CN110257315B - Bacillus subtilis and construction method and application thereof - Google Patents

Abstract

The invention belongs to the field of microorganisms, and discloses bacillus subtilis and a construction method and application thereof. The bacillus subtilis is purD in bacillus subtilis strain^P116L、purR^A65DOr guaB^G279RAt least one site of the above-mentioned gene has undergone point mutation. purD^P116L、purR^A65DOr guaB^G279RBacillus subtilis A1, A2 and A3 strains are obtained by single site mutation respectively. And sequentially transforming the B.subtilis168 (delta upp) strain by using the three single point mutation plasmids to obtain the Bacillus subtilis A5 strain with point mutation at three sites. The bacillus subtilis is an adenosine high-yield strain, can effectively accumulate adenosine, improves the yield of the adenosine, and lays a foundation for the industrial production of the adenosine.

Description

Bacillus subtilis and construction method and application thereof

Technical Field

The invention belongs to the field of microorganisms, particularly relates to bacillus subtilis and a construction method and application thereof, and particularly relates to adenosine-producing bacillus subtilis and a construction method and application thereof.

Background

Adenosine, known as 6-amino-9-beta-D-ribofuranosyl-9-hydrogen purine, is a dephosphorylated product of adenine nucleotides and is an important nucleotide derivative. Adenosine is an endogenous nucleoside distributed throughout human cells, can directly enter cardiac muscle to generate adenosine through phosphorylation, participates in cardiac muscle energy metabolism, and also participates in dilating coronary vessels to increase blood flow. Adenosine has physiological effects on the cardiovascular system and many other systems and tissues of the body. Adenosine can be used as a specific medicine for treating heart, is also an important intermediate for synthesizing Adenosine Triphosphate (ATP), adenine, adenylic acid and vidarabine, and is widely applied to industries such as medicine and the like.

There are three main methods for adenosine production, chemical synthesis, RNA hydrolysis and fermentation. The chemical synthesis method is to chemically synthesize adenosine by using different chemical substances as substrates, for example, 6-chloropurine is prepared by reacting hypoxanthine as a starting raw material with phosphorus oxychloride. The 6-chloropurine and the tetraacetyl ribose are subjected to condensation reaction under the action of a special catalyst, and the condensation compound is subjected to ammonolysis under the action of saturated ammonia methanol at the temperature of 0 ℃ to prepare the adenosine. However, the chemical method for synthesizing adenosine has the defects of large solvent loss, high cost, low yield and the like, and is relatively serious in environmental pollution and not suitable for large-scale industrialization. The RNA hydrolysis method comprises culturing yeast with saccharide material, separating RNA from the yeast, hydrolyzing RNA to obtain inosinic acid (IMP), and synthesizing adenosine with IMP. However, the degradation of RNA generates a mixture of 4 nucleotides, which causes great difficulty and increased cost in the subsequent separation and extraction process. The microbial fermentation method is a main method for producing adenosine because of the advantages of environmental protection, low raw material cost, mild reaction conditions, easy control, wide raw material sources and the like. The breeding of excellent production strains is the key of adenosine fermentation. However, the fermentation performance of the current adenosine strains is still poor, the conversion rate of adenosine is still low, and the requirement of large-scale industrial production cannot be met.

Disclosure of Invention

In view of the above, the present invention aims to provide a bacillus subtilis with high adenosine conversion rate, and a construction method and an application thereof, aiming at the defects existing in the prior art.

In order to realize the purpose of the invention, the invention adopts the following technical scheme:

a Bacillus subtilis has point mutation at least one of the following sites in a Bacillus subtilis strain:

1)purD^P116L: the 116 th proline of the glycinamide nucleotide synthetase gene purD is mutated into leucine;

2)purR^A65D: alanine 65 of transcription regulator gene purR is mutated into aspartic acid;

3)guaB^G279R: glycine 279 of the inosinic acid dehydrogenase gene guaB was mutated to arginine.

In some embodiments, the Bacillus subtilis is a strain in which point mutations occur at all three of the positions.

Preferably, the bacillus subtilis is a b.

The invention also provides a construction method of the bacillus subtilis, which comprises the following steps:

a, constructing a bacillus subtilis (delta upp) strain by adopting a gene traceless editing method;

step B, preparing purD respectively^P116L、purR^A65D、guaB^G279RThree point mutation gene segments are connected with a vector to respectively obtain three single-site mutation plasmids;

and step C, respectively transforming the three single-point mutation plasmids into a bacillus subtilis (delta upp) strain to obtain the bacillus subtilis with single-point mutation.

In some embodiments, the bacillus subtilis is b.

In some embodiments, the method for constructing the b.subtiliss 168(Δ upp) strain in step a of the construction method is to amplify by pfu DNA polymerase using primers upp-1f/1r and upp-2f/2r and b.subtiliss 168 genome as a template to obtain upstream and downstream homology arms of 888bp and 938bp, respectively; amplifying by using a primer upp-1f/2r to obtain an upstream fusion fragment and a downstream fusion fragment, connecting the fragments with a vector plasmid, and transforming the fragments into a B.subtiliss 168 strain through Spizisen to obtain the B.subtiliss 168 (delta upp) strain;

wherein the sequence of upp-1f is shown as SEQ ID No. 1; the sequence of upp-1r is shown as SEQ ID No. 2; the sequence of upp-2f is shown as SEQ ID No. 3; the sequence of upp-2r is shown as SEQ ID No. 4.

