattgaaggg attattgaga tcgcgaaaag aaacggcgtt 240
gatgccattc atccgggcta tggatttctg tctgaaaata tccaatttgc gagacgctgt 300
gaagaagagg gcatcgtatt tatcggaccg acgtcagcgc atttggatat gttcggagat 360
aaggtcaagg ccagagagca ggcggaaaaa gccggcatcc ccgttattcc ggggagtgac 420
gggcctgccg aaacattaaa agatgtcgaa caattcgcaa aagtacacgg atttccgttt 480
attattaaag cgtcgctcgg aggcggcggc cgcggaatga gaatcgtcag gaacgaaaac 540
gaattgaaag attcgtttga gcgggccaaa tccgaagcga aagccgcatt cggaaacgac 600
gaagtgtatg ttgaaaaact gatcgaaaat cctaagcata ttgaagttca ggtgatcgga 660
gataaagaag gaaatgtcgt ccatctgtat gagcgggact gttccgttca aagacggcat 720
caaaaggtca ttgaggtggc gccgagcgtg tccttacagc ctgaattaag agacgagatc 780
tgtgaagcgg ctgtcgcact tgcgaaaaat gtcggctata tcaacgctgg aacagtggaa 840
tttctcgtag cggacggtga attttacttt attgaagtga atccgcgcgt acaagtggag 900
catacgatta cggaaatgat tacgggggtt gatatcgttc agacgcaaat cctcgtcgcg 960
cagggccacg gtctgcacag ccgtgccgtc aacatccctc atcagaaaga catttttaca 1020
aacgggtatg cgatacagtc acgcgtgacc actgaagatc cgctgaatga ctttatgcct 1080
gacacgggta aaattatggc ttaccgctca ggcggcggct tcggcgtgcg tcttgatact 1140
gggaacagct tccaaggcgc cgtcatcacg ccttattatg attcactgct cgtcaagctg 1200
tcgacatggg cgctgacgtt tgaacaggca tccgcaaaaa tggtccgcaa cctgcaggaa 1260
ttcagaatca ggggcattaa gaccaatatc ccgtttcttg aaaacgtggc aaagcatgaa 1320
aaattcctga cgggacaata cgatacatcg tttatcgaca caacgcctga gctgtttgtt 1380
tttcctaaac agaaggaccg cggaacaaaa atgctttcct atatcggcaa tgtaacggtg 1440
aacggttttc cgggaatcgg aaaaaaagaa aaacctgcgt ttgataagcc ccagactgtt 1500
acgttaggta tcggcgaaaa gccggcaagc ggcacgaagc agattcttga tgaaagaggc 1560
gctgaagggc ttgctgactg ggtgaaagag cagaaatccg tacttctgac cgatacaacg 1620
ttcagggatg cccatcagtc cctgcttgca acccggatca gatccaatga cttgaaaaaa 1680
atcgcaaacc ctacggctgc tctgtggcct gaactgttca gccttgaaat gtggggtggg 1740
gcgacatttg atgtagcgta ccgtttctta aaggaagatc cttggaaacg ccttgaagat 1800
ctccgcaagg aagtgccgaa cacattgttc cagatgctgc ttcgttcatc aaatgccgtc 1860
ggctatacaa actatccgga caatgtcatt caaaaatttg tccggcagtc agcagcatca 1920
ggtattgacg tattccggat ctttgacagc ctgaactggg tgaaagggat gacgctggcc 1980
atcgatgccg tccgtgaaac cggaaaagtg gcggaggctg cgatttgtta tacgggagat 2040
attcttgata agagccggac gaagtatgat ctgaaatact atctttctat ggcaaaagag 2100
cttgaggcat cgggagcgca tattctcggc attaaagaca tggccggtct tttgaaacct 2160
caagccgcat acgaacttgt ctcagcgctg aaggaaacga ttgatattcc cgttcatctt 2220
cacacgcatg atacgagcgg caacggcgtc tttctctatg ccaaagccgt tgaagcgggt 2280
gtggatatcg tagatgtcgc cgtcagctca atggcgggtc tgacttcaca gccgagtgca 2340
agcggatttt atcatgcgct tgaaggaaac agccgccgtc ctgaaatgga tgtccggcag 2400
gttgaaagac tgtcacaata ttgggaatcc gtccgtcaat attacagtga atttgaaagc 2460
gggatgaagt ctccgcatac tgagatttat aatcacgaaa tgccgggcgg acagtacagc 2520
aatctgcagc agcaggcaaa aggagtcggc ctcggcgacc gctggaatga agtgaaagac 2580
atgtacagcg tcgtcaaccg catgttcggc gacgtcgtta aagtaacgcc ttcttccaaa 2640
gtcgtcggag atatggcgct ttacatggtg caaaacaatt taacggaaca agatgtttat 2700
gataaaggcg aaactcttga ttttccggat tctgttgttg agctctttaa aggacagatc 2760
ggccagccgc acggcggatt tccggaaaaa ctgcaaaagc tcgttctaaa aggacagacg 2820
ccgattaagg taagaccggg tgaactgctt gaaccggtat cttttgaagg catcaaagaa 2880
gaatggaaag aaactcatca gatggaattg agtgatcagg acgcaatcgc gtatgctctt 2940
tatccgaagg tattcactga atacgttaaa acggctgaac gcttcggtga tatttccgta 3000
ttggacacac cgactttctt ctacggcatg aggctcggtg aagaaatcga agtggaaatc 3060
gagcgaggaa aaacgctgat cgtaaagctt gtgtctatcg gtgaaccgca gcctgatgcg 3120
acacgtgtcg tttattttga gttgaacggc cagcctcgtg aggtggtcat taaagatgaa 3180
agcattaaat catccgtaca ggaaaaatta aaggccgatc ggacaaaccc aagccacatc 3240
gcagcatcaa tgccgggaac cgttattaaa ttgttaacgc aaaccggtgc gaaggtgaac 3300
aaaggggatc atctgatgat taatgaagcg atgaaaatgg agacgacggt gcaggcgccg 3360
ttctccggga cgattcagca gattcatgtg aaaaacggtg aaccgattca gacaggcgat 3420
ttactgattg agattgaaaa agcgtag 3447
<210> 9
<211> 1467
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 9
atgtgggaaa gtaaattttc aaaagaaggc ttaacgttcg atgatgtact gctcgtacca 60
gctcaatcag acgtacttcc gcgtgatgtg gatttgtctg ttgaactgac aaaaacgtta 120
aagcttaata ttcctgtcat cagtgcagga atggatacag taacagaatc agcaatggcg 180
attgcgatgg cccgacaagg cggcttgggc attattcata aaaacatgtc catcgaacag 240
caggctgaac atgttgacaa agtcaaacgt tctgaacggg gcgttattac aaatcccttc 300
tttttaacac ctgatcatca agtattcgat gcggagcatt tgatggggaa atacagaatt 360
tccggtgttc cgatcgtaga taataaagac gatcaaaagc tggtcggtat cattacaaac 420
cgcgatcttc gctttatctc tgattattca atgaaaatca gtgatgttat gacaaaagaa 480
gagctggtta cggctcctgt gggaaccaca ttagacgaag cggaaaaaat cttgcagaag 540
cataaaattg aaaaacttcc attagtggat gaccaaaaca aattaaaagg tcttatcacg 600
atcaaagata ttgaaaaggt tatcgaattc ccgaattcat ctaaagatga acacggacgc 660
ctgatcgtcg gcgctgcggt aggcgtgaca ggtgatacaa tgactcgtgt cagcaagctt 720
gttgaagcga atgtcgacgt tatcgtggtt gatacggctc acggacattc cagaggcgta 780
ctgaacacag ttgcgaaaat ccgtgagaca tatcctgaat tgaacattat cgcaggaaat 840
gttgctacgg ctgaagcgac aaaggctttg attgaagccg gagcaaacat tgtaaaagtg 900
ggaatcggac ctggatctat ctgtacgaca cgcgtcgttg caggcgtagg tgtaccgcaa 960
atcactgcga tttatgattg tgccactgaa gcgagaaaac acggcgcaac aattatcgcg 1020
gacggcggta ttaaattctc cggagatatt acgaaagcat tggcatccgg cggacatgct 1080
gtcatgcttg gaagcctgct tgccggtact tcagaaagcc cgggcgaaac tgaaatctat 1140
caaggcagaa gatttaaagt gtatcgcggt atgggttctg tcgctgccat ggaaaaaggc 1200
agtaaagacc gatatttcca agaagaaaat aagaaattcg tccctgaagg tatcgaagga 1260
cggactccgt acaaaggtcc tgtagaagaa acagtgtatc agcttgtcgg cggtcttcgt 1320