In some embodiments, the screening in the construction method specifically comprises screening transformants with an LB plate containing 2.5. mu.g/mL of chloramphenicol at 30 ℃, inoculating the obtained transformants into LB liquid, culturing at 42 ℃ and 200rpm for 12h and transferring one generation, and diluting and coating the LB plate containing 5. mu.g/mL of chloramphenicol to obtain a primary recombinant; the primary recombinants were inoculated into LB liquid, cultured at 42 ℃ for 12 hours at 200rpm and passed one generation, and diluted and spread on LB plates containing 0.8. mu.M 5-FU to screen the secondary recombinants, i.e., B.subtiliss 168 (. DELTA.upp) strain.

In some embodiments, the vector of step B in the construction method is pKSU.

In some embodiments, the three single-site mutant plasmids are pKSU-purD, pKSU-purR, and pKSU-guaB, respectively, and the single-site mutant bacillus subtilis is b.subtilis a1, b.subtilis a2, b.subtilis A3 strain, respectively.

In other embodiments, step C of the method for constructing bacillus subtilis is to sequentially transform the b.subtilis168(Δ upp) strain with three single point mutation plasmids to obtain bacillus subtilis a5 with point mutations at all three sites.

It will be understood by those skilled in the art that the Bacillus subtilis strain of the present invention is not limited to the B.subtilis168 strain. Other Bacillus subtilis may also be used.

The invention also provides application of the bacillus subtilis in fermentation production of adenosine.

The invention also provides a production method of adenosine, which comprises the steps of inoculating the bacillus subtilis to a seed culture medium for propagation, and transferring the propagated culture into a fermentation culture medium for fermentation.

Wherein the formula (g/L) of the seed culture medium is as follows: 20 parts of glucose, 5 parts of yeast powder, 5 parts of corn steep liquor dry powder, 3 parts of monopotassium phosphate, 0.5 part of magnesium sulfate, 0.02 part of ferrous sulfate, 0.01 part of manganese sulfate and 7.0-7.2 parts of pH;

the formula (g/L) of the fermentation medium is as follows: 60 parts of glucose, 3.5 parts of yeast powder, 3 parts of monopotassium phosphate, 25 parts of ammonium sulfate, 0.01 part of manganese sulfate, 5 parts of magnesium sulfate, 10 parts of monosodium glutamate, 15 parts of corn steep liquor dry powder and 25 parts of calcium carbonate, wherein the pH value is 7.0-7.2;

the fermentation condition is 36 ℃, and the fermentation time is 48 h.

According to the technical scheme, the invention provides the bacillus subtilis and the construction method and application thereof. The bacillus subtilis is purD in bacillus subtilis strain^P116L、purR^A65DOr guaB^G279RAt least one site of the above-mentioned gene has undergone point mutation. purD^P116LOr purR^A65DUnder the condition of the mutation of (a), the feedback inhibition or feedback repression of the adenosine synthesis pathway is released, guaB^G279RThe competitive metabolic pathway of adenosine is blocked under the mutation condition, and the large accumulation of adenosine can be realized. purD^P116L、purR^A65DOr guaB^G279RThe single site mutation respectively obtains strains of bacillus subtilis A1, B.subtilis A2 and B.subtilis A3. The B.subtilis168 (delta upp) strain is transformed by three single point mutation plasmids in sequence to obtain the Bacillus subtilis A5 with point mutation at three sites. Experiments show that compared with the starting strain B.subtiliss 168-delta upp, the adenosine accumulation of the engineering bacteria is improved, the accumulation of A1 is minimum, the accumulation of A2 is more, the accumulation of A3 is less than that of A2, the accumulation of guanosine is reduced, the accumulation of adenosine of the A5 strain with point mutation at all three sites is maximum, and the mutation at the three sites plays a main role in adenosine accumulation. The bacillus subtilis is an adenosine high-yield strain, can effectively accumulate adenosine, improves the yield of the adenosine, and lays a foundation for the industrial production of the adenosine.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below.

FIG. 1 shows a comparison of the production levels of glycosides by the strains.

Detailed Description

The invention discloses bacillus subtilis and a construction method and application thereof. Those skilled in the art can modify the process parameters appropriately to achieve the desired results with reference to the disclosure herein. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the methods and products of the present invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications of the methods described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of the present invention without departing from the spirit and scope of the invention.

In order to further understand the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Unless otherwise specified, the reagents involved in the examples of the present invention are all commercially available products, and all of them are commercially available. The original strain B.subtilis168 used in the invention is derived from BGSC (Bacillus Genetic Stock Center, http:// www.bgsc.org /). Adenosine standards used in the present invention were purchased from Sigma (http:// www.sigmaaldrich.com/Sigma-aldrich), molecular biological reagents used such as DNA polymerase, DNA purification kit, restriction enzyme, dephosphorylating enzyme, DNA ligase and the like were purchased from Thermo (http:// www.thermoscientificbio.com/fermentas), and other biochemical reagents used were purchased from Biotechnology (Shanghai) GmbH (http:// www.sangon.com /).

The primer sequences related to the examples are shown in Table 1.