tcaggtatgg gatattgcgg ttcaaaagac ttgcgcgctt ttagagaaga agctcaattt 1380
atccgtatga caggagcagg tcttcgcgaa agccatccgc atgatgtcca aatcacgaag 1440
gaatcaccaa actacacaat ctcataa 1467
<210> 10
<211> 931
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 10
acagaatgct cttgattaaa tccgtatgtt aagttatatt ttttttaatt tttcggattt 60
tgggggtaag ttcatgaagt ttcgtcgcag cggcagattg gtggacttaa caaattattt 120
gttaacccat ccgcatgaat taataccgtt aacgtttttc tcagaacggt atcaatcagc 180
aaagtcatca atcagtgaag atttaacaat tattaaacag accttcgaac agcaaggcat 240
tgggacgctg cttacagtgc cgggagctgc cggaggcgtc aaatatattc cgaaagtaaa 300
acaggctgaa gcagaagcgt ttatacagga gctgggacag tctttagtaa atcctgagcg 360
tatccttccg ggcggttatg tatatttaac ggatatctta ggcaaacctt ctgtcctctc 420
taatgcaggc aggctttttg cttccgtttt tgcggagcgg gagattgatg tggtgatgac 480
cgttgcgaca aaaggaatcc ctcttgctta cgcagcggcc agttatctga acgttccggt 540
tgtcatcgta cgaaaagaca ataaagtgac ggaaggctct acagtgagca tcaattatgt 600
atcagggtcg tctaaccgca ttcaaacaat gtcgcttgcg aaaagaagtt tggccacggg 660
gtcgaacgtt ttgattattg acgactttat gaaagccggc ggcacaatta acggcatgat 720
cagcctgctt gatgagttta atgcgaacgt cgcgggtata ggcgtcttgg ttgaagctga 780
gggagtgaat gaacggcttg tcgatgaata catgtcgctg cttacccttt caaccatcaa 840
catgaaagac aaaacgattg agattcaaaa cggcaatttt ctgcgatttt ttaaagaaca 900
gcatttaaag aatggggaga cagaaaaatg a 931
<210> 11
<211> 839
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 11
atgttatttt tcattgatac agcaaacatt gacgagatta aagaagctta tgaacttggc 60
gttcttgccg gagttacgac aaaccctagt ttagtggcaa aagaagctga cgtgtctttc 120
catgacagac tgcgtgagat tacggaagtc gtgaaaggat ctgtaagcgc ggaagtcatt 180
tccctgaacg ctgaagaaat gattgaagaa ggtaaagaac ttgcgaaaat cgcgccgaat 240
atcacggtaa aaattccgat gacgtctgaa ggattaaaag ccgtaaaagc gctgagcgac 300
ctgaacatta aaacaaacgt gacgctcatc ttcagcgcca accaggcgct tttggccgcc 360
agagccggag cgacttatgt ttctccgttc ttaggccgtc tggatgatat cggtcataac 420
ggtcttgaac tgatttcaga aataagacag atttttgacc ttcatgacat tgatacacaa 480
atcatcgcag cttccatccg tcatgcgcag cacgtgactg aagccgcttt acgcggtgcc 540
catatcggta cgatgccgct gaaagttatt caccagctga caaagcaccc gttaacggat 600
aaaggcatcg agcaattctt ggcagactgg aataaataag ggcgaaaagg gcggcaaacc 660
ggttgcatcc gtttgccgca cccttatgtt ttcctgtttg acggcgggcc ttcaatatca 720
aagttccccg gaatgtaaac ccggcgggtc tctatgcatc ctatgttaaa aatgccccgc 780
aaagcttcgc tattttcttc ctgttatttt ataatgtcct tgtattcttt ctcttcgaa 839
<210> 12
<211> 585
<212> PRT
<213> Bacillus subtilis (Bacillus subtilis)
<400> 12
Met Arg Lys Thr Lys Ile Val Cys Thr Ile Gly Pro Ala Ser Glu Ser
1 5 10 15
Ile Glu Met Leu Thr Lys Leu Met Glu Ser Gly Met Asn Val Ala Arg
20 25 30
Leu Asn Phe Ser His Gly Asp Phe Glu Glu His Gly Ala Arg Ile Lys
35 40 45