TABLE 1 primer sequences

Primer and method for producing the same	Sequence 5'→ 3'	Sequence numbering
			upp-1f	acgcgtcgaccaggagcaagtgcgtatc	SEQ ID No.1
upp-1r	atctccgagacctggaacacctttcccatactgtgttt	SEQ ID No.2
			upp-2f	aaacacagtatgggaaaggtgttccaggtctcggagat	SEQ ID No.3
upp-2r	aaaactgcaggccacagtaatcatcagaatg	SEQ ID No.4
			purD-1f	acgcgtcgactcgaagaagcggcaaaagcgg	SEQ ID No.5
purD-1r	ttctgcggtcagaatgtcgtatttcttc	SEQ ID No.6
			purD-2f	aatacgacattctgaccgcagaatacgag	SEQ ID No.7
purD-2r	aaaactgcagtcaatgaccttcgagccgttttc	SEQ ID No.8
			purR-1f	acgcgtcgacgaagatgtgcagccggttaggc	SEQ ID No.9
purR-1r	cgcctccggcatctccgggaacagtaag	SEQ ID No.10
			purR-2f	tgttcccggagatgccggaggcgttaaat	SEQ ID No.11
purR-2r	aaaactgcagctaagacgccgattcccgccac	SEQ ID No.12
			guaB-1f	acgcgtcgaccaagacagggcggcttgggcat	SEQ ID No.13
guaB-1r	ttaaacattattgctagaaacgtggcatc	SEQ ID No.14
			guaB-2f	aacattattgctagaaacgtggcaacag	SEQ ID No.15
gauB-2r	aaaactgcagcggtataccttaaatcttctgcc	SEQ ID No.16

Example 1: mutagenesis screening to obtain adenosine high-yield strain

B.subtilis168 is used as an original strain, the B.subtilis168 strain is subjected to conventional mutagenesis treatment by ultraviolet 15W, 30cm and 20min, and then is subjected to mutagenesis by nitrosoguanidine under the conditions of 0.4mg/mL, 36 ℃ and 20 min; then coating the strain on a basic culture medium (g/L: glucose 20, ammonium sulfate 2, magnesium sulfate 0.4, calcium chloride 0.02, ferrous sulfate 0.02, disodium hydrogen phosphate 1.5, zinc sulfate 0.01, manganese sulfate 0.01, potassium dihydrogen phosphate 1.5 and agar 18, wherein the pH value is 7.0-7.2) containing 0.2 g/L8-azaguanine, culturing at 36 ℃ for 24 hours, selecting the strain with the best growth vigor for the next round of mutagenesis, increasing the concentration of the 8-azaguanine in the basic culture medium, and obtaining a B.subtiliss MHA strain after multiple rounds of mutagenesis and screening, wherein the strain can grow on the 8-azaguanine culture medium containing 1g/L, the shaking flask adenosine production level of the B.subtiliss MHA is 10g/L, the conversion rate is 14%, and the strain is a high-adenosine yield strain.

By comparative genomic analysis, B.subtilis MHA has purD^P116L、purR^A65DAnd guaB^G279RPoint mutations of three key genes, which may be factors promoting high adenosine production.

Example 2: construction of B.subtiliss 168 (delta upp) Strain by Gene traceless editing method

Bacillus subtilis168 is used as a starting strain, a gene traceless editing method used in the invention is based on a temperature-sensitive plasmid-mediated two-step integration and upp reverse screening principle, a transformation method is used, and the editing process can be referred to as an Applied Microbiology and Biotechnology 2014,98(21):8963-8973.Zhang W, Gao W, Feng J, et al.

Using primers upp-1f/1r and upp-2f/2r, using B.subtiliss 168 genome as a template, using pfu DNA polymerase to amplify to respectively obtain upstream and downstream homologous arms of 888bp and 938bp, using the primers upp-1f/2r to amplify to obtain upstream and downstream fusion fragments, carrying out SalI/PstI double digestion, connection, transformation and other operations on the fragments and pKS 7 (tool vector) plasmid to obtain plasmid pKS 7-delta upp, transforming the plasmid pKS 7-delta upp into B.subtiliss 168 through Spizzen, using an LB plate containing 2.5 mu g/mL chloramphenicol to screen transformants at 30 ℃, connecting the obtained transformants into 5mL LB liquid, culturing at 42 ℃ and 200rpm for 12h and transferring one generation, diluting and coating the LB plate containing 5 mu g/mL to obtain primary recombinants; the primary recombinants were inoculated into 5ml of LB liquid, cultured at 42 ℃ for 12 hours at 200rpm and passed one generation, diluted and spread on LB plates containing 0.8. mu.M 5-FU to screen secondary recombinants, and B.subtiliss 168 (. DELTA.upp) strain was obtained.

Example 3: engineering strain B.subtilisa1 (purD)^P116L)，A2(purR^A65D)，A3(guaB^G279R) Construction of

Amplifying by using pfu high-fidelity DNA polymerase with primers purD-1f/1r, purD-2f/2r, purR-1f/1r, purR-2f/2r, guaB-1f/1r and guaB-2f/2r and B.subtilis168 genome as a template to obtain upper and lower homologous arms of purD, purR and guaB respectively; fusing upstream and downstream fragments with primers purD-1f/2r, purR-1f/2r and guaB-1f/2r to obtain purD homologous fragment (containing P116L mutation, complete purD gene nucleotide sequence shown in SEQ ID No.17 and 1269bp totally, amino acid sequence shown in SEQ ID No.18 and 422 amino acids totally), purR homologous fragment (containing A65D mutation, complete purR gene nucleotide sequence shown in SEQ ID No.19 and 858bp totally, amino acid sequence shown in SEQ ID No.20 and 285 amino acids totally) and guaB homologous fragment (containing G279R mutation, complete guaB gene nucleotide sequence shown in SEQ ID No.21 and 1467bp totally, amino acid sequence shown in SEQ ID No.22 and 488 amino acids totally), and ligating the 3 fragments with pKI (tool PsI/279, Sal I-DNA fragment and the like to obtain plasmid, pKSU-purR and pKSU-guaB. The transformation and screening methods are the sameExample 2, the introduction of purD into B.subtiliss 168 (. DELTA.upp) was obtained^P116LSubtilis A1 Strain of (1), purR was introduced^A65DSubtilis A2 strain of (1), introduced guaB^G279RThe strain of subflis a 3.