Asn Ile Arg Glu Ala Ser Lys Lys Leu Gly Lys Asn Val Gly Ile Leu
50 55 60
Leu Asp Thr Lys Gly Pro Glu Ile Arg Thr His Thr Met Glu Asn Gly
65 70 75 80
Gly Ile Glu Leu Glu Thr Gly Lys Glu Leu Ile Ile Ser Met Asp Glu
85 90 95
Val Val Gly Thr Thr Asp Lys Ile Ser Val Thr Tyr Glu Gly Leu Val
100 105 110
His Asp Val Glu Gln Gly Ser Thr Ile Leu Leu Asp Asp Gly Leu Ile
115 120 125
Gly Leu Glu Val Leu Asp Val Asp Ala Ala Lys Arg Glu Ile Lys Thr
130 135 140
Lys Val Leu Asn Asn Gly Thr Leu Lys Asn Lys Lys Gly Val Asn Val
145 150 155 160
Pro Gly Val Ser Val Asn Leu Pro Gly Ile Thr Glu Lys Asp Ala Arg
165 170 175
Asp Ile Val Phe Gly Ile Glu Gln Gly Val Asp Phe Ile Ala Pro Ser
180 185 190
Phe Ile Arg Arg Ser Thr Asp Val Leu Glu Ile Arg Glu Leu Leu Glu
195 200 205
Glu His Asn Ala Gln Asp Ile Gln Ile Ile Pro Lys Ile Glu Asn Gln
210 215 220
Glu Gly Val Asp Asn Ile Asp Ala Ile Leu Glu Val Ser Asp Gly Leu
225 230 235 240
Met Val Ala Arg Gly Asp Leu Gly Val Glu Ile Pro Ala Glu Glu Val
245 250 255
Pro Leu Val Gln Lys Glu Leu Ile Lys Lys Cys Asn Ala Leu Gly Lys
260 265 270
Pro Val Ile Thr Ala Thr Gln Met Leu Asp Ser Met Gln Arg Asn Pro
275 280 285
Arg Pro Thr Arg Ala Glu Ala Ser Asp Val Ala Asn Ala Ile Phe Asp
290 295 300
Gly Thr Asp Ala Ile Met Leu Ser Gly Glu Thr Ala Ala Gly Ser Tyr
305 310 315 320
Pro Val Glu Ala Val Gln Thr Met His Asn Ile Ala Ser Arg Ser Glu
325 330 335
Glu Ala Leu Asn Tyr Lys Glu Ile Leu Ser Lys Arg Arg Asp Gln Val
340 345 350
Gly Met Thr Ile Thr Asp Ala Ile Gly Gln Ser Val Ala His Thr Ala
355 360 365
Ile Asn Leu Asn Ala Ala Ala Ile Val Thr Pro Thr Glu Ser Gly His
370 375 380
Thr Ala Arg Met Ile Ala Lys Tyr Arg Pro Gln Ala Pro Ile Val Ala
385 390 395 400
Val Thr Val Asn Asp Ser Ile Ser Arg Lys Leu Ala Leu Val Ser Gly
405 410 415
Val Phe Ala Glu Ser Gly Gln Asn Ala Ser Ser Thr Asp Glu Met Leu
420 425 430
Glu Asp Ala Val Gln Lys Ser Leu Asn Ser Gly Ile Val Lys His Gly
435 440 445
Asp Leu Ile Val Ile Thr Ala Gly Thr Val Gly Glu Ser Gly Thr Thr
450 455 460
Asn Leu Met Lys Val His Thr Val Gly Asp Ile Ile Ala Lys Gly Gln
465 470 475 480
Gly Ile Gly Arg Lys Ser Ala Tyr Gly Pro Val Val Val Ala Gln Asn
485 490 495
Ala Lys Glu Ala Glu Gln Lys Met Thr Asp Gly Ala Val Leu Val Thr
500 505 510
Lys Ser Thr Asp Arg Asp Met Ile Ala Ser Leu Glu Lys Ala Ser Ala
515 520 525
Leu Ile Thr Glu Glu Gly Gly Leu Thr Ser His Ala Ala Val Val Gly
530 535 540
Leu Ser Leu Gly Ile Pro Val Ile Val Gly Leu Glu Asn Ala Thr Ser
545 550 555 560
Ile Leu Thr Asp Gly Gln Asp Ile Thr Val Asp Ala Ser Arg Gly Ala
565 570 575
Val Tyr Gln Gly Arg Ala Ser Val Leu
580 585
<210> 13
<211> 527
<212> PRT
<213> Bacillus (Bacillus)
<400> 13
Met Asn Ser Val Asp Leu Thr Ala Asp Leu Gln Ala Leu Leu Thr Cys
1 5 10 15
Pro Asn Val Arg His Asn Leu Ser Ala Ala Gln Leu Thr Glu Lys Val