Example 4: engineering strain B.subtilis A5 construction (purD is introduced)^P116L、guaB^G279R&purR^A65DMutation)

The plasmid pKSU-purR is transformed into a B.subtilis A1 strain to obtain an engineering bacterium B.subtilis A4 (purD)^P116L&purR^A65DMutation), the screening method was the same as in example 3; the plasmid pKSU-guaB was transformed into B.subtilis A4 strain to obtain the engineered strain B.subtilis A5 (purD)^P116L、guaB^G279R&purR^A65DMutation), the screening method was the same as in example 3.

The LB liquid culture medium formula is: 10g/L peptone, 5g/L yeast extract, 10g/L NaCl, adjusting pH to 7.2, and sterilizing at 0.15MPa for 20 min. The LB solid culture medium formula is: agar powder (final concentration 18g/L) was added to LB liquid medium and sterilized at 121 ℃ for 20 min. The formulation of Spizizen transformation medium is shown in Table 2.

TABLE 2 Spizizen transformation Medium formulation

Note: the percentage concentrations of the components are mass volume percent (mg/mL).

Example 5: engineering strains B.subtilis-delta upp, A1, A2, A3, A5 and MHA adenosine synthesis ability comparison.

1. Culture medium:

(1) seed culture medium formula (g/L): 20 parts of glucose, 5 parts of yeast powder, 5 parts of corn steep liquor dry powder, 3 parts of monopotassium phosphate, 0.5 part of magnesium sulfate, 0.02 part of ferrous sulfate, 0.01 part of manganese sulfate, 7.0-7.2 parts of pH, and sterilizing for 20min at 121 ℃.

(2) Fermentation medium formula (g/L): 60 parts of glucose, 3.5 parts of yeast powder, 3 parts of monopotassium phosphate, 25 parts of ammonium sulfate, 0.01 part of manganese sulfate, 5 parts of magnesium sulfate, 10 parts of monosodium glutamate, 15 parts of corn steep liquor dry powder and 25 parts of calcium carbonate, wherein the pH value is 7.0-7.2, and the corn steep liquor is sterilized at 121 ℃ for 20 min.

2. Culture method

(1) Streaking an LB plate on a three-region strain, and culturing at 37 ℃ overnight;

(2) selecting a single colony, inoculating the single colony into 30mL of seed culture medium, and culturing at 110rpm and 36 ℃ for 7-8 h;

(3) transferring the strain to 30ml of fermentation medium according to the inoculation amount of 10%, and culturing for 36h at the rotating speed of 120rpm of a shaking table and the temperature of 36 ℃;

the fermentation results are shown in FIG. 1, and it can be seen from the results that the adenosine accumulation of the engineering bacteria is improved compared with the original strain B.subtiliss 168-delta upp, A1 (purD)^P116L)、A2(purR^A65D) And A3 (guaB)^G279R) The single-point engineering bacteria respectively accumulate adenosine 1.2g/L, adenosine 3.8g/L and adenosine 2.6g/L, the accumulation of A1 is minimum, and purD genes are probably not key sites; a2 accumulates most, purR^A65DThe introduction of the fusion protein weakens the repression effect of the PurR protein on the pur operon and improves the overall expression level of the pur operon; a3 (guaB)^G279R) The strain accumulated 2.6g/L adenosine and decreased guanosine accumulation, indicating that guaB^G279RMutations weaken the guanosine branch. Double mutation engineering bacterium A4 (purD)^P116L&purR^A65D) When adenosine accumulates 5.2g/L and guanosine accumulates 1.2g/L, guaB was introduced^G279RWhen in mutation, the A5 strain only accumulates guanosine of 0.2g/L and adenosine of 8.9g/L, which indicates that the mutation at the three sites plays a main role in adenosine accumulation.

The construction of the strain of the present invention, the order of the steps is not limited, and those skilled in the art can achieve the object of the present invention according to the disclosure of the present invention, all of which belong to the protection scope of the present invention.

The codes of the strains, such as B.subtilis A1 and B.subtilis A2, are for convenience of description and should not be construed as limiting the invention. The purD containing bacillus subtilis glycinamide nucleotide synthetase mutant gene constructed by the method^P116LInosinate dehydrogenase mutant Gene guaB^G279RAnd transcription regulator mutant Gene purR^A65DThe use of the engineered bacteria of (1), including but not limited to adenosine.

Sequence listing

<110> Gallery plum blossom Biotechnology development Co., Ltd

<120> bacillus subtilis and construction method and application thereof

<130> MP1832875

<160> 22

<170> SIPOSequenceListing 1.0

<210> 1

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

acgcgtcgac caggagcaag tgcgtatc 28

<210> 2

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atctccgaga cctggaacac ctttcccata ctgtgttt 38

<210> 3

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aaacacagta tgggaaaggt gttccaggtc tcggagat 38

<210> 4

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

aaaactgcag gccacagtaa tcatcagaat g 31

<210> 5

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

acgcgtcgac tcgaagaagc ggcaaaagcg g 31

<210> 6

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ttctgcggtc agaatgtcgt atttcttc 28

<210> 7

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

aatacgacat tctgaccgca gaatacgag 29

<210> 8

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

aaaactgcag tcaatgacct tcgagccgtt ttc 33

<210> 9

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

acgcgtcgac gaagatgtgc agccggttag gc 32

<210> 10

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

cgcctccggc atctccggga acagtaag 28

<210> 11

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

tgttcccgga gatgccggag gcgttaaat 29

<210> 12

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

aaaactgcag ctaagacgcc gattcccgcc ac 32

<210> 13

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

acgcgtcgac caagacaggg cggcttgggc at 32

<210> 14

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ttaaacatta ttgctagaaa cgtggcatc 29