20 25 30
Leu Ser Arg Asn Glu Gly Ile Leu Thr Ser Thr Gly Ala Val Arg Ala
35 40 45
Thr Thr Gly Ala Tyr Thr Gly Arg Ser Pro Lys Asp Lys Phe Ile Val
50 55 60
Glu Glu Glu Ser Thr Lys Asn Lys Ile Asp Trp Gly Pro Val Asn Gln
65 70 75 80
Pro Ile Ser Glu Glu Ala Phe Glu Arg Leu Tyr Thr Lys Val Val Ser
85 90 95
Tyr Leu Lys Glu Arg Asp Glu Leu Phe Val Phe Glu Gly Phe Ala Gly
100 105 110
Ala Asp Glu Lys Tyr Arg Leu Pro Ile Thr Val Val Asn Glu Phe Ala
115 120 125
Trp His Asn Leu Phe Ala Arg Gln Leu Phe Ile Arg Pro Glu Gly Asn
130 135 140
Asp Lys Lys Thr Val Glu Gln Pro Phe Thr Ile Leu Ser Ala Pro His
145 150 155 160
Phe Lys Ala Asp Pro Lys Thr Asp Gly Thr His Ser Glu Thr Phe Ile
165 170 175
Ile Val Ser Phe Glu Lys Arg Thr Ile Leu Ile Gly Gly Thr Glu Tyr
180 185 190
Ala Gly Glu Met Lys Lys Ser Ile Phe Ser Ile Met Asn Phe Leu Leu
195 200 205
Pro Glu Arg Asp Ile Leu Ser Met His Cys Ser Ala Asn Val Gly Glu
210 215 220
Lys Gly Asp Val Ala Leu Phe Phe Gly Leu Ser Gly Thr Gly Lys Thr
225 230 235 240
Thr Leu Ser Ala Asp Ala Asp Arg Lys Leu Ile Gly Asp Asp Glu His
245 250 255
Gly Trp Ser Asp Thr Gly Val Phe Asn Ile Glu Gly Gly Cys Tyr Ala
260 265 270
Lys Cys Ile His Leu Ser Glu Glu Lys Glu Pro Gln Ile Phe Asn Ala
275 280 285
Ile Arg Phe Gly Ser Val Leu Glu Asn Val Val Val Asp Glu Asp Thr
290 295 300
Arg Glu Ala Asn Tyr Asp Asp Ser Phe Tyr Thr Glu Asn Thr Arg Ala
305 310 315 320
Ala Tyr Pro Ile His Met Ile Asn Asn Ile Val Thr Pro Ser Met Ala
325 330 335
Gly His Pro Ser Ala Ile Val Phe Leu Thr Ala Asp Ala Phe Gly Val
340 345 350
Leu Pro Pro Ile Ser Lys Leu Thr Lys Glu Gln Ala Met Tyr His Phe
355 360 365
Leu Ser Gly Tyr Thr Ser Lys Leu Ala Gly Thr Glu Arg Gly Val Thr
370 375 380
Ser Pro Glu Thr Thr Phe Ser Thr Cys Phe Gly Ser Pro Phe Leu Pro
385 390 395 400
Leu Pro Ala His Val Tyr Ala Glu Met Leu Gly Lys Lys Ile Asp Glu
405 410 415
His Gly Ala Asp Val Phe Leu Val Asn Thr Gly Trp Thr Gly Gly Gly
420 425 430
Tyr Gly Thr Gly Glu Arg Met Lys Leu Ser Tyr Thr Arg Ala Met Val
435 440 445
Lys Ala Ala Ile Glu Gly Lys Leu Glu Asp Ala Glu Met Ile Thr Asp
450 455 460
Asp Ile Phe Gly Leu His Ile Pro Ala His Val Pro Gly Val Pro Asp
465 470 475 480
His Ile Leu Gln Pro Glu Asn Thr Trp Thr Asn Lys Glu Glu Tyr Lys
485 490 495
Glu Lys Ala Val Tyr Leu Ala Asn Glu Phe Lys Glu Asn Phe Lys Lys
500 505 510
Phe Ala His Thr Asp Ala Ile Ala Gln Ala Gly Gly Pro Leu Val
515 520 525

Claims (10)

1. A glyceraldehyde-3-phosphate dehydrogenase mutant, characterized in that the mutant comprises a mutation of amino acid 169 of glyceraldehyde-3-phosphate dehydrogenase from G to D or E;
wherein, the reference sequence number of glyceraldehyde-3-phosphate dehydrogenase on NCBI is NP 390780.1 or CBI43831.1.