<210> 15

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

aacattattg ctagaaacgt ggcaacag 28

<210> 16

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

aaaactgcag cggtatacct taaatcttct gcc 33

<210> 17

<211> 1269

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

gtgaatgtat taattatcgg taaaggcgga agagaacata cgctggcgtg gaaggcagcg 60

caaagcagcc tcgtcgagaa tgtatttgcc gctcccggaa atgacggcat ggcagcttcc 120

gctcagcttg taaacattga ggaaagcgac cacgcagggc ttgtctcatt tgcaaaacaa 180

aatcaggtcg gcctgaccat tgtcggccct gaggttcctt taattgaagg tctggtggat 240

gaattcgaaa aagcgggctt acatgtgttc ggtccgtcaa aagctgcggc gatcatcgaa 300

ggaagcaaac agttcgctaa ggatttaatg aagaaatacg acattctgac cgcagaatac 360

gagacgttta catcctttga tgaggcgaag gcatatgtgc aggaaaaagg tgctccgatt 420

gtgataaaag cagatggact tgcagctgga aaaggcgtta ctgtggctat gacagaggaa 480

gaagcaattg cgtgcttgca tgactttctt gaagatgaaa agttcggtga tgcgagcgcg 540

tccgttgtca ttgaagaata tctttctggt gaagaatttt ctctaatggc ctttgtcaaa 600

ggggaaaagg tgtatccgat ggtgattgcc caggatcaca agcgggcgtt tgacggagac 660

aaaggcccga atacaggcgg catgggcgcc tactcgccag ttccgcaaat ttcggaagaa 720

acggtccgcc atgctgtaga aacgatcgtt aagccggctg caaaagcaat ggtacaagaa 780

ggccgttcct tcactggcgt tttgtacgct ggattgatgc ttactgaaaa cggctcgaag 840

gtcattgaat ttaatgcccg tttcggcgat ccggaaacac aggtcgtgct tccgcgcatg 900

gaatctgatc tggtacaggt gcttcttgat cttttagatg ataaggaagt tgacttaaga 960

tggaaggata ccgcggcagt gagtgttgtg cttgcatcag aagggtatcc ggaaagctat 1020

gcaaaaggca cgccgatcgg cagccttgca gcagaaactg agcaggtcgt ggtcttccat 1080

gccggaacga aagcagaagg tggagagttc gttacaaacg gggggcgcgt cgccaatgtg 1140

acggcttttg atgaaacgtt tgaagcggct agagaccgag tgtacaaagc ggttgatgaa 1200

attttcaaac cgggactctt tttcagaaaa gacattgggg cacgcgcttt aaaggctgcc 1260

caaaaataa 1269

<210> 18

<211> 422

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 18

Val Asn Val Leu Ile Ile Gly Lys Gly Gly Arg Glu His Thr Leu Ala

1 5 10 15

Trp Lys Ala Ala Gln Ser Ser Leu Val Glu Asn Val Phe Ala Ala Pro

20 25 30

Gly Asn Asp Gly Met Ala Ala Ser Ala Gln Leu Val Asn Ile Glu Glu

35 40 45

Ser Asp His Ala Gly Leu Val Ser Phe Ala Lys Gln Asn Gln Val Gly

50 55 60

Leu Thr Ile Val Gly Pro Glu Val Pro Leu Ile Glu Gly Leu Val Asp

65 70 75 80

Glu Phe Glu Lys Ala Gly Leu His Val Phe Gly Pro Ser Lys Ala Ala

85 90 95

Ala Ile Ile Glu Gly Ser Lys Gln Phe Ala Lys Asp Leu Met Lys Lys

100 105 110

Tyr Asp Ile Leu Thr Ala Glu Tyr Glu Thr Phe Thr Ser Phe Asp Glu

115 120 125

Ala Lys Ala Tyr Val Gln Glu Lys Gly Ala Pro Ile Val Ile Lys Ala

130 135 140

Asp Gly Leu Ala Ala Gly Lys Gly Val Thr Val Ala Met Thr Glu Glu

145 150 155 160

Glu Ala Ile Ala Cys Leu His Asp Phe Leu Glu Asp Glu Lys Phe Gly

165 170 175

Asp Ala Ser Ala Ser Val Val Ile Glu Glu Tyr Leu Ser Gly Glu Glu

180 185 190

Phe Ser Leu Met Ala Phe Val Lys Gly Glu Lys Val Tyr Pro Met Val

195 200 205

Ile Ala Gln Asp His Lys Arg Ala Phe Asp Gly Asp Lys Gly Pro Asn

210 215 220

Thr Gly Gly Met Gly Ala Tyr Ser Pro Val Pro Gln Ile Ser Glu Glu

225 230 235 240

Thr Val Arg His Ala Val Glu Thr Ile Val Lys Pro Ala Ala Lys Ala

245 250 255

Met Val Gln Glu Gly Arg Ser Phe Thr Gly Val Leu Tyr Ala Gly Leu

260 265 270

Met Leu Thr Glu Asn Gly Ser Lys Val Ile Glu Phe Asn Ala Arg Phe

275 280 285

Gly Asp Pro Glu Thr Gln Val Val Leu Pro Arg Met Glu Ser Asp Leu

290 295 300

Val Gln Val Leu Leu Asp Leu Leu Asp Asp Lys Glu Val Asp Leu Arg

305 310 315 320

Trp Lys Asp Thr Ala Ala Val Ser Val Val Leu Ala Ser Glu Gly Tyr

325 330 335

Pro Glu Ser Tyr Ala Lys Gly Thr Pro Ile Gly Ser Leu Ala Ala Glu

340 345 350

Thr Glu Gln Val Val Val Phe His Ala Gly Thr Lys Ala Glu Gly Gly

355 360 365

Glu Phe Val Thr Asn Gly Gly Arg Val Ala Asn Val Thr Ala Phe Asp

370 375 380

Glu Thr Phe Glu Ala Ala Arg Asp Arg Val Tyr Lys Ala Val Asp Glu

385 390 395 400

Ile Phe Lys Pro Gly Leu Phe Phe Arg Lys Asp Ile Gly Ala Arg Ala

405 410 415

Leu Lys Ala Ala Gln Lys

420

<210> 19

<211> 858

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

atgaagtttc gtcgcagcgg cagattggtg gacttaacaa attatttgtt aacccatccg 60

cacgagttaa taccgctaac ctttttctct gagcggtatg aatctgcaaa atcatcgatc 120

agtgaagatt taacaattat taaacaaacc tttgaacagc aggggattgg tactttgctt 180

actgttcccg gagatgccgg aggcgttaaa tatattccga aaatgaagca ggctgaagct 240

gaagagtttg tgcagacact tggacagtcg ctggcaaatc ctgagcgtat ccttccgggc 300

ggttatgtat atttaacgga tatcttagga aagccatctg tactctccaa ggtagggaag 360

ctgtttgctt ccgtgtttgc agagcgcgaa attgatgttg tcatgaccgt tgccacgaaa 420

ggcatccctc ttgcgtacgc agctgcaagc tatttgaatg tgcctgttgt gatcgttcgt 480

aaagacaata aggtaacaga gggctccaca gtcagcatta attacgtttc aggctcctca 540

aaccgcattc aaacaatgtc acttgcgaaa agaagcatga aaacgggttc aaacgtactc 600

attattgatg actttatgaa agcaggcggc accattaatg gtatgattaa cctgttggat 660

gagtttaacg caaatgtggc gggaatcggc gtcttagttg aagccgaagg agtagatgaa 720