2. A nucleic acid molecule encoding the mutant of claim 1 or a biological material comprising said nucleic acid molecule;
the biological material is recombinant DNA, expression cassette, transposon, plasmid vector, viral vector or engineering bacteria.
3. The nucleic acid molecule of claim 2 or any of the following uses of the biological material:
(1) Used for fermentation production of nucleoside;
(2) For improving fermentation yield of nucleosides;
(3) Is used for constructing the genetic engineering bacteria for producing nucleosides.
4. A method for constructing a nucleoside-producing strain, characterized in that a mutation is introduced into the genome of a microorganism having nucleoside-producing ability by genetic engineering means so that the glyceraldehyde-3-phosphate dehydrogenase encoded thereby contains a G169D or G169E mutation site; wherein, the reference sequence number of glyceraldehyde-3-phosphate dehydrogenase on NCBI is NP 390780.1 or CBI43831.1.
5. The method according to claim 4, wherein the microorganism is a Bacillus (Bacillus) species, preferably Bacillus subtilis (Bacillus subtilis), bacillus amyloliquefaciens (Bacillus amyloliquefaciens), bacillus pumilus (Bacillus pumilus).
6. The construction method of the nucleoside-producing engineering bacteria is characterized in that the nucleoside-producing strain constructed by the method of claim 4 or 5 is taken as a starting strain, and at least one of the following methods (1) to (3) is adopted to carry out genetic engineering modification on the starting strain:
(1) introducing mutation into the original strain by utilizing a genetic engineering means, so that the coded pyruvate kinase contains a T101K, T101R or T101P mutation site; wherein, the reference sequence number of the pyruvate kinase on NCBI is NP_390796.1;
(2) introducing a mutation into the starting strain by genetic engineering means such that its pycA gene encoding pyruvate carboxylase comprises a mutation of the first base from T to G or A;
(3) introducing mutation into the original strain by utilizing a genetic engineering means, so that the coded phosphoenolpyruvate carboxykinase contains K147R or K147H mutation sites; wherein, the reference sequence number of the phosphoenolpyruvate carboxykinase on NCBI is NP_390934.2;
preferably, the starting strain is genetically engineered using the combination of (1) to (3).
7. The method of claim 6, wherein the pycA gene is from bacillus subtilis:
i) A nucleotide sequence shown as SEQ ID NO. 7;
ii) the nucleotide sequence shown in SEQ ID NO. 7 is substituted, deleted and/or added with one or more nucleotides and expresses the same functional protein;
iii) A nucleotide sequence which hybridizes to the sequence shown in SEQ ID No. 7 and expresses the same functional protein under stringent conditions, i.e., in a 0.1 XSSPE solution containing 0.1% SDS or in a 0.1 XSSC solution containing 0.1% SDS, at 65℃and washing the membrane with the solution;
iv) a nucleotide sequence which has more than 90% homology with the nucleotide sequence of i), ii) or iii) and expresses the same functional protein; or alternatively, the process may be performed,
the pycA gene is from bacillus amyloliquefaciens, which is:
a) A nucleotide sequence shown as SEQ ID NO. 8;
b) The nucleotide sequence shown in SEQ ID NO. 8 is a nucleotide sequence which is substituted, deleted and/or added with one or more nucleotides and expresses the same functional protein;
c) A nucleotide sequence which hybridizes to the sequence shown in SEQ ID No. 8 and expresses the same functional protein under stringent conditions, i.e., in a 0.1 XSSPE solution containing 0.1% SDS or in a 0.1 XSSC solution containing 0.1% SDS, at 65℃and washing the membrane with the solution;
d) Nucleotide sequences which have more than 90% homology with the nucleotide sequences of a), b) or c) and express the same functional protein.