cgtcttgttg acgaatatat gtcacttctt actctttcaa ccatcaacat gaaagagaag 780

tccattgaaa ttcagaatgg caattttctg cgttttttta aagacaatct tttaaagaat 840

ggagagacag aatcatga 858

<210> 20

<211> 285

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 20

Met Lys Phe Arg Arg Ser Gly Arg Leu Val Asp Leu Thr Asn Tyr Leu

1 5 10 15

Leu Thr His Pro His Glu Leu Ile Pro Leu Thr Phe Phe Ser Glu Arg

20 25 30

Tyr Glu Ser Ala Lys Ser Ser Ile Ser Glu Asp Leu Thr Ile Ile Lys

35 40 45

Gln Thr Phe Glu Gln Gln Gly Ile Gly Thr Leu Leu Thr Val Pro Gly

50 55 60

Asp Ala Gly Gly Val Lys Tyr Ile Pro Lys Met Lys Gln Ala Glu Ala

65 70 75 80

Glu Glu Phe Val Gln Thr Leu Gly Gln Ser Leu Ala Asn Pro Glu Arg

85 90 95

Ile Leu Pro Gly Gly Tyr Val Tyr Leu Thr Asp Ile Leu Gly Lys Pro

100 105 110

Ser Val Leu Ser Lys Val Gly Lys Leu Phe Ala Ser Val Phe Ala Glu

115 120 125

Arg Glu Ile Asp Val Val Met Thr Val Ala Thr Lys Gly Ile Pro Leu

130 135 140

Ala Tyr Ala Ala Ala Ser Tyr Leu Asn Val Pro Val Val Ile Val Arg

145 150 155 160

Lys Asp Asn Lys Val Thr Glu Gly Ser Thr Val Ser Ile Asn Tyr Val

165 170 175

Ser Gly Ser Ser Asn Arg Ile Gln Thr Met Ser Leu Ala Lys Arg Ser

180 185 190

Met Lys Thr Gly Ser Asn Val Leu Ile Ile Asp Asp Phe Met Lys Ala

195 200 205

Gly Gly Thr Ile Asn Gly Met Ile Asn Leu Leu Asp Glu Phe Asn Ala

210 215 220

Asn Val Ala Gly Ile Gly Val Leu Val Glu Ala Glu Gly Val Asp Glu

225 230 235 240

Arg Leu Val Asp Glu Tyr Met Ser Leu Leu Thr Leu Ser Thr Ile Asn

245 250 255

Met Lys Glu Lys Ser Ile Glu Ile Gln Asn Gly Asn Phe Leu Arg Phe

260 265 270

Phe Lys Asp Asn Leu Leu Lys Asn Gly Glu Thr Glu Ser

275 280 285

<210> 21

<211> 1467

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

atgtgggaaa gtaaattttc aaaagaaggc ttaacgttcg acgatgtgct gcttgtacca 60

gcaaagtctg aggtacttcc gcgtgatgtg gatttatctg tagaacttac aaaaacgtta 120

aagctaaata ttcctgtcat cagcgcaggt atggacactg taacagaatc agcaatggca 180

attgcaatgg caagacaggg cggcttgggc atcattcaca aaaatatgtc cattgaacag 240

caggctgaac aagttgataa agtaaagcgt tctgagcgcg gcgttatcac aaatcccttc 300

tttttaactc ctgatcacca agtatttgat gcggagcatt tgatggggaa atacagaatt 360

tccggtgttc cgattgtaaa taacgaagaa gaccagaagc ttgttggaat tattacaaac 420

cgtgaccttc gttttatttc tgactactca atgaaaatca gcgacgtcat gacgaaagaa 480

gagctagtta ctgcatctgt aggaactact ctggatgaag ctgaaaagat tttgcagaaa 540

cataaaattg aaaagcttcc tctcgtagat gaccagaata aattaaaagg tcttatcaca 600

attaaagaca ttgaaaaagt cattgagttc ccgaactcat ctaaagacat tcacggccgc 660

ctgatcgttg gcgcggcagt tggtgtaact ggcgatacaa tgactcgcgt caaaaagctt 720

gttgaagcca atgttgatgt gattgttatc gatacagctc acggacactc tcaaggcgtt 780

ttaaacacag tcacaaaaat ccgtgaaacg tatcccgaat taaacattat tgctagaaac 840

gtggcaacag ctgaagcgac aagagcgctt atcgaagctg gagcagacgt tgtcaaagtt 900

ggaatagggc ctggttcaat ttgtactaca cgtgttgtag ccggcgtggg tgttccgcaa 960

attacagcaa tttatgattg tgcgactgaa gcaagaaaac acggcaaaac aatcatcgcc 1020

gacggtggga ttaaattctc tggcgatatc actaaagcat tggcagccgg cggacatgct 1080

gttatgctcg gaagcttgct tgcaggcaca tcagaaagcc ctggtgaaac tgaaatctac 1140

caaggcagaa gatttaaggt ataccgcggc atgggatcag ttgctgcaat ggaaaaagga 1200

agtaaagacc gttacttcca agaagaaaac aaaaaatttg ttcctgaagg aattgaagga 1260

cgcacacctt acaaagggcc agttgaagaa accgtttatc agctagtcgg aggccttcgt 1320

tctggtatgg ggtattgcgg gtccaaagat ctgcgtgcgc taagagaaga agctcagttc 1380

attcgcatga ctggcgcagg acttcgcgaa agccatccgc atgacgtaca gattacaaaa 1440

gaatcaccta actatacaat ttcataa 1467

<210> 22

<211> 488

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 22

Met Trp Glu Ser Lys Phe Ser Lys Glu Gly Leu Thr Phe Asp Asp Val

1 5 10 15

Leu Leu Val Pro Ala Lys Ser Glu Val Leu Pro Arg Asp Val Asp Leu

20 25 30

Ser Val Glu Leu Thr Lys Thr Leu Lys Leu Asn Ile Pro Val Ile Ser

35 40 45

Ala Gly Met Asp Thr Val Thr Glu Ser Ala Met Ala Ile Ala Met Ala

50 55 60

Arg Gln Gly Gly Leu Gly Ile Ile His Lys Asn Met Ser Ile Glu Gln

65 70 75 80

Gln Ala Glu Gln Val Asp Lys Val Lys Arg Ser Glu Arg Gly Val Ile

85 90 95

Thr Asn Pro Phe Phe Leu Thr Pro Asp His Gln Val Phe Asp Ala Glu

100 105 110

His Leu Met Gly Lys Tyr Arg Ile Ser Gly Val Pro Ile Val Asn Asn

115 120 125

Glu Glu Asp Gln Lys Leu Val Gly Ile Ile Thr Asn Arg Asp Leu Arg

130 135 140

Phe Ile Ser Asp Tyr Ser Met Lys Ile Ser Asp Val Met Thr Lys Glu

145 150 155 160

Glu Leu Val Thr Ala Ser Val Gly Thr Thr Leu Asp Glu Ala Glu Lys

165 170 175

Ile Leu Gln Lys His Lys Ile Glu Lys Leu Pro Leu Val Asp Asp Gln

180 185 190

Asn Lys Leu Lys Gly Leu Ile Thr Ile Lys Asp Ile Glu Lys Val Ile

195 200 205

Glu Phe Pro Asn Ser Ser Lys Asp Ile His Gly Arg Leu Ile Val Gly

210 215 220

Ala Ala Val Gly Val Thr Gly Asp Thr Met Thr Arg Val Lys Lys Leu

225 230 235 240

Val Glu Ala Asn Val Asp Val Ile Val Ile Asp Thr Ala His Gly His

245 250 255

Ser Gln Gly Val Leu Asn Thr Val Thr Lys Ile Arg Glu Thr Tyr Pro

260 265 270

Glu Leu Asn Ile Ile Ala Arg Asn Val Ala Thr Ala Glu Ala Thr Arg

275 280 285

Ala Leu Ile Glu Ala Gly Ala Asp Val Val Lys Val Gly Ile Gly Pro

290 295 300

Gly Ser Ile Cys Thr Thr Arg Val Val Ala Gly Val Gly Val Pro Gln

305 310 315 320

Ile Thr Ala Ile Tyr Asp Cys Ala Thr Glu Ala Arg Lys His Gly Lys

325 330 335

Thr Ile Ile Ala Asp Gly Gly Ile Lys Phe Ser Gly Asp Ile Thr Lys

340 345 350

Ala Leu Ala Ala Gly Gly His Ala Val Met Leu Gly Ser Leu Leu Ala

355 360 365

Gly Thr Ser Glu Ser Pro Gly Glu Thr Glu Ile Tyr Gln Gly Arg Arg

370 375 380

Phe Lys Val Tyr Arg Gly Met Gly Ser Val Ala Ala Met Glu Lys Gly

385 390 395 400

Ser Lys Asp Arg Tyr Phe Gln Glu Glu Asn Lys Lys Phe Val Pro Glu

405 410 415

Gly Ile Glu Gly Arg Thr Pro Tyr Lys Gly Pro Val Glu Glu Thr Val

420 425 430

Tyr Gln Leu Val Gly Gly Leu Arg Ser Gly Met Gly Tyr Cys Gly Ser

435 440 445

Lys Asp Leu Arg Ala Leu Arg Glu Glu Ala Gln Phe Ile Arg Met Thr

450 455 460

Gly Ala Gly Leu Arg Glu Ser His Pro His Asp Val Gln Ile Thr Lys

465 470 475 480

Glu Ser Pro Asn Tyr Thr Ile Ser

485

Claims (8)

1. The bacillus subtilis is characterized by being any one of the following bacillus subtilis:

bacillus subtilis with purD P116L point mutation;

purR A65D point mutated Bacillus subtilis;

bacillus subtilis with a guaB G279R point mutation;

purD P116L and purR A65D point mutated Bacillus subtilis;

purD P116L, purR A65D and guaB G279R point-mutated Bacillus subtilis;

wherein the strain before point mutation is engineering bacterium B.subtilis 168.

2. The method for constructing Bacillus subtilis according to claim 1, comprising:

a, constructing a bacillus subtilis (delta upp) strain by adopting a gene traceless editing method;

step B, three point mutation gene fragments of purD P116L, purR A65D and guaB G279R are respectively prepared and are connected with a vector to respectively obtain three single point mutation plasmids;

step C, respectively or sequentially transforming the three single-point mutant plasmids into a bacillus subtilis (delta upp) strain to obtain single-site mutant bacillus subtilis or bacillus subtilis with multiple site mutations;

the bacillus subtilis (delta upp) strain is a B.subtilis168 strain.

3. The method for constructing the bacillus subtilis (Δ upp) strain according to claim 2, wherein primers upp-1f/1r and upp-2f/2r are used in the step A, and a B.subtiliss 168 genome is used as a template, and pfu DNA polymerase is used for amplification to obtain upstream and downstream homology arms of 888bp and 938bp respectively; amplifying by using a primer upp-1f/2r to obtain an upstream fusion fragment and a downstream fusion fragment, connecting the fragments with a vector plasmid, and transforming the fragments into a B.subtiliss 168 strain through Spizisen to obtain the B.subtiliss 168 (delta upp) strain;

wherein the sequence of upp-1f is shown as SEQ ID No. 1; the sequence of upp-1r is shown as SEQ ID No. 2; the sequence of upp-2f is shown as SEQ ID No. 3; the sequence of upp-2r is shown as SEQ ID No. 4.

4. The construction method according to claim 3, wherein the screening is specifically that LB plate containing 2.5 μ g/mL chloramphenicol is used for screening transformants at 30 ℃, the obtained transformants are inoculated into LB liquid, cultured at 42 ℃ and 200rpm for 12h and passed for generation, and diluted and coated with LB plate containing 5 μ g/mL chloramphenicol to obtain primary recombinants; the primary recombinants were inoculated into LB liquid, cultured at 42 ℃ for 12 hours at 200rpm and passed one generation, and diluted and spread on LB plates containing 0.8. mu.M 5-FU to screen the secondary recombinants, i.e., B.subtiliss 168 (. DELTA.upp) strain.

5. The method according to claim 2 or 3, wherein the vector of step B is pKSU.

6. Use of the Bacillus subtilis of claim 1 for the fermentative production of adenosine.

7. A method for producing adenosine, which comprises inoculating the Bacillus subtilis of claim 1 into a seed culture medium for propagation, and transferring the propagated culture into a fermentation culture medium for fermentation.

8. The production method according to claim 7, wherein the seed culture medium formula (g/L): 20 parts of glucose, 5 parts of yeast powder, 5 parts of corn steep liquor dry powder, 3 parts of monopotassium phosphate, 0.5 part of magnesium sulfate, 0.02 part of ferrous sulfate, 0.01 part of manganese sulfate and 7.0-7.2 parts of pH;

the formula (g/L) of the fermentation medium is as follows: 60 parts of glucose, 3.5 parts of yeast powder, 3 parts of monopotassium phosphate, 25 parts of ammonium sulfate, 0.01 part of manganese sulfate, 5 parts of magnesium sulfate, 10 parts of monosodium glutamate, 15 parts of corn steep liquor dry powder and 25 parts of calcium carbonate, wherein the pH value is 7.0-7.2;

the fermentation condition is 36 ℃, and the fermentation time is 48 h.

Images