8. A nucleoside producing strain or engineering bacterium constructed according to the method of any one of claims 5 to 7.
9. A method of producing nucleosides, said method comprising the steps of:
1) Culturing the strain or engineering bacterium of claim 8 to obtain a culture of the microorganism;
2) Collecting the produced nucleosides from the culture obtained in step 1).
10. The method of claim 9, wherein the nucleoside comprises adenosine, inosine, guanosine, and their corresponding nucleoside derivatives.
CN202210398758.XA 2022-04-15 2022-04-15 Glyceraldehyde-3-phosphate dehydrogenase mutant and application thereof Pending CN116948994A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210398758.XA CN116948994A (en) 2022-04-15 2022-04-15 Glyceraldehyde-3-phosphate dehydrogenase mutant and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210398758.XA CN116948994A (en) 2022-04-15 2022-04-15 Glyceraldehyde-3-phosphate dehydrogenase mutant and application thereof

Publications (1)

Publication Number Publication Date
CN116948994A true CN116948994A (en) 2023-10-27

Family

ID=88453480

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210398758.XA Pending CN116948994A (en) 2022-04-15 2022-04-15 Glyceraldehyde-3-phosphate dehydrogenase mutant and application thereof

Country Status (1)

Country Link
CN (1) CN116948994A (en)

Similar Documents

Publication Publication Date Title
CN106754602A (en) A kind of method of the recombinant microorganism for producing cytidine and production cytidine
CN112574934B (en) Engineering bacterium for high yield of guanosine as well as construction method and application thereof
CN112143751B (en) Bacillus subtilis engineering bacterium for high nucleoside yield, and construction method and application thereof
CN110257315B (en) Bacillus subtilis and construction method and application thereof
US8187840B2 (en) Microorganism producing inosine and method of producing inosine using the same
JP5488594B2 (en) Method for producing purine ribonucleoside and ribonucleotide
CN112126666B (en) Nucleoside high-yield bacterium and construction method and application thereof
CN113278596B (en) Mutant capable of improving bacillus nucleoside yield and application thereof
CN116948994A (en) Glyceraldehyde-3-phosphate dehydrogenase mutant and application thereof
CN116949007A (en) Fructose 1, 6-bisphosphatase II mutant and application thereof
CN116790522A (en) Pyruvate carboxylase mutant and application thereof
CN116790568A (en) Phosphoenolpyruvate carboxykinase mutant and application thereof
WO2006078132A1 (en) Escherichia strain capable of converting xmp to gmp and maintaining the inactivated state of gene(s) associated with gmp degradation and methods of using the same
JPH05276974A (en) Production of cytidine diphosphate choline
CN116790546A (en) Pyruvic acid kinase mutant and application thereof
CN116262913A (en) L-threonine 3-dehydrogenase and uracil-permease mutant and application thereof
CN116804178A (en) Construction method of nucleoside producing engineering bacteria and method for producing nucleosides
CN116790454A (en) Construction method of nucleoside producing strain and method for producing nucleoside
CN115678864A (en) Gene engineering bacterium for producing nucleoside and construction method and application thereof
CN118222602A (en) Method for improving production efficiency of microbial nucleosides
CN118345055A (en) Pyruvate carboxylase mutant and application thereof
CN117587055A (en) Method for improving microbial nucleoside yield
CN117305285A (en) Phosphoenolpyruvate carboxykinase mutant and application thereof
CN116926036A (en) Pyruvic acid kinase mutant, recombinant microorganism, construction method and application thereof
CN117417906A (en) Recombinant microorganism and its use in the production of nucleosides

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